Cellular senescence is an important mechanism of tumor regression upon c-Myc inactivation.

Abstract

Oncogene-induced senescence is an important mechanism by which normal cells are restrained from malignant transformation. Here we report that the suppression of the c-Myc (MYC) oncogene induces cellular senescence in diverse tumor types including lymphoma, osteosarcoma, and hepatocellular carcinoma. MYC inactivation was associated with prototypical markers of senescence, including acidic beta-gal staining, induction of p16INK4a, and p15INK4b expression. Moreover, MYC inactivation induced global changes in chromatin structure associated with the marked reduction of histone H4 acetylation and increased histone H3 K9 methylation. Osteosarcomas engineered to be deficient in p16INK4a or Rb exhibited impaired senescence and failed to exhibit sustained tumor regression upon MYC inactivation. Similarly, only after lymphomas were repaired for p53 expression did MYC inactivation induce robust senescence and sustained tumor regression. The pharmacologic inhibition of signaling pathways implicated in oncogene-induced senescence including ATM/ATR and MAPK did not prevent senescence associated with MYC inactivation. Our results suggest that cellular senescence programs remain latently functional, even in established tumors, and can become reactivated, serving as a critical mechanism of oncogene addiction associated with MYC inactivation.

Full text

Page 1

Cellular senescence is an important mechanism
of tumor regression upon c-Myc inactivation
Chi-Hwa Wu, Jan van Riggelen, Alper Yetil, Alice C. Fan, Pavan Bachireddy, and Dean W. Felsher*
Departments of Medicine and Pathology, Division of Oncology, Stanford University School of Medicine, Stanford University, Stanford, CA 94305
Edited by Peter K. Vogt, The Scripps Research Institute, La Jolla, CA, and approved June 28, 2007 (received for review March 6, 2007)
Oncogene-induced senescence is an important mechanism by
which normal cells are restrained from malignant transformation.
Here we report that the suppression of the c-Myc (MYC) oncogene
induces cellular senescence in diverse tumor types including lym-
phoma, osteosarcoma, and hepatocellular carcinoma. MYC inacti-
vation was associated with prototypical markers of senescence,
including acidic ?-gal staining, induction of p16INK4a, and
p15INK4b expression. Moreover, MYC inactivation induced global
changes in chromatin structure associated with the marked reduc-
tion of histone H4 acetylation and increased histone H3 K9 meth-
ylation. Osteosarcomas engineered to be deficient in p16INK4a or
Rb exhibited impaired senescence and failed to exhibit sustained
tumor regression upon MYC inactivation. Similarly, only after
lymphomas were repaired for p53 expression did MYC inactivation
induce robust senescence and sustained tumor regression. The
pharmacologic inhibition of signaling pathways implicated in
oncogene-induced senescence including ATM/ATR and MAPK did
not prevent senescence associated with MYC inactivation. Our
results suggest that cellular senescence programs remain latently
functional, even in established tumors, and can become reacti-
vated, serving as a critical mechanism of oncogene addiction
associated with MYC inactivation.
oncogene addiction ? tumorigenesis ? tumor maintenance
T
such as cellular proliferation, growth, apoptosis, metabolism,
adhesion, protein synthesis, DNA replication, and angiogenesis
(1–3). The overexpression of c-Myc (MYC) is associated with
tumorigenesis in a wide range of human cancers by causing
inappropriate gene expression, resulting in autonomous cellular
proliferation, while blocking cellular differentiation (4, 5). Myc
is likely to contribute to tumorigenesis through an exaggeration
of its physiologic functions.
c-Myc forms heterodimeric complexes with Max to bind to a
DNA-motif called the E-box, thereby activating gene expression.
In addition, Max heterodimerizes with Mad family members
to antagonize Myc’s ability to induce transcription (6). Both
Myc:Max and Mad:Max complexes modulate gene expression by
several mechanisms, including recruitment of coregulatory com-
plexes that remodel the chromatin structure. Myc is known to
associate with histone acetyl-transferase complexes such as
