Matrix Gla protein is involved in elastic fiber calcification in the dermis of pseudoxanthoma elasticum patients.

Abstract

Mature MGP (Matrix gamma-carboxyglutamic acid protein) is known to inhibit soft connective tissues calcification. We investigated its possible involvement in pseudoxanthoma elasticum (PXE), a genetic disorder whose clinical manifestations are due to mineralization of elastic fibers. PXE patients have lower serum concentration of total MGP compared to controls (P<0.001). Antibodies specific for the noncarboxylated (Glu-MGP) and for the gamma-carboxylated (Gla-MGP) forms of MGP were assayed on ultrathin sections of dermis from controls and PXE patients. Normal elastic fibers in controls and patients were slightly positive for both forms of MGP, whereas Gla-MGP was more abundant within control's than within patient's elastic fibers (P<0.001). In patients' calcified elastic fibers, Glu-MGP intensively colocalized with mineral precipitates, whereas Gla-MGP precisely localized at the mineralization front. Data suggest that MGP is present within elastic fibers and is associated with calcification of dermal elastic fibers in PXE. To investigate whether local cells produce MGP, dermal fibroblasts were cultured in vitro and MGP was assayed at mRNA and protein levels. In spite of very similar MGP mRNA expression, cells from PXE patients produced 30% less of Gla-MGP compared to controls. Data were confirmed by immunocytochemistry on ultrathin sections. Normal fibroblasts in vitro were positive for both forms of MGP. PXE fibroblasts were positive for Glu-MGP and only barely positive for Gla-MGP (P<0.001). In conclusion, MGP is involved in elastic fiber calcification in PXE. The lower ratio of Gla-MGP over Glu-MGP in pathological fibroblasts compared to controls suggests these cells may play an important role in the ectopic calcification in PXE.

Full text

Page 1

Matrix Gla protein is involved in elastic fiber calcification
in the dermis of pseudoxanthoma elasticum patients
Dealba Gheduzzi1,*, Federica Boraldi1,*, Giulia Annovi1, Chiara Paolinelli DeVincenzi1, Leon J Schurgers2,
Cees Vermeer2, Daniela Quaglino1and Ivonne Pasquali Ronchetti1
Mature MGP (Matrix g-carboxyglutamic acid protein) is known to inhibit soft connective tissues calcification. We
investigated its possible involvement in pseudoxanthoma elasticum (PXE), a genetic disorder whose clinical manifesta-
tions are due to mineralization of elastic fibers. PXE patients have lower serum concentration of total MGP compared to
controls (Po0.001). Antibodies specific for the noncarboxylated (Glu-MGP) and for the g-carboxylated (Gla-MGP) forms of
MGP were assayed on ultrathin sections of dermis from controls and PXE patients. Normal elastic fibers in controls and
patients were slightly positive for both forms of MGP, whereas Gla-MGP was more abundant within control’s than within
patient’s elastic fibers (Po0.001). In patients’ calcified elastic fibers, Glu-MGP intensively colocalized with mineral
precipitates, whereas Gla-MGP precisely localized at the mineralization front. Data suggest that MGP is present within
elastic fibers and is associated with calcification of dermal elastic fibers in PXE. To investigate whether local cells produce
MGP, dermal fibroblasts were cultured in vitro and MGP was assayed at mRNA and protein levels. In spite of very similar
MGP mRNA expression, cells from PXE patients produced 30% less of Gla-MGP compared to controls. Data were
confirmed by immunocytochemistry on ultrathin sections. Normal fibroblasts in vitro were positive for both forms of
MGP. PXE fibroblasts were positive for Glu-MGP and only barely positive for Gla-MGP (Po0.001). In conclusion, MGP
is involved in elastic fiber calcification in PXE. The lower ratio of Gla-MGP over Glu-MGP in pathological fibroblasts
compared to controls suggests these cells may play an important role in the ectopic calcification in PXE.
Laboratory Investigation (2007) 87, 998–1008; doi:10.1038/labinvest.3700667; published online 27 August 2007
KEYWORDS: calcification; dermal fibroblast; elastic fiber; human skin; MGP; pseudoxanthoma elasticum
The high concentration of calcium and phosphate in the
extracellular space would lead to tissue calcification unless
efficiently inhibited by a series of proteins and glycoproteins
that have been found to operate in soft connective tissues to
prevent calcium precipitation.1
Great attention has been recently paid to fetuin, which
accumulates in the mineralized matrix of bone where it
modulates apatite formation.2–4It also circulates in serum
where it probably inhibits mineral precipitation due to the
acidic amino-acid residues of its cystatin-like domain.4,5
Recently, a significant decrease in fetuin was measured in the
serum of patients with pseudoxanthoma elasticum (PXE),6
a genetic disorder characterized by mineralization of
elastic fibers,7–9and it has been suggested that fetuin could
have been removed from serum and ‘bound to the mineral
deposits’.5,10
Another protein involved in inhibition of calcium pre-
cipitation in soft connective tissues is matrix Gla protein
(MGP), a 10-kDa secreted protein containing 5-glutamic
acid residues that must be g-carboxylated by a vitamin K-
dependent g-carboxylase in order to acquire calcium-binding
properties.11,12MGP-deficient mice manifest extensive cal-
cification of the aorta and articular cartilage,12similar to
what has been observed in Keutel syndrome, which is due to
mutations in the human MGP gene.13,14
Several in vitro and in vivo studies have shown that MGP is
expressed by many peripheral cell types, including fibroblasts
and smooth muscle cells.15–18In an in vitro model of vascular
calcification, the expression of MGP mRNA by smooth
muscle cells was inversely correlated with mineral forma-
tion.19Overexpression of MGP was shown to inhibit normal
chondrocyte and cartilage mineralization,20whereas inhibi-
Received 20 February 2007; revised 12 July 2007; accepted 17 July 2007
1Department of Biomedical Sciences, University of Modena and Reggio Emilia, Modena, Italy and2Department of Biochemistry, University of Maastricht, Maastricht,
The Netherlands
Correspondence: Professor IP Ronchetti, PhD, Department of Biomedical Sciences, Via Campi, 287, Modena 41100, Italy. E-mail: ronchetti.ivonne@unimore.it
*These authors contributed equally to this work.
Laboratory Investigation (2007) 87, 998–1008
& 2007 USCAP, Inc All rights reserved 0023-6837/07 $30.00
998 Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org

Page 2

tion of MGP maturation by warfarin treatment induced
calcification of cartilage and aorta, both in animals21–23and
humans.24,25Moreover, in aortas, mineralization induced by
warfarin was observed limited to elastic fibers, in the absence
of necrotic material, and therefore attributable to an active
process.22,26Therefore, defects in MGP carboxylation seems
to be associated with elastin mineralization. In a recent paper,
dermal elastic fiber calcification has been extensively de-
scribed in patients affected by coagulation disorders due to
a genetic defect in vitamin K recycling with consequent
deficient protein g-carboxylation.27
In the present study, we investigated on the possible in-
volvement of MGP on elastic fiber calcification in PXE, by
measuring MGP serum level and its distribution in the der-
mis of controls and PXE patients. Moreover, since fibroblasts
are responsible for the homeostatic control of connective
tissues, we investigated whether dermal fibroblasts isolated
from patients had normal efficiency in the expression
and maturation of MGP. The following parameters were
investigated: (i) the serum MGP level in PXE patients
compared to controls. (ii) the relative amount and
immunolocalization of both g-carboxylated
carboxylated forms of MGP in the dermis of controls and
PXE patients, mainly focusing on elastic fibers; (iii) the ex-
pression and immunolocalization of both Gla-MGP and Glu-
MGP in human dermal fibroblasts cultured in vitro and
isolated from normal subjects and PXE patients. Data in-
dicate a deficiency in the homeostatic control of MGP ma-
turation in PXE dermal fibroblasts.
and non-
MATERIALS AND METHODS
Blood, Serum, and Plasma Collection
The protocol for the present study was approved by the
Medical Ethical Committee of the University of Modena and
Reggio Emilia. Healthy subjects were recruited from volun-
teers; PXE subjects were from the collection present in our
reference Center for the Diagnosis of PXE. Patients and
controls were of comparable age (ranging from 18 to 65
years). Blood was taken by venipuncture from 30 controls
(from 21 to 65 years, mean age 38714 years; 4 men and 36
women) and from 30 PXE patients (from 13 to 64 years;
mean age 41714 years; 4 men and 36 women), collected in
serum tubes, stored for 1h at room temperature and cen-
trifuged at 3000g for 10min. Aliquots of serum were frozen
and stored at ?801C until used. For plasma, blood from 15
women affected by PXE was collected into Na citrate-con-
taining tubes, centrifuged at 3500g for 10min at 41C. Ali-
quots of plasma-citrate were stored at ?851C until used. As
controls, normal pooled laboratory plasma was used.
Skin Biopsies and Cell Culture
After informed consent, skin biopsies were taken under local
anesthesia from the neck or from the axilla of six PXE pa-
tients and six normal subjects who underwent surgery and
did not show any clinical sign of connective tissue alterations.
All PXE patients had severe clinical manifestations, such as
coalescent skin papules on the posterior and lateral neck, in
the axillae and groin, skin laxity in flexural areas. They were
also diagnosed by ultrastructural analysis of skin biopsies and
by identification of ABCC6 mutations on both alleles.28Fi-
broblast cultures were established and maintained according
to Quaglino et al.29Briefly, skin biopsies were fragmented
and cells were grown as monolayer in 75cm flasks (Nunc,
Roskilde, Denmark) in Dulbecco’s modified Eagle’s medium
(DMEM) containing 10% fetal bovine serum (FBS) and used
between the third and the tenth passage in vitro. Control and
PXE cells were used at the same passage within each
experiment.
Protein Preparation
Fibroblasts were plated in 75cm2flasks at a density of 8?105
cells in 15ml DMEM with 10% FBS. After 7 days from
seeding, cells were removed from the culture flasks with
0.25% trypsin-EDTA in phosphate-buffered saline (PBS) for
10min at 371C. Trypsin was blocked by addition of DMEM
plus 10% FBS. Cells were centrifuged for 5min at 1000r.p.m.
at 41C, washed with cold PBS, centrifuged again and then
suspended in isotonic buffer containing 25mM imidazole,
250mM sucrose, 10mg/ml Sigma protease inhibitor mixture
and 1mM NaF, pH 7.5. Cells were sonicated on ice in a
Sonifier B-12 (Branson Sonic Power Company, Danbury,
Connecticut, USA) with 20 pulses of 2s each. The sonicate
was centrifuged at 10000g for 10min to remove cell debris.
The membrane-enriched fraction was obtained by centrifu-
ging the supernatant at 229000g for 60min in a Type 50-Ti
rotor (Beckman Instruments, Fullerton, CA, USA) and stored
frozen at ?851C until used. Prior to 2D-PAGE, membrane
proteins were dissolved in 250mM phosphate, 0.5M KCl,
20% glycerol, and 0.75% CHAPS, pH 7.85, containing
10ml/ml Sigma protease inhibitor mixture and subsequently
precipitated with the ProteoExtract Protein Precipitation
Kit (Calbiochem, Darmstadt, Germany) according to the
instruction. Proteins were harvested frozen at ?201C.
Electrophoresis
Proteins extracted from a pool of fibroblasts derived from six
patients and six controls were used for each assay. Proteins
were dissolved in 8M urea, 2% CHAPS, 65mM dithio-
erythritol, 2% pH 3–10 ampholyte (GE HealthCare, UK),
and trace of bromphenol blue and were then applied onto
Immobiline pH 3–10 nonlinear DryStrips (7cm long, GE
HealthCare). Isoelectric focusing was performed on an
IPGphor system (GE HealthCare) at 161C according to the
instruction manual. Immobilized pH gradient strips were
reduced (2% dithioerythritol), alkylated (2.5% iodoaceta-
mide) in equilibration buffer (6M urea, 50mM Tris-HCl, pH
6.8, 30% glycerol, 2% SDS) and then loaded onto vertical
SDS-PAGE gel (15%). The second dimension was run using
an electrophoresis Unit (Bio-Rad). Gels were stained with
ammoniacal silver nitrate.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
www.laboratoryinvestigation.org | Laboratory Investigation | Volume 87 October 2007999