TRRAP to induce the acetylation of nucleosomal histones,
which results in transcriptional activation (7). However, Mad
recruits histone deacetylases like Sin3, subsequently repressing
transcription of its target genes (8–10). The Myc:Max network
has been implicated in the regulation of hundreds of genes (2).
To understand how MYC initiates and maintains tumorigen-
esis, we and other groups have generated transgenic mice that
conditionally overexpress MYC under the regulation of tissue
specific promoters (11). Using the tetracycline regulatory system
(Tet-off), we overexpressed MYC in different cellular lineages
resulting in the formation of lymphomas, osteosarcomas, and
hepatocellular carcinomas. The inactivation of MYC stereotypi-
cally causes sustained tumor regression, although the specific
consequences depend upon the cell type (11–14). Upon MYC
he c-myc proto-oncogene encodes a transcription factor that
is known to play a crucial role in various biological processes
inactivation, lymphomas undergo proliferative arrest, differen-
tiation, and apoptosis associated with sustained regression in ?
70% of the transgenic mice. MYC inactivation in osteosarcoma
results in the differentiation into mature osteocytes and the
formation of bone but is not associated with significant apopto-
sis. In hepatocellular carcinoma, MYC inactivation also results
in differentiation of tumor cells, in this case, into normal
hepatocytes and biliary cells; however, a subpopulation of the
cells retains its neoplastic properties upon MYC inactivation,
henceexhibitingtumordormancy.Theinactivationofoncogenes
such as MYC can reverse the process of transformation even in
tumors with genomic complexity (15). However, the molecular
mechanism by which the inactivation of MYC or other onco-
genes induces tumor regression is still unclear.
Oncogene-induced senescence (OIS) is defined as irreversible
cell cycle arrest of normal cells upon overexpression of onco-
genes such as Ras and Raf (16, 17). OIS is believed to act as a
barrier for tumorigenesis both in mouse and human tissues
(17–21). Even though its molecular mechanism is not well
understood, cellular senescence is accompanied by hallmark
features including increased acidic ?-gal activity (22) and up-
regulation of cell cycle inhibitors like p15INK4b, p16INK4a, and
p21CIP (18, 20, 22–24). In addition, OIS is associated with global
changes in chromatin structure, in particular acetylation and
methylation of histones (21, 25), leading to heterochromatin
formation (18). Signaling pathways such as the DNA damage
response (26, 27), mitogen-activated protein kinase (MAPK)
(16, 28, 29), and the phosphoinositide-3 kinase (30, 31) are
implicated in OIS. Interestingly, tumor cells can reactivate
senescence pathways after treatment with chemotherapeutic
agents, strongly suggesting that this process is retained in tumor
cells (32).
Hence, we hypothesized that one possible mechanism by
which suppression of oncogenes such as MYC induces tumor
regression is by restoring cellular senescence programs. To
interrogate this possibility, we examined the consequences of
MYC inactivation in murine transgenic lymphoma, hepatocel-
lular carcinoma, and osteosarcoma.
Results
Tumor Regression upon MYC Inactivation Is Associated with Increased
Cellular Senescence Markers. The suppression of MYC in primary
MYC-induced lymphoma and hepatocellular carcinoma resulted
in senescence-associated acidic ?-gal (SA-?-Gal) staining (Fig.
Author contributions: C.-H.W., J.v.R., and D.W.F. designed research; C.-H.W., J.v.R., A.Y.,
A.C.F., and P.B. performed research; C.-H.W., J.v.R., A.Y., and D.W.F. contributed new
reagents/analytic tools; C.-H.W., J.v.R., A.Y., A.C.F., P.B., and D.W.F. analyzed data; and
C.-H.W., J.v.R., and D.W.F. wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
Abbreviations: MYC, c-Myc; OIS, oncogene-induced senescence; Sa-?-gal, senescence-
associated acidic ?-gal; shRNA, short hairpin RNA.
*To whom correspondence should be addressed. E-mail: dfelsher@stanford.edu.
This article contains supporting information online at www.pnas.org/cgi/content/full/
0701953104/DC1.
© 2007 by The National Academy of Sciences of the USA
13028–13033 ?
PNAS ?
August 7, 2007 ?
vol. 104 ?
no. 32 www.pnas.org?cgi?doi?10.1073?pnas.0701953104