Page 3

Western Blotting
It was carried out after transfer of proteins to nitro-
cellulose membranes, applying a 200mA constant current.
Membranes were washed with TTBS (50mM Tris, 150mM
NaCl, pH 7.5, plus 0.1% Tween20) and blocked with 3% BSA
in TTBS. Nitrocellulose films were incubated with primary
antibodies (mouse anti-g-carboxylated-MGP or mouse anti-
non-carboxylated-MGP) diluted 1:10000 in TTBS plus
1% BSA. After washes with TTBS, the incubation with the
secondary antibody was performed by using anti-mouse
IgG conjugated with horseradish peroxidase (GE HealthCare)
diluted 1:20000 in TTBS and 1% BSA and the im-
munoreaction was revealed by using the SuperSignal West
Pico Chemiluminescent Substrate (Pierce) and normalized to
b-actin.
Quantitative Real-Time RT-PCR
Total RNA was isolated from cells using the RNeasy Protect
cells Mini kit (Qiagen, Valencia, CA, USA). Quality and
quantity of RNA were checked by spectrophotometer and
agarose gel. Then 3mg of total RNA was reverse transcribed
using Superscript III (Invitrogen) and Oligo dT18primers
(Invitrogen) according to the manufacturer’s instruction and
conversion was confirmed by a PCR with CLK2 primers.
A negative control was carried out to ensure the absence of
DNA contamination. A 10? diluted cDNA sample was
further amplified on an iCycler (BioRad) using SYBRs
GreenERtqPCR SuperMix (Invitrogen), according to the
manufacturer’s instruction. Primers for conducting real-time
RT-PCR are shown in Table 1 and were designed using
Universal ProbeLibrary version 2.35 for human (www.roche-
applied-science.com) and were synthesized by Invitrogen. All
RT-PCR analyses were carried out in triplicate. The thermal
cycling parameters were set to 501C for 2min, 951C for
3min, 45 cycles of 951C for 30s, an annealing temperature of
601C for 30s and 721C for 30s, followed by melting curve
analysis with a temperature ranging from 95 to 551C. Gene
expression in each sample was normalized to the expression
of an housekeeping gene (CLK2) and compared with control
samples, using the 2?DDCtmethod.30
Immunocytochemistry
Skin biopsies and cultured fibroblasts were processed for
electron microscopy. Briefly, small fragments of skin biopsies
or fibroblasts scraped from the substrate and centrifuged to
form a pellet were immediately fixed in 2.5% para-
formaldehyde in Tyrode’s saline, pH 7.2, for 16–20h at 41C,
followed by fixation in 0.5% osmium tetroxide (Fluka AG
Chem) in the same buffer for 60min at room temperature,
dehydration in ethanol and propylene oxide and embedding
in Spurr resin (Polysciences Inc., Warrington, PA, USA).
Ultrathin sections were collected on nickel grids and pro-
cessed for immunocytochemistry as already described.31
Unspecific epitopes were neutralized by incubating sections
on 0.5% bovine serum albumin in buffer. Monoclonal anti-
bodies towards the noncarboxylated species of MGP and
towards the g-carboxylated form of MGP32,33were used in
parallel in all experiments where normal and PXE samples
had to be compared. The immunoreactions were revealed by
secondary antibodies conjugated with 10nm gold particles
(EY Laboratories, San Mateo, CA, USA). Controls for the
immunoreactions were performed by omitting the primary
antibody or by incubating the sections with nonimmune
sera instead of the primary antibody. Sections were then
stained with uranyl acetate and lead citrate and observed
by transmission electron microscopy (Jeol, EM1200, Tokyo,
Japan).
Immunoassay for Serum MGP
Serum MGP was assayed by using the test kit from Biomedica
(Vienna, Austria). It is a competitive enzyme-linked im-
munosorbent assay (ELISA) in which microwell plates are
coated with mouse monoclonal antibodies raised against
human MGP. The protocol described by Schurgers et al32,33
has been applied.
Coagulation Factors
The procoagulant activity of prothrombin (FIIc) and factor
VIIc were measured in a coagulometer (ACL 300 Research;
Instrumentation Laboratory, Milan, Italy) using Thromborel
S and human coagulation factor II- and VII-deficient plasma
(Behringwerke AG, Marburg, Germany). All values were ex-
pressed as a percentage of values obtained for pooled normal
plasma.
Statistical Analysis
The intensity of immunostaining was evaluated by counting
the number of gold particles present in 20 random fields on
ultrathin sections of dermal elastic fibers or of cytoplasm
of cultured dermal fibroblasts by applying a 1mm2mask
on images obtained at the same magnification (?20000).
Data were compared by Student’s t-test with significance
at Po0.05. The immunoreactivity of the two antibodies
was different, therefore only intra-antibody comparison was
carried out.
Table 1 Primers used for real-time RT-PCR
Length Position Tm % GC Sequence
CLK2
Sense 20667–686 5950 GGACATTTAGCCGCTCATCT
Antisense21706–72659 50 CGTCGTCCTCTACACTCTTGG
MGP
Sense21 135–155 59 52 CCGCCTTAGCGGTAGTAACTT
Antisense 20227–246 59 52 TGCTGAGGGGATATGAAGGT
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
1000 Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org