Page 2

1A and data not shown). Moreover, MYC inactivation in trans-
planted liver tumors also was associated with induced SA-?-Gal
activity(Fig.1B).Notably,after5daysofMYCinactivation,liver
tumors no longer exhibited SA-?-Gal activity. As previously
reported, at this time point, the remaining tumor cells have
differentiated into normal liver cells (14). Therefore, tumor
regression in vivo appeared to be associated with cellular senes-
cence in primary lymphoma and liver tumors as well as in
transplanted liver tumors.
One possible explanation for our results is that cellular
senescence is occurring secondarily to a host-dependent mech-
anism such as hypoxia associated with tumor regression (33, 34).
To evaluate whether cellular senescence occurs through a cell-
autonomous versus a host-dependent mechanism, the conse-
quences of MYC inactivation were examined in lymphoma and
osteosarcoma-derived cell lines in vitro (12, 13). Multiple inde-
pendent tumors exhibited induction of SA-?-Gal activity upon
MYC inactivation [Fig. 2A and supporting information (SI) Fig.
5]. In addition, transplanted lymphoma cell lines also exhibited
SA-?-Gal activity upon MYC inactivation in vivo (Fig. 2A).
Hence, MYC inactivation results in cellular senescence through
a cell-autonomous mechanism.
To confirm further that MYC inactivation was resulting in
cellular senescence, we examined the expression of additional
molecular markers (17, 18, 20, 23, 32). Among them, p15INK4b
and p21CIP have been shown to be MYC targets (35, 36). Upon
MYC inactivation in vitro (SI Fig. 6), osteosarcoma cell lines
exhibited the induction of p15INK4b and p21CIP mRNA ex-
pression by quantitative RT-PCR (Fig. 2B) and p16INK4a
protein expression as shown by Western blot analysis (Fig. 2C).
Similarly, upon MYC inactivation in vivo (SI Fig. 6), hepatocel-
lular carcinomas exhibited induction of p15INK4b but did not
exhibit induction of p21CIP mRNA expression (Fig. 2B). Thus,
MYC inactivation resulted in the induction of p16INK4a and
p15INK4b and variably p21CIP, which has been associated with
cellular senescence.
MYC Inactivation Induces Global Changes in Chromatin Structure.
Cellular senescence is known to be associated with changes in
chromatin structure (18, 25). Moreover, MYC recently has been
shown to globally influence the acetylation and methylation of
histones (10). Therefore, we examined global chromatin modi-
ficationsassociatedwithcellularsenescenceinosteosarcomacell
linesinvitroandhepatocellularcarcinomainvivo.First,wefound
heterochromatin formation upon MYC inactivation in osteosar-
coma (Fig. 3A). After 12 h of MYC inactivation, there was
marked global reduction of total acetylation of histone H4
detected by immunofluorescence and Western blot analysis (Fig.
3 B and E), reduction of trimethyl K4 histone H3 (Fig. 3E), and
an increase of trimethyl K9 histone H3 (Fig. 3D). In contrast,
there was no change in total acetylation of histone H3 (Fig. 3 C
and E). Also, there was a global reduction in total histone H4
acetylation in transplanted hepatocellular carcinomas after 2
days of MYC inactivation (Fig. 3E). Hence, MYC inactivation
results in global changes of histone modifications that have been
associated with cellular senescence.
Cellular Senescence Is Required for Tumor Regression upon MYC
Inactivation.Cellularsenescencerequiresthefunctionofmultiple
tumor suppressors including p53, Rb, and p16INK4a (17, 18, 24,
32). We evaluated the effects of the loss of expression of these
genes on the ability of MYC inactivation to induce senescence.
Recently, we have described the generation of lymphoma cell
lines that express p53, are engineered to be negative for p53, or
have been subsequently restored for p53 expression by using a
retroviral vector (33). We found that only lymphoma cell lines
that expressed endogenous or restored p53, but not p53 deficient
tumors, exhibited SA-?-Gal activity upon MYC inactivation
(Fig. 4A). In addition, p53 expression was required for complete
tumorregressionuponMYCinactivationwhentransplantedinto
syngeneic hosts as quantified by bioluminescence imaging (Fig.
4B). Thus, the loss of p53 prevents both cellular senescence and
complete tumor regression upon MYC inactivation.
Next, we suppressed Rb, p16INK4a, or p53 expression in
osteosarcoma cell lines by retrovirally delivered short hairpin
RNA (shRNA) (SI Fig. 8). Cells in which Rb, p16INK4a, or p53
was suppressed, but not in the scramble control, exhibited loss of
SA-?-Gal staining upon MYC inactivation (Fig. 4C). Upon
MYC inactivation, tumor cells with suppressed p16INK4a, p53,
or Rb exhibited continued cellular proliferation (18.09%,
12.10%, or 13.54% versus 0.37%, respectively; SI Fig. 9A). These
shRNAs also impeded the block of cell growth induced by MYC
inactivation assayed by colony formation (SI Fig. 9B). As a
negative control, tumor cells expressing a scrambled shRNA
controldidnotexhibitchangesincellularproliferationorgrowth
upon MYC inactivation. Thus, the knockdown of p16INK4a, Rb,
or p53 expression suppressed both cellular senescence and cell
cycle arrest upon MYC inactivation.
We examined whether the perturbation of cellular senescence
programs influenced the ability of MYC inactivation to induce
sustained tumor regression in osteosarcoma. Upon MYC inactiva-
Fig. 1.
vivo. (A) Acidic ?-gal (?-gal) staining was conducted for primary hepatocel-
ullar carcinoma and lymphoma 2 days and 4 days after MYC inactivation.
Primary MYC-induced hepatocellular carcinoma was transplanted to SCID
mice s.c (14). (B) Tumor tissues were stained with acidic ?-gal (22) or hema-
toxylin and eosin at different time points upon MYC inactivation.
MYC inactivation induces cellular senescence in primary tumors in
Wu et al.
PNAS ?
August 7, 2007 ?
vol. 104 ?
no. 32 ?
13029
CELL BIOLOGY