Page 4

RESULTS
MGP Content in Serum of PXE Patients
Previous studies showed that, in humans, there are no signi-
ficant differences in the MGP levels between genders and
no significant variations with age.32,33In the present study,
circulating MGP level was measured in the serum of 30
controls and of 30 PXE patients (see Materials and Methods).
Figure 1 illustrates that the amount of MGP was statistically
lower in patients (5.1671.07nM/ml) compared to controls
(7.2671.24nM/ml) (Po0.001). Unfortunately, the method
could not discriminate between the g-carboxylated and the
noncarboxylated forms of MGP.
Immunolocalization of MGP in the Human Dermis
In order to investigate whether MGP is involved in elastic
fiber calcification in PXE, ultrathin sections of skin biopsies
from normal subjects and from patients affected by PXE were
immunostained in parallel by using antibodies specific for
the noncarboxylated (Glu-MGP) and for the g-carboxylated
(Gla-MGP) forms of MGP.32,33
In normal skin, fibroblasts were almost negative for
Glu-MGP, whereas they were slightly positive for Gla-MGP
(not shown). In the dermis of PXE patients, fibroblasts were
almost negative for both forms of MGP (not shown).
All components of the extracellular matrix, apart from
elastic fibers, were always negative for both types of anti-
bodies in all samples of both controls and patients. In
contrast, elastic fibers were always positive for MGP. In
particular, Glu-MGP was equally present within control’s
elastic fibers (Figure 2a) and within noncalcified elastic fibers
in the dermis of PXE patients (Figure 2b). By contrast, Gla-
MGP was always present within control’s elastic fibers (Figure
3a), whereas it was almost absent from noncalcified PXE
elastic fibers (Figure 3b). The number of gold particles per
unit surface area of sectioned elastic fibers and the sig-
nificance of data are reported in Figures 2 and 3. As already
pointed out in the Materials and Method section, the two
antibodies had different reactivity and their immunoreac-
tions could not be compared. Therefore, comparison could
only be made between control and pathological samples
treated with the same antibody under identical experimental
conditions. Data clearly show that Gla-MGP was almost
absent from elastic fibers in patients.
As already described in several reports, calcification of
elastic fibers in the dermis of PXE can assume different
structural forms, which are often present in distinct regions
of the same fiber.8The two main forms are represented
in Figure 4. One of them consists of electron-opaque
polymorphic masses of calcified material deforming and
fracturing the elastic fibers (Figure 4a, arrows). The second
form is characterized by dispersed small-calcified spots
occupying the center of fibers (Figure 4a and b, asterisk) and
separated from the surrounding apparently normal elastin by
an electron opaque ring made of needle-shaped crystals
(Figure 4b, inset).
The two antibodies tested reacted in a completely
different manner on these two different regions. The anti-
body that recognizes Glu-MGP strongly reacted with the
polymorphous calcified areas and with the finely dispersed
calcified core of elastic fibers (Figure 4c, asterisks). By con-
trast, the antibody towards Gla-MGP was absent from these
regions and was only and precisely localized at the calcifi-
cation front separating the central mineralized core from the
surrounding apparently normal elastin (Figure 4d, arrows).
MGP by In Vitro Dermal Fibroblasts
Since peripheral cells, namely fibroblasts and smooth muscle
cells, are the major producers of MGP in vivo,15,17,34we
wanted to analyse whether dermal fibroblasts might be
involved in MGP expression and maturation. Dermal fibro-
blasts were isolated from skin biopsies of both controls and
PXE patients and were analysed for the expression of MGP.
The expression of MGP mRNAwas similar in controls and in
PXE fibroblasts, differences being statistically not significant
(Figure 5).
When measured at protein level, as illustrated in Figure 6,
the total amount of MGP in PXE cells was about 25% less
than that found in control fibroblasts (Po0.05). As specified
in the Materials and Method section, analyses were
performed on a pool of cell membranes from fibroblasts of
six patients and six controls in each experiment, and
experiments were carried out in triplicate. Therefore, the
subfractionation method employed should circumvent the
evaluation of MGP eventually taken up by cells from
the medium and accumulating within the cytoplasm.
Data on the relative amounts of Glu-MGP (a) and
Gla-MGP (b), identified by specific antibodies and normal-
ized to the b-actin content, are shown in Figure 6. The
amount of Glu-MGP was very similar in both control (34%)
and PXE (32%) fibroblasts. By contrast, the relative amount
of Gla-MGP was 66% in controls, whereas it was around 43%
in PXE cells, and the ratio between Gla-MGP to Glu-MGP
Figure 1 Total MGP measured in the serum of 30 controls and of 30 PXE
patients of comparable age. The level of MGP was significantly higher in the
serum of normal subjects compared to patients (Po0.001).
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
www.laboratoryinvestigation.org | Laboratory Investigation | Volume 87 October 20071001