Page 3

tion, tumors expressing shRNA against p16INK4a or Rb exhibited
sustainedregressioninonly40%(P?0.0085)or60%(P?0.0628)
of mice, respectively. In marked contrast, control tumors exhibited
100% sustained tumor regression (Fig. 4D). Thus, inhibition of
p16INK4a or Rb prevents MYC inactivation from inducing sus-
tained tumor regression of osteosarcoma in vivo.
Fig. 2.
osteosarcoma and lymphoma cell lines before and after MYC inactivation for 48 and 24 h, respectively. Means and standard deviations of the percentages of
SA-?-gal-positivecellsareindicated.(Bottom)s.c.-injectedMYC-inducedlymphomacellline6780withMYConor3daysafterMYCinactivationstainedwitheosin
and ?-gal activities. (B) Real-time PCR for p15INK4b and p21CIP were done in an osteosaroma cell line in vitro (Upper) and hepatocellular carcinoma in vivo
(Lower) normalized by GAPDH. (C) Western blots with osteosarcoma cells with MYC on or MYC off conditions at various time points for p16INK4a expression.
MYC inactivation induces expression of cellular senescence markers in vitro and in vivo. (A) (Top and Middle) Acidic ?-gal staining was conducted for
Fig.3.
doxycyclinetoinactivateMYCexpression.(A)HeterochromatinformationwasshownbyDAPIstainingat48hafterMYCinactivation.(B–D)Immunofluorescence
staining with anti-acetyl histone H4 (B), anti-acetyl histone H3 antibody (C), and anti-trimethyl K9 histone H3 antibody (D) upon MYC inactivation for 0, 6, 12,
24, and 48 h. There was a great reduction of MYC expression after 4 h of treatment of doxycycline (SI Fig. 7). (E) Western blots for MYC on and MYC off bone
tumorcellsinvitroandtransplantedprimaryhepatocullarcarcinomainvivoprobedwithantibodiesagainstMYC,acetylhistoneH4,acetylhistoneH3,trimethyl
K4 histone H3, and ?-tubulin.
MYCinactivationinducesglobalchangesinchromatinstructure.Bonetumorcellsgeneratedfrommicewereculturedinvitroandtreatedwith20ng/ml
13030 ?
www.pnas.org?cgi?doi?10.1073?pnas.0701953104Wu et al.

Page 4

DNA Damage Response and MAPK Pathways Are Not Required for
Senescence Induced by MYC Inactivation. Oncogene activation in-
duced senescence in normal cells recently has been shown to be
mediated by specific signaling pathways including ATM/ATR
(26, 27) and MAPK (16, 28, 29). To test whether senescence
upon MYC-inactivation in tumor cells similarly depends on
DNA-repair pathways, lymphoma cells were treated with the
ATM/ATR inhibitor caffeine (27, 37). However, we did not
observe any decrease in SA-?-Gal-positive cells (Fig. 4E and SI
Fig. 10). OIS also appears to require ERK1/2 and p38-MAPK
signaling (16, 28, 29). Pharmacologic inhibition of ERK1/2 or
p38-MAPK using U0126 or SB203580, respectively, at 10 ?M for
48 h did not prevent MYC inactivation-induced senescence as
monitored by SA-?-Gal staining, p15INK4b, and p21CIP ex-
pression (Fig. 4F and SI Fig. 11).
Therefore, we conclude that the inhibition of DNA-damage
response, ERK1/2, and p38-MAPK signaling pathways are not
sufficient to prevent cellular senescence upon MYC inactivation.
Discussion
Our results illustrate that cellular senescence is an important
mechanism of sustained tumor regression upon MYC oncogene
Fig. 4.
and p53 restored lymphomas in MYC on and MYC off after 24 h. Means and standard deviations of the percentages of SA-?-gal-positive cells are indicated.
Bioluminescence imaging of tumor cell elimination of p53-negative versus p53-restored lymphomas before and after MYC inactivation. (B) Luciferase-labeled
lymphoma cells (107) were inoculated into syngeneic mice, then imaged by bioluminescence imaging on the day of MYC inactivation (MYC On) and 9 days after
MYC inactivation (MYC Off). (C) Acidic ?-gal staining for osteosarcoma cells infected with scramble shRNA, Rb shRNA, p16INK4a shRNA, or p53 shRNA in MYC
on and MYC off for 48 h. The cells were counterstained with eosin. (D) Tumor-free survival of mice that had been injected with 105bone tumor cells infected
with vector control or RB or p16INK4a shRNA vectors. (E) MYC-induced lymphoma cells were treated with or without 5 mM caffeine 1 h before turning MYC off.
SA-?-Gal staining was performed 24 h later after MYC inactivation. Means and standard deviations of the percentages of SA-?-gal-positive cells are indicated.
(F) MYC-induced lymphomas were treated with the ERK1/2 pathway inhibitor (U0126, 10 ?M) or p38-MAPK pathway inhibitor (SB203580, 10 ?M) for 48 h with
MYC off conditions. (G) Cells were collected for SA-?-gal staining. A model for OIS and oncogene inactivation-induced senescence is illustrated here.
Loss of p53, Rb, or p16INK4a affects cellular senescence and tumor regression upon MYC inactivation. (A) Acidic ?-gal staining for MYC, p53?/?/MYC,
Wu et al.
PNAS ?
August 7, 2007 ?
vol. 104 ?
no. 32 ?
13031
CELL BIOLOGY