Page 5

was more than 30% lower in PXE (1.34) compared to con-
trols (1.94) (Po0.01) (Figure 6c).
Immunolocalization of MGP on In Vitro Dermal
Fibroblasts
In vitro dermal fibroblasts were positive for MGP, as shown
by the immunoelectron-microscopy approach applied to thin
sections of cultured fibroblasts. The amount and distribution
of Glu-MGP were scarce and almost identical in control (a)
and PXE (b) fibroblasts (Figure 7). By contrast, Figure 8
illustrates that the immunoreaction towards Gla-MGP was
much stronger in control (a) compared to PXE (b) fibro-
blasts. The number of gold particles per square unit of
cytoplasm measured on random fields was 30711/m2in
controls and 1274/m2in PXE cells (Po0.001). Moreover, as
expected from data of the literature,32the immunoreaction
for Gla-MGP was precisely and almost exclusively localized
on membranes of the endoplasmic reticulum in both control
and PXE fibroblasts.
Coagulation Factor
Measurements of coagulation factors II and VII in the plasma
of PXE patients did not reveal any significant difference
between patients and controls. Values for coagulation factors
II and VII were only 3 and 7% higher in PXE patients
compared to controls (data not shown).
DISCUSSION
Relevant findings of this work are that human dermal
fibroblasts express and produce MGP, and that MGP is
present within normal elastic fibers in the human dermis.
Owing to the well-recognized role of MGP in preventing
mineralization of soft connective tissues11,12,15,19,20and
the propensity of elastin per se ´ to accumulate calcium,35
the presence of MGP within normal elastic fibers would
suggest that this protein may have a role in preventing
elastic fiber calcification. Strategic location of g-carboxylated
MGP within elastic fibers may protect those unique
structures against mineralization. Elastic fibers of PXE
patients that contain only the noncarboxylated immature
MGP are not protected from sequestration of calcium
from the serum. Moreover, MGP is involved in PXE calcifi-
cation, being immature noncarboxylated MGP (Glu-MGP)
associated with mineral precipitates and g-carboxylated
MGP (Gla-MGP) associated with the calcification front.
These data suggest once more the different and opposite
Figure 2 Immunolocalization of noncarboxylated MGP (Glu-MGP) on elastic fibers of the normal human dermis (a) and on the nonmineralized dermal
elastic fibers of PXE patients (b). The number of gold particles (gp) per unit area of elastic fibers was almost the same in the two conditions. Bar: (a) and (b)
1mm; insets 0.1mm.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
1002Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org

Page 6

role of the two forms of MGP in favouring/preventing
calcium precipitation, respectively. Finally, MGP content,
and in particular the ratio between Gla-MGP to Glu-MGP,
could be taken as marker for elastic fiber calcification in PXE
patients.
In the normal dermis, elastic fibers were immunologically
positive for both Glu-MGP and Gla-MGP. By contrast,
the noncalcified elastic fibers in PXE patients were almost
negative for Gla-MGP. Therefore, elastic fibers of PXE
patients would seem less protected from calcium precipita-
tion due to their low content of the active g-carboxylated
form of the protein.
These data may explain findings by Gordon et al36who
found that fragments of skin from PXE patients were able to
accumulate more calcium compared to normal skin when
incubated in a calcium-containing medium.
The different role of Glu- and Gla-MGP on the miner-
alization process of elastic fibers was shown by the different
localization of the antibodies specific for the two forms of
MGP even within the same elastic fiber. Glu-MGP was
always and abundantly present in the areas of either bulky or
spotty mineralization. By contrast, Gla-MGP was only and
precisely localized at the thin frontline separating the central
mineralized core from the surrounding apparently normal
elastin. These data are in agreement with those obtained
by light microscopy on human aortas in the early phase
of atherosclerosis and in Monckeberg’s sclerosis where the
Glu-MGP has been observed to colocalize with calcifi-
cation, whereas Gla-MGP has been found around elastic
fibers.32In that report, the low resolution of the technique
did not allow the precise localization of the g-carboxylated
form of MGP.32By considering the inhibitory role on
calcification of mature g-carboxylated MGP and that calci-
fication seems to progress from the center of elastic fibers
towards their periphery, the present data suggest that mature
calcium-binding MGP (Gla-MGP) would arrest calcification
at these peculiar sites. By contrast, immature Glu-MGP was
always associated with bulky mineral precipitates where it
might favor calcification. Similar to what is suggested for
fetuin,5,10it cannot be excluded that immature MGP is
captured during calcification.
It has been already demonstrated that MGP is synthesized
bynumerouscelltypes,
cells,17,19,34,37pneumocytes15,18and chondrocytes.20,38
includingsmooth muscle
Figure 3 Immunolocalization of g-carboxylated MGP (Gla-MGP) on elastic fibers of the normal human dermis (a) and the nonmineralized dermal elastic
fibers of PXE patients (b). The number of gold particles (gp) per unit area of elastic fiber was significantly higher in control compared with PXE (Po0.001).
Bar: (a) and (b) 1mm; insets 0.1mm.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
www.laboratoryinvestigation.org | Laboratory Investigation | Volume 87 October 20071003

Page 7

MGP and elastic fiber calcification in PXE
D Gheduzzi et al
1004Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org

Page 8

We wanted to verify whether dermal fibroblasts express MGP
and whether they may be responsible for the low amount of the
g-carboxylated form of MGP within elastic fibers in the dermis
of patients. Therefore, in vitro dermal fibroblasts from normal
subjects and from patients affected by PXE, bearing identified
ABCC6 mutations,28were assayed and compared for MGP
expression and maturation. The amount of the MGP protein
was measured on cell membrane extracts in order to look for
proteins actually belonging to the cells and not taken up from
the medium. Data show that dermal fibroblasts express MGP
in either the g-carboxylated and the noncarboxylated forms.
However, although the mRNA levels were very similar in
control and PXE cells, the amount of protein, and in particular
of the mature g-carboxylated form of MGP, was significantly
lower in PXE cells compared to controls (Po0.01). Therefore,
the data might support the hypothesis of a deficient post-
transcriptional maturation of MGP by PXE fibroblasts.
Data obtained by immunoblotting were in perfect agree-
ment with those by immunoelectron microscopy on thin
sections of fibroblasts, where control cells were positive for
Gla-MGP, whereas PXE fibroblasts were almost negative for
the same antibodies.
The lower expression of g-carboxylated MGP by PXE
fibroblasts suggests that these cells may play an important
role in calcification of dermal elastic fibers in PXE.
Total serum MGP content was lower in PXE patients
compared to controls (Po0.001). Unfortunately, the method
did not allow to distinguish between the noncarboxylated
and the g-carboxylated forms of MGP. Recently, a reduced
amount of fetuin, another serum protein involved in the
inhibition of ectopic calcification, has been measured in the
serum of PXE patients,6and the authors suggested that fetuin
might have disappeared from the circulation by remaining
entrapped within the calcium/phosphate mineral precipitates
typical of PXE.6Without excluding a similar possibility, data
of the present study seem to suggest that the lower amount
of circulating MGP in PXE patients may be related to
reduced expression of MGP, and in particular of the active
g-carboxylated form of MGP by peripheral cells, rather than
to its capture by mineralized elastic fibers.
Figure 5 MGP mRNA expression in control and PXE fibroblasts assayed by
RT-PCR. Differences between control and PXE cells were not significant.
Figure 6 Noncarboxylated-MGP and g-carboxylated MGP expressed by in
vitro fibroblasts were assayed at protein level by western blot. Data were
normalized to b-actin. PXE fibroblasts expressed 25% less MGP compared to
controls (a, b). In addition, both control and PXE cells produced similar
amount of noncarboxylated MGP, whereas g-carboxylated MGP was more
than 30% higher in control compared to PXE fibroblasts (c).
Figure 4 Immunolocalization of glu- and Gla-MGP in calcified dermal elastic fibers in PXE patients. The polymorphous precipitates deforming elastic fibers
(a, arrows) coexisted with areas of fine disperse calcification precipitates (a and b, asterisk), which were very often separated from the surrounding
apparently normal elastin (b) by a ring of needle-shaped mineral crystals (b, inset). Noncarboxylated-MGP was localized on the polymorphous precipitates
and on the mineralized core of elastic fibers (c, asterisk); g-carboxylated MGP was always and only localized at the mineralization front (d, arrows). Bar: 1mm.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
www.laboratoryinvestigation.org | Laboratory Investigation | Volume 87 October 2007 1005

Page 9

By immunoelectron microscopy, Glu-MGP was equally
present within noncalcified elastic fibers of both controls and
patients; by contrast, Gla-MGP was present in controls
whereas it was almost absent from nonmineralized elastic
fibers of patients. Similar findings were also found for dermal
fibroblasts cultured in vitro where PXE fibroblasts appeared
to be significantly less positive for Gla-MGP compared to
controls. Therefore, the ratio of Gla-MGP to Glu-MGP
would seem of paramount importance in understanding the
occurrence of ectopic mineralization.
From these data it would seem that local cells, such as
fibroblasts, play an important role in preventing dermal
elastic fiber calcification. It has been repeatedly shown that
MGP, although it is a circulating protein, acts as inhibitor of
the extracellular matrix calcification in the vicinity of cells
expressing the protein.12,34,37Therefore, our findings that
PXE fibroblasts express lower amount of the g-carboxylated
form of MGP compared to controls may suggest that
calcification of elastic fibers, at least in the dermis of PXE
patients, might depend on local scarce availability of the
active carboxylated form of MGP.26This hypothesis is in
agreement with data obtained on transgenic animals showing
that local, and not systemic, expression of MGP inhibits
extracellular matrix calcification,34and with findings show-
ing that only living smooth muscle cells producing MGP are
able to prevent calcification of aortic rings in organ culture.37
How to reconcile ABCC6 mutations in PXE with impaired
expression and maturation of MGP is an open question.
In the absence of knowledge on the physiological role of
the membrane transporter responsible for PXE, we approach
the problem of clinical manifestations in PXE by trying
to understand the mechanisms of elastic fiber calcification,
to identify cells involved and to characterize alterations of
connective tissue metabolism relevant for the progression of
disease.
It has been repeatedly reported that fibroblasts from
patients, despite their very low or absent expression of the
Figure 7 Immunolocalization of noncarboxylated MGP (Glu-MGP) on in
vitro fibroblasts from control (a) and PXE patients (b). In both cases, MGP
localized on membranes of the endoplasmic reticulum. The amount of
noncarboxylated MGP, evaluated as number of gold particles (gp) per unit
area, was similar in control (a) and PXE fibroblasts (b). Bar: 0.1mm.
Figure 8 Immunolocalization of g-carboxylated MGP (Gla-MGP) on in vitro
fibroblasts from controls (a) and PXE patients (b). In both cases, MGP
localized on membranes of the endoplasmic reticulum. The amount of
g-carboxylated MGP, evaluated as number of gold particles (gp) per unit
area, was much higher in control (a) than in PXE fibroblasts (b) (Po0.001).
Bar: 0.1mm.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
1006Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org