Page 5

inactivation in hematopoietic tumors, osteosarcomas, and hep-
atocellular carcinomas. MYC inactivation was associated with
several molecular features of cellular senescence including ele-
vated acidic-?-gal activity, increased expression of the cell cycle
inhibitors p15INK4b and p16INK4a, the formation of hetero-
chromatin,andcharacteristicchangesinchromatinstructurelike
histone H3 K9 methylation. Importantly, we observed that MYC
inactivationeitherinvitroorinvivoresultsincellularsenescence,
strongly suggesting that senescence programs are activated
through cell autonomous programs, as opposed to indirect
consequences of tumor involution and local hypoxia.
Moreover, both cellular senescence and sustained tumor
regression upon MYC inactivation were shown to require the
expression of p16INK4a, Rb, and p53, and the reconstitution of
p53 expression correspondingly restored the ability of MYC
inactivation to induce senescence. Hence, the suppression of
MYC oncogene appears to induce senescence through at least
some pathways overlapping with oncogene activation-induced
senescence(19–21,24).Furthermore,MYCmaybeabletoblock
thefunctionoftumor-suppressorgenesincludingp16INK4a,Rb,
and p53 (38). Hence, inactivating MYC now may restore their
functions. Even though the mechanism by which MYC inacti-
vation inducing cellular senescence is not clear and needs further
examination, our results suggest that unlike OIS in normal cells,
the inhibition of ATM/ATR or MAPK pathways does not
impedeoncogeneinactivationinducedsenescenceintumorcells.
Because MYC is downstream of MAPK pathways (39), our
results suggest that inactivating MYC is capable of executing
senescence programs independently of upstream regulatory
pathways.
Previously, we have shown that the suppression of the MYC
oncogene results in distinct specific consequences in different types
of tumors. Here, we illustrate that in many types of cancers, MYC
inactivationinducestumorregressionultimatelythroughacommon
convergent pathway associated with cellular senescence. Hence, in
hematopoietic tumors, MYC inactivation resulted in an initial
proliferative arrest, differentiation, and senescence, subsequently
followed by complete elimination through apoptosis (12). In os-
teosarcoma, MYC inactivation resulted in proliferative arrest and
differentiationoftumorcellsintomatureosteocytesassociatedwith
senescence, but no significant apoptosis (13). Finally, in hepatocel-
lularcarcinoma,tumorsunderwentsenescence,differentiation,and
apoptosis (14). We noted that the remaining differentiated hepa-
tocytesdidnotexhibitsenescence,whichpossiblycouldexplainwhy
MYC reactivation restored their neoplastic properties (14). Thus,
cellularsenescencepathwaysappeartobeanimportantcomponent
of oncogene addiction associated with MYC overexpression.
Notably, recent reports have variously suggested or refuted
that knockout of Myc results in senescence. One report dem-
onstrated that the knockout of one allele of c-myc in human
fibroblasts results in senescence through p16INK4a and Bmi-1
(40).However,otherreportsshowedthatthecompleteknockout
of either n-myc or c-myc, respectively, does not induce cellular
senescence in normal cells (10, 41). Our results suggest that
MYC inactivation in tumor cells more generally results in
senescence.
An important implication of our results is that cellular senes-
cence pathways must remain intact in tumors as has been
suggested (32). Inactivation of MYC appeared to reactivate
cellular senescence pathways that then must be silenced in tumor
cells. This shift in balance between tumor-promoting and tumor-
suppressing signals has been suggested to be integral to the
phenomena of oncogene addiction (42). Furthermore, recently
itwassuggestedthatoncogeneinactivationmayinduceapoptosis
in tumors by flipping the balance of pro- and antiapoptotic