Page 10

PXE causative gene,39exhibit and maintain, at least up to
the tenth passage in vitro, behavioral,29biochemical,40,41and
degradation42properties different from controls. Therefore,
PXE fibroblasts seem to bear permanent metabolic altera-
tions that are maintained when cultured in vitro and that,
in vivo, could be responsible for local clinical manifestations.
We have recently reported that PXE fibroblasts in vitro
suffer from a mild chronic oxidative stress with production of
significantly higher amount of malondialdehyde compared to
controls.43Since malondialdehyde is the final product of
phospholipid peroxidation induced by oxidative stress, the
organization of cell membranes in PXE would be different
from controls (unpublished data). This, in turn, may affect
the activity of enzymes localized on membranes of the endo-
plasmic reticulum, such as the enzyme g-carboxylase,44,45
whose activity is necessary for MGP g-carboxylation.
Therefore, disturbance of the g-carboxylase system, however
induced, might lead to deficient expression of active MGP.
Very recently, skin and vessel alterations similar to those in
PXE have been observed in patients suffering from vitamin
K-dependentcoagulationfactor
with mutations in genes coding for enzymes involved in
the g-carboxylation pathway and recycling.27Therefore,
maturation of MGP by the vitamin K-dependent g-carboxy-
lase, an endoplasmic reticulum enzyme, has fundamental
importance in preventing extracellular matrix calcification
and, in particular, calcification of dermal elastic fibers similar
to those in PXE.27PXE patients do not suffer from coagu-
lation deficiency and those of the present study had normal
levels of factors II and VII. Therefore, it is not that MGP
deficiency in PXE patients may depend on alterations in the
vitamin K-dependent g-carboxylase system per se.
The present report indicates that elastic fiber calcification
in PXE is associated with scarce expression and accumulation
within elastic fibers of the mature g-carboxylated form of
MGP, an inhibitor of ectopic calcification in soft connective
tissues. Moreover, since the reduced expression of the mature
g-carboxylated form of MGP by PXE dermal fibroblasts is
associated with significant lower amount of circulating
MGP in patients compared to controls, we suggest that
fibroblasts may be, at least partially, responsible for the low
level of circulating MGP. This is in agreement with recent
observations that mature MGP is synthesized by cells in
periphery,34where it would exert local inhibition of ectopic
calcification.12,34,37
In conclusion, impaired maturation of MGP would be part
of the metabolic alterations of PXE fibroblasts and could play
a relevant role in time-dependent stability of elastic fibers
in PXE.
deficiencyassociated
ACKNOWLEDGEMENT
We are grateful to members of PXE-Italia ONLUS for their help in donating
samples, to PXE-International for the support, to Dr Marcello Pinti who
supervised RT-PCR experiments, and to Professor Lionel Bercovitch for
precious criticisms and help with the manuscript. Grants and support: MIUR
(2004064073-001); EC (LSHM-CT-2005-512117- GENESKIN); EC, LSHM-CT-
2005-018960-ELASTAGE).
1. Schinke T, McKee MD, Karsenty G. Extracellular matrix calcification:
where is the action? Nat Genet 1999;21:150–151.
2. Denecke B, Graber S, Scafer C, et al. Tissue distribution and activity
testing suggest a similar but not identical function of fetuin-B and
fetuin-A. Biochem J 2003;376:135–145.
3. Schafer C, Heiss A, Schwarz A, et al. The serum protein a2 Heremans-
Schmid glycoprotein/fetuin-A is a systemically acting inhibitor of
ectopic calcification. J Clin Invest 2003;112:357–366.
4. Schinke T, Amendt C, Trindl A, et al. The serum protein a2-HS
glycoprotein/fetuin inhibits apatite formation in vitro and in
mineralizing calvaria cells. J Biol Chem 1996;271:20789–20796.
5. Heiss A, DuChesne A, Denecke D, et al. Structural basis of calcification
inhibition by alpha-2-HS glycoprotein/fetuin-A. Formation of colloidal
calciprotein particles. J Biol Chem 2003;278:13333–13341.
6. Hendig D, Schulz V, Arndt M, et al. Role of serum fetuin-A, a major
inhibitor of systemic calcification, in pseudoxanthoma elasticum. Clin
Chem 2006;52:227–234.
7. Danielsen L, Kobayasi T, Larsen HW, et al. Pseudoxanthoma elasticum.
A clinico-pathological study. Acta Derm Venereol 1970;50:355–373.
8. Pasquali Ronchetti I, Volpin D, Baccarani Contri M, et al.
Pseudoxanthoma elasticum: biochemical and ultrastructural study.
Dermatologica 1981;163:307–326.
9. Gheduzzi D, Sammarco R, Quaglino D, et al. Extracutaneous
ultrastructural alterations in pseudoxanthoma elasticum. Ultrastruct
Pathol 2003;27:375–384.
10. Price PA, Williamson MK, Nguyen TMT, et al. Serum levels of the
fetuin–mineral complex correlate with arterial calcification in the rat.
J Biol Chem 2004;279:1594–1600.
11. Price PA, Williamson MK. Primary structure of bovine matrix
Gla protein, a new vitamin K-dependent bone protein. J Biol Chem
1985;260:14971–14975.
12. Luo G, Ducy P, McKee MD, et al. Spontaneous calcification of arteries
and cartilage in matrix gla protein. Nature 1997;386:78–81.
13. Munroe PB, Olgunturk RO, Fryns JP, et al. Mutations in the gene
encoding the human matrix Gla protein cause Keutel syndrome. Nat
Genet 1999;21:142–144.
14. Meier M, Weng LP, Alexandrakis E, et al. Tracheobronchial stenosis in
Keutel syndrome. Eur Resp J 2001;17:566–569.
15. Fraser JD, Price PA. Lung, heart, and kidney express high levels of
mRNA for the vitamin K-dependent matrix Gla protein: implications for
the possible functions of matrix Gla protein and for the tissue
distribution of the gamma-carboxylase. J Biol Chem 1988;263:
11033–11036.
16. Hale JE, Fraser JD, Price PA. The identification of matrix Gla protein in
cartilage. J Biol Chem 1988;263:5820–5824.
17. Shanahan CM, Weissberg PL, Metcalfe JC. Isolation of gene markers of
differentiated and proliferating vascular smooth muscle cells. Circ Res
1993;73:193–204.
18. Rannels SR, Cancela ML, Wolpert EB, et al. Matrix Gla protein gene
expression in cultured type II pneumocytes. Am J Physiol
1993;265:L270–L278.
19. Mori K, Shioi A, Jono S, et al. Expression of matrix Gla protein (MGP) in
an in vitro model of vascular calcification. FEBS Lett 1998;433:19–22.
20. Yagami K, Suh JY, Enomoto-Iwamoto M, et al. Matrix GLA protein is a
developmental regulator of chondrocyte mineralization and, when
constitutively expressed, blocks endochondral and intramembranous
ossification in the limb. J Cell Biol 1999;147:1097–1108.
21. Howe AM, Webster WS. Warfarin exposure and calcification of the
arterial system in the rat. Intern J Exp Path 2000;81:51–56.
22. Price PA, Faus SA, Williamson MK. Warfarin causes rapid calcification of
the elastic lamellae in rat arteries and heart valves. Arterioscler Thromb
Vasc Biol 1998;18:1400–1407.
23. Price PA, Faus SA, Williamson MK. Warfarin-induced artery calcification
is accelerated by growth and vitamin D. Arterioscler Thromb Vasc Biol
2000;20:317–327.
24. Taybi H, Capitanio MA. Tracheobronchial calcification: an observation
in three children after mitral valve replacement and warfarin sodium
therapy. Radiology 1990;176:728–730.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
www.laboratoryinvestigation.org | Laboratory Investigation | Volume 87 October 20071007