pathways (43). Indeed, our observation supports this conclusion
and illustrates that one possible overriding mechanism is that
upon oncogene inactivation tumors undergo cellular senescence.
The subsequent decision of whether tumor cells undergo senes-
cence later accompanied by their complete elimination through
apoptosis depends on other factors specific to a given type of
cancer.
Our studies suggest that cellular senescence may be an im-
portant general mechanism by which targeted therapeutics
induces tumor regression. It long has been postulated that MYC
plays a role in the immortalization of tumor cells (44), so it is
perhaps less surprising that the inactivation of MYC could result
in senescence. However, it remains to be seen whether suppress-
ing other oncogenes in murine and even more importantly
human tumors will result in senescence. In this regard, we have
preliminary results indicating that inactivation of K-Ras in
lymphoma also induced senescence (unpublished results), sug-
gesting that this oncogene inactivation induced senescence
(OIIS) may be a general mechanism of tumor regression upon
oncogene inactivation (Fig. 4G). Previous reports (45, 46)
suggested that activating apoptosis or cellular senescence could
serve as an intrinsic mechanism for tumor regression. Recent
observations support the idea that the restoration of p53 func-
tion may contribute to tumor regression by inducing senescence
(47, 48).
We recognize that there are likely to be multiple mechanisms
by which oncogene inactivation results in tumor regression,
including both cell intrinsic mechanisms and host dependence
mechanisms such as the inhibition of angiogenesis (33). Here we
uncover that cellular senescence appears to be a common
critical, tumor cell-intrinsic mechanism for MYC-associated
oncogene addiction.
Materials and Methods
Cell Culture, Western Blots, and RT-PCR. Cell lines derived from
osteogenic sarcomas were cultured in DMEM supplemented
with 10% FBS/1% penicillin/streptomycin/1% L-glutamine/1%
nonessential amino acids. Lymphoma derived cell lines were
grown in RPMI medium 1640 with 10% FBS/1% penicillin/
Streptomycin/1% L-glutamine/50 ?M 2-mercaptoethanol. To
inactivate MYC expression, 20 ng/ml doxycycline was added to
the medium. To inhibit ATM and ATR, 1 h before the doxycy-
cline treatment, 5 mM caffeine (Sigma, St. Louis, MO) were
added to the tissue culture medium (37). For colony formation
assay, 4.25 ? 10e3 of bone tumor cells were seeded on 10-cm
tissue culture plates with no doxycycline or 20 ng/ml doxycyline
in the medium. Four days after, cells were fixed with methanol
and stained with 0.5% methylene blue in 85% ethanol. Anti-
bodies for Western blots and primers for real-time PCR are
listed in SI Methods.
Immunofluorescence.Cellswerefixedwith4%paraformaldehydein
PBS for 15 min at room temperature for anti-acetyl histone H4
(06-598; Upstate Biotechnology) and trimethyl K9 histone H3
(8898; Abcam). For anti-acetyl histone H3 (06-599; Upstate Bio-
technology) staining, cells were fixed with 95% ethanol and 5%
aceticacidfor1minatroomtemperature.Cellswerepermeabilized
with 0.2% Triton X-100 (EM Science, Gibbstown, NJ) in PBS for
10 min at room temperature. FITC-labeled secondary antibody
(F-0382; Sigma) were applied at the concentration of 1:500. Images
were taken with Nikon E800 scope. Senescence-associated hetero-
chromatin staining was conduced as described (18).
Animal Experiments. Tet-o-MYC transgenic mice have been de-
scribed (12). All animal experiments were performed by follow-
ing the guidelines from Administrative Panel on Laboratory
Animal Care at Stanford University (protocol 8144). To inac-
tivate MYC expression, drinking water was supplemented with
200 ?g/ml doxycycline. ?-Gal staining of tumors were conduced
as described (32).
13032 ?
www.pnas.org?cgi?doi?10.1073?pnas.0701953104Wu et al.