Page 11

25. Schori TR, Stungis GE. Long-term warfarin treatment may induce
arterial calcification in humans: case report. Clin Invest Med
2004;27:107–109.
26. Spronk HM, Soute BA, Schurgers LJ, et al. Matrix Gla protein
accumulates at the border of regions of calcification and normal
tissue in the media of the arterial vessel wall. Biophys Biochim Res
Commun 2001;289:485–490.
27. Vanakker O, Martin L, Gheduzzi D, et al. Pseudoxanthoma elasticum-
like phenotype with cutis laxa and multiple coagulation factor
deficiency represents a separate genetic entity. J Invest Dermatol
2007;127:581–587.
28. Gheduzzi D, Guidetti R, Anzivino C, et al. ABCC6 mutations in Italian
families affected by pseudoxanthoma elasticum (PXE). Hum Mutat
2004;24:438–439.
29. Quaglino D, Boraldi F, Barbieri D, et al. Abnormal phenotype of in vitro
dermal fibroblasts from patients with pseudoxanthoma elasticum
(PXE). Biochim Biophys Acta 2000;1501:51–62.
30. Livak Kj, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2?DDCtmethod. Methods
2001;25:402–408.
31. Baccarani Contri M, Boraldi F, Taparelli F, et al. Matrix proteins with
high affinity for calcium ions are associated with mineralization within
the elastic fibers of pseudoxanthoma elasticum dermis. Am J Pathol
1996;148:569–577.
32. Schurgers LJ, Teunissen KJF, Knapen MHJ, et al. Novel conformation-
specific antibodies against matrix g-carboxyglutamic acid (Gla) protein.
Undercarboxylated matrix Gla protein as marker for vascular
calcification. Arterioscler Thromb Vasc Biol 2005;25:1629–1633.
33. Schurgers LJ, Teunissen KJF, Knapen MHJ, et al. Characteristics and
performance of an immunosorbent assay for human matrix
Gla-protein. Clin Chim Acta 2005;351:131–138.
34. Murshed M, Schinke T, McKee MD, et al. Extracellular matrix
mineralization is regulated locally; different roles of two gla-containing
proteins. J Cell Biol 2004;165:625–630.
35. Tamburro AM, Guantieri V, Daga-Gordini D, et al. Concentration-
dependent conformational transition of alpha elastin in aqueous
solution. J Biol Chem 1978;253:2893–2894.
36. Gordon SG, Subryan VL, Solomons CC, et al. In vitro uptake of calcium
by dermis of patients with pseudoxanthoma elasticum. J Lab Clin Med
1975;86:638–643.
37. Price PA, Chan WS, Jolson DM, et al. The elastic lamellae of devitalized
arteries calcify when incubated in serum: evidence for a serum
calcification factor. Arterioscler Thromb Vasc Biol 2006;26:
1079–1085.
38. Luo G, D’Souza R, Hogue D, et al. The matrix gla protein gene is
a marker of the chondrogenesis cell lineage during mouse
development. J Bone Miner Res 1995;10:325–334.
39. Matsuzaki Y, Nakano A, Jiang QJ, et al. Tissue-specific expression of the
ABCC6 gene. J Invest Dermatol 2005;125:900–905.
40. Passi A, Albertini R, Baccarani-Contri M, et al. Proteoglycan alterations
in skin fibroblast cultures from patients affected with
pseudoxanthoma elasticum. Cell Biochem Funct 1996;14:111–120.
41. Tiozzo-Costa R, Baccarani-Contri M, Cingi MR, et al. Pseudoxanthoma
elasticum (PXE): ultrastructural and biochemical study on proteoglycan
and proteoglycan-associated material produced by skin fibroblasts
in vitro. Coll Rel Res 1988;8:49–64.
42. Quaglino D, Tiozzo R, Passi A, et al. Metalloproteases/antiproteinases
imbalance in cultured dermal fibroblasts from pseudoxanthoma
elasticum patients. Biochim Biophys Acta 2005;1741:42–47.
43. Pasquali Ronchetti I, Garcia-Fernandez MI, Boraldi F, et al. The
occurrence of oxidative stress in fibroblasts from patients with
pseudoxanthoma elasticum. Its role in the pathogenesis of clinical
manifestations. J Pathol 2006;207:54–61.
44. Cain D, Hutson SM, Wallin R. Assembly of the warfarin-sensitive
vitamin K 2,3, epoxide reductase enzyme complex in endoplasmic
reticulum membrane. J Cell Biol 1997;272:29068–29075.
45. Tie J, Wu SM, Jin D, et al. A topological study of the human g-glutamyl
carboxylase. Blood 2000;96:973–978.
MGP and elastic fiber calcification in PXE
D Gheduzzi et al
1008 Laboratory Investigation | Volume 87 October 2007 | www.laboratoryinvestigation.org