Page 6

In Vivo Bioluminescence Imaging. p53?/?and p53-restored tumor
cells, expressing the luciferase enzyme, were injected i.p. or s.c.
into syngeneic mice. Tumors were allowed to develop until
reaching approximately the same bioluminescent signal. Tumor
regression then was induced by doxycycline treatment (200
?g/ml). Transgenic mice were anesthetized with a combination
of inhaled isoflorane/oxygen delivered by the Xenogen XGI-8
5-port Gas Anesthesia System. An aqueous solution of the
substrate D-luciferin (150 mg/kg) was injected into the animal’s
peritoneal cavity 10 min before imaging. Animals then were
placed into a light-tight chamber and imaged with an IVIS-100
cooled CCD camera (Xenogen, Alameda, CA).
Retrovirus Constructs, Virus Production, and Tumor Cell Infection.
Vectors containing RNAi sequences against p16INK4aand Rb
(MSCV-LMP), MSCV-IRES-GFP. and MSCV-p53-IRES-GFP
constructswereallkindlyprovidedbyS.Lowe(ColdSpringHarbor
Laboratory,ColdSpringHarbor,NY).ScrambleshRNAsequences
were designed (AGCGCGCTTTGTAGGATTCG) and cloned in
totheMSCV-LMPvectorasdescribed(OpenBiosystems).MSCV-
LUC-IRES-GFP and MSCV-Puro-LUC constructs, a modified
version of the pDON plasmid vector (Takara Mirus Bio, Madison,
WI), was kindly provided by Luis Soares (Stanford University).
Tumor cells were incubated with retroviruses containing superna-
tants for 12 h at 32°C in media containing 4 ?g/ml polybrene. Cells
then were expanded at 37°C for an additional 48 h, and GFP-
expressing cells were purified by flow cytometry on a FACS
Vantage (Becton Dickinson). Cells containing MSCV-Puro-LUC
were selected with puromycin. The restoration of p53 protein
expression was confirmed by Western blot analysis.
We dedicate this work in memory of Arthur Lantz. We thank the many
members of the D.W.F. laboratory for generously providing their
suggestions and Dr. Scott Lowe for generously providing us with the
shRNA retroviral vectors for p16INK4a, p53, and RB. This work was
supported by National Cancer Institute Grants R01-CA85610, R01-
CA105102, 3R01CA089305–03S1, NIH/NCI ICMIC P50, and NIH/
NCI 1P20 CA112973; Leukemia and Lymphoma Society; Burroughs
Wellcome Fund; and the Damon Runyon Lilly Clinical Investigator
Award (to D.W.F.); Leukemia and Lymphoma Society (A.C.F.);
Lymphoma Research Foundation (J.v.R.); and Howard Hughes Med-
ical Institute (P.B.).
1. Dang CV, O’Donnell KA, Zeller KI, Nguyen T, Osthus RC, Li F (2006) Semin
Cancer Biol 16:253–264.
2. Oster SK, Ho CS, Soucie EL, Penn LZ (2002) Adv Cancer Res 84:81–154.
3. Secombe J, Pierce SB, Eisenman RN (2004) Cell 117:153–156.
4. Adhikary S, Eilers M (2005) Nat Rev Mol Cell Biol 6:635–645.
5. Dang CV (1999) Mol Cell Biol 19:1–11.
6. Pelengaris S, Khan M, Evan G (2002) Nat Rev Cancer 2:764–776.
7. Bouchard C, Dittrich O, Kiermaier A, Dohmann K, Menkel A, Eilers M,
Luscher B (2001) Genes Dev 15:2042–2047.
8. Fernandez PC, Frank SR, Wang L, Schroeder M, Liu S, Greene J, Cocito A,
Amati B (2003) Genes Dev 17:1115–1129.
9. Frank SR, Schroeder M, Fernandez P, Taubert S, Amati B (2001) Genes Dev
15:2069–2082.
10. KnoepflerPS,ZhangXY,ChengPF,GafkenPR,McMahonSB,EisenmanRN
(2006) EMBO J 25:2723–2734.
11. Felsher DW (2003) Nat Rev Cancer 3:375–380.
12. Felsher DW, Bishop JM (1999) Mol Cell 4:199–207.
13. Jain M, Arvanitis C, Chu K, Dewey W, Leonhardt E, Trinh M, Sundberg CD,
Bishop JM, Felsher DW (2002) Science 297:102–104.
14. Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S,
Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, et al. (2004) Nature
431:1112–1117.
15. Karlsson A, Giuriato S, Tang F, Fung-Weier J, Levan G, Felsher DW (2003)
Blood 101:2797–2803.
16. Zhu J, Woods D, McMahon M, Bishop JM (1998) Genes Dev 12:2997–3007.
17. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW (1997) Cell
88:593–602.
18. Narita M, Nunez S, Heard E, Lin AW, Hearn SA, Spector DL, Hannon GJ,
Lowe SW (2003) Cell 113:703–716.
19. Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T, van der
Horst CM, Majoor DM, Shay JW, Mooi WJ, Peeper DS (2005) Nature
436:720–724.
20. Collado M, Gil J, Efeyan A, Guerra C, Schuhmacher AJ, Barradas M, Benguria
A, Zaballos A, Flores JM, Barbacid M, et al. (2005) Nature 436:642.
21. Braig M, Lee S, Loddenkemper C, Rudolph C, Peters AH, Schlegelberger B,
Stein H, Dorken B, Jenuwein T, Schmitt CA (2005) Nature 436:660–665.
22. Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE,
Linskens M, Rubelj I, Pereira-Smith O, et al. (1995) Proc Natl Acad Sci USA
92:9363–9367.
23. Chan HM, Narita M, Lowe SW, Livingston DM (2005) Genes Dev 19:196–201.
24. Chen Z, Trotman LC, Shaffer D, Lin HK, Dotan ZA, Niki M, Koutcher JA,
Scher HI, Ludwig T, Gerald W, et al. (2005) Nature 436:725–730.
25. Zhang R, Poustovoitov MV, Ye X, Santos HA, Chen W, Daganzo SM,
Erzberger JP, Serebriiskii IG, Canutescu AA, Dunbrack RL, et al. (2005) Dev
Cell 8:19–30.
26. DiMiccoR,FumagalliM,CicaleseA,PiccininS,GaspariniP,LuiseC,Schurra
C, Garre M, Nuciforo PG, Bensimon A, et al. (2006) Nature 444:638–642.
27. BartkovaJ,RezaeiN,LiontosM,KarakaidosP,KletsasD,IssaevaN,Vassiliou
LV, Kolettas E, Niforou K, Zoumpourlis VC, et al. (2006) Nature 444:633–637.
28. Cammarano MS, Nekrasova T, Noel B, Minden A (2005) Mol Cell Biol
25:9532–9542.
29. Lorenzini A, Tresini M, Mawal-Dewan M, Frisoni L, Zhang H, Allen RG, Sell
C, Cristofalo VJ (2002) Exp Gerontol 37:1149–1156.
30. ColladoM,MedemaRH,Garcia-CaoI,DubuissonML,BarradasM,Glassford
J, Rivas C, Burgering BM, Serrano M, Lam EW (2000) J Biol Chem 275:21960–
21968.
31. Courtois-Cox S, Genther Williams SM, Reczek EE, Johnson BW, McGilli-
cuddy LT, Johannessen CM, Hollstein PE, MacCollin M, Cichowski K (2006)
Cancer Cell 10:459–472.
32. Schmitt CA, Fridman JS, Yang M, Lee S, Baranov E, Hoffman RM, Lowe SW
(2002) Cell 109:335–346.
33. Giuriato S, Ryeom S, Fan AC, Bachireddy P, Lynch RC, Rioth MJ, van
Riggelen J, Kopelman AM, Passegue E, Tang F, et al. (2006) Proc Natl Acad
Sci USA 103:16266–16271.
34. Welford SM, Bedogni B, Gradin K, Poellinger L, Broome Powell M, Giaccia
AJ (2006) Genes Dev 20:3366–3371.
35. Gartel AL, Ye X, Goufman E, Shianov P, Hay N, Najmabadi F, Tyner AL
(2001) Proc Natl Acad Sci USA 98:4510–4515.
36. Staller P, Peukert K, Kiermaier A, Seoane J, Lukas J, Karsunky H, Moroy T,
Bartek J, Massague J, Hanel F, et al. (2001) Nat Cell Biol 3:392–399.
37. Sarkaria JN, Busby EC, Tibbetts RS, Roos P, Taya Y, Karnitz LM, Abraham
RT (1999) Cancer Res 59:4375–4382.
38. Felsher DW, Zetterberg A, Zhu J, Tlsty T, Bishop JM (2000) Proc Natl Acad
Sci USA 97:10544–10548.
39. Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, Nevins JR (2000) Genes Dev
14:2501–2514.
40. Guney I, Wu S, Sedivy JM (2006) Proc Natl Acad Sci USA 103:3645–3650.
41. Oskarsson T, Essers MA, Dubois N, Offner S, Dubey C, Roger C, Metzger D,
Chambon P, Hummler E, Beard P, et al. (2006) Genes Dev 20:2024–2029.
42. Weinstein IB (2002) Science 297:63–64.
43. Sharma SV, Gajowniczek P, Way IP, Lee DY, Jiang J, Yuza Y, Classon M,
Haber DA, Settleman J (2006) Cancer Cell 10:425–435.
44. Grandori C, Wu KJ, Fernandez P, Ngouenet C, Grim J, Clurman BE, Moser
MJ,OshimaJ,RussellDW,SwisshelmK,etal.(2003)GenesDev17:1569–1574.
45. Lowe SW, Cepero E, Evan G (2004) Nature 432:307–315.
46. Sharpless NE, DePinho RA (2005) Nature 436:636–637.
47. Xue W, Zender L, Miething C, Dickins RA, Hernando E, Krizhanovsky V,
Cordon-Cardo C, Lowe SW (2007) Nature 445:656–660.
48. Ventura A, Kirsch DG, McLaughlin ME, Tuveson DA, Grimm J, Lintault L,
Newman J, Reczek EE, Weissleder R, Jacks T (2007) Nature 445:661–665.
Wu et al.
PNAS ?
August 7, 2007 ?
vol. 104 ?
no. 32 ?
13033
CELL BIOLOGY