Content uploaded by Malgorzata Milner-Krawczyk
Author content
All content in this area was uploaded by Malgorzata Milner-Krawczyk on Oct 10, 2014
Content may be subject to copyright.
Regular paper
Engineered resistance against proteinases
Malgorzata Milner
1
, Jadwiga Chroboczek
2
and Wlodzimierz Zagorski-Ostoja
1
1
Department of Protein Biosynthesis, Institute of Biochemistry and Biophysics, Polish Academy of Sciences,
Warszawa, Poland;
2
Laboratoire de Biophysique Moléculaire, Institut de Biologie Structurale, Grenoble,
Cedex 1, France
Received: 08 May, 2007; revised: 02 July, 2007; accepted: 20 August, 2007
available on-line: 06 September, 2007
Exogenous proteinase inhibitors are valuable and economically interesting protective biotechno-
logical tools. We examined whether small proteinase inhibitors when fused to a selected target
protein can protect the target from proteolytic degradation without simultaneously aecting the
function and activity of the target domain. Two proteinase inhibitors were studied: a Kazal-type
silk proteinase inhibitor (SPI2) from Galleria mellonella, and the Cucurbita maxima trypsin in-
hibitor I (CMTI I). Both inhibitors target serine proteinases, are small proteins with a compact
structure stabilized by a network of disulde bridges, and are expressed as free polypeptides in
their natural surroundings. Four constructs were prepared: the gene for either of the inhibitors
was ligated to the 5’ end of the DNA encoding one or the other of two selected target proteins,
the coat protein (CP) of Potato potyvirus Y or the Escherichia coli β-glucuronidase (GUS). CMTI
I fused to the target proteins strongly hampered their functions. Moreover, the inhibitory activ-
ity of CMTI I was retained only when it was fused to the CP. In contrast, when fused to SPI2,
specic features and functions of both target proteins were retained and the inhibitory activity of
SPI2 was fully preserved. Measuring proteolysis in the presence or absence of either inhibitor,
we demonstrated that proteinase inhibitors can protect target proteins used either free or as a fu-
sion domain. Interestingly, their inhibitory eciency was superior to that of a commercial inhibi-
tor of serine proteinases, AEBSF.
Keywords: proteinase inhibitors, protein protection, fusion proteins
INTRODUCTION
Proteolysis, the hydrolytic cleavage of peptide
bonds, is responsible for many specialized intra- and
extra-cellular biological processes. Enzymes respon-
sible for proteolysis (designated proteinases or pro-
teases) are encoded by approx. 2% of all genes and
et al., 2001). Although unquestionably indispensable,
they are potentially very damaging to the cell and
therefore mechanisms for their control have evolved.
One of these mechanisms is based on inactivation of
proteinases by complex formation with polypeptide
inhibitors (Laskowski & Kato, 1980; Enghild et al.,
1990). Two functional groups of proteinase inhibi-
tors can be distinguished, one that reacts with the
target proteinase through an irreversible “trapping”
mechanism, the other using tight-binding reactions
(Rawlings et al.
are rather small proteins (27–200 amino acids) and
Corresponding author: Malgorzata Milner,
Department of Protein Biosynthesis, Institute of Biochemistry and Biophysics
gosiam@ibb.waw.pl
AbbreviationsCu-
curbita maxima trypsin inhibitor I; CMTI::CP, protein fusion of CMTI I and CP; CMTI::GUS, protein fusion of CMTI I and
, inhibitor concentration required
-thiogalactoside; K
i
, inhibitory dissociation constant; K
m
,
2
-TNBS, amino groups
-
Vol. 54 No. 3/2007, 523–536
on-line at: www.actabp.pl
524 2007
M. Milner and others
-
teinases of one mechanistic class (serine, cysteine,
Moreover, in most cases these inhibitors contain a
-
have been used as an auxiliary criterion for inhibi-
-
ings et al., 2004). The majority of presently known
inhibitors are directed towards serine proteinases
and interact with the proteinase via an exposed re-
active-site loop in a so-called canonical or substrate-
-
ber, 1992; Laskowski et al., 2000). The binding loop
of the inhibitor on which the reactive site residue P1
of the proteinase as would be a substrate, with the
scissile peptide bond approaching and blocking the
catalytic proteinase residue in a noncovalent, near-
known and are the subject of an overwhelming
number of research communications. Their potential
for application in medicine, agriculture or biotech-
nology makes them objects of special interest (Xiao
et al., 1999; Shi et al., 2001; Mandal et al., 2002; Na-
in the virus replication cycle, their inhibitors are at-
tractive candidates for the design of new antiviral
strategies (Kondo et al., 1992; Cimerman et al., 1996;
Gutierrez-Campos et al., 1999; Takahashi et al., 1999).
Last but not least, exogenous proteinase inhibitors
can be considered as valuable and economically im-
portant protective tools, for example in bioreactors,
where they can enhance the yield and prolong the
life of desired protein products.
-
teins that are proteinase inhibitors, 1) a silk protei-
nase inhibitor (SPI2) of the Kazal-type, recently de-
scribed as a natural component of the silk of Galleria
mellonella (Nirmala et al., 2001), and 2) the Cucurbita
maxima trypsin inhibitor I (CMTI I) of the squash
inhibitor family (Bolewska et al.
shortest known single-domain member of the Kazal
kDa) with unique structural features. Each typical
Kazal-type domain includes six conserved cysteines
bridges dictating the formation of three rings des-
ignated A, B and C (Laskowski & Kato, 1980; Nir-
mala et al., 2001). SPI2 is atypical, as cysteines I and
In contrast, the B-ring with its P1 reactive site resi-
due is highly conserved suggesting that it is prob-
ably crucial for the inhibitory activity (Nirmala et al.,
2001). SPI2 has been shown to be active against fun-
gal and bacterial serine proteinases with the strong-
est inhibition directed against proteinase K from the
mould Tritirachium album, and subtilisin from Bacil-
lus subtilis; its activity against trypsin is relatively
weak (Nirmala et al., 2001). CMTI I is one of the best
known representatives of the family of squash pro-
teinase inhibitors (Leluk et al. et al., 1989;
Otlewski & Krowarsch, 1996) that are composed
-
tures. Similarly to the members of the Kazal fam-
ily, the most important structural feature of squash
inhibitors is the tight cross-linking of the polypep-
et al.,
et al., 1989; Stachowiak et al., 1990). The
squash inhibitors strongly inhibit bovine trypsin and
a number of medically important serine proteinases
(Otlewski et al. et al., 1994).
In the present study, we investigated whether
these small polypeptide inhibitors fused to a cho-
sen target protein could protect the target protein
and activity of the target domain. As target proteins,
Shukla et al., 1988; Shukla & Ward, 1989) and bacte-
-
-
tures – the ability to form supramolecular structures
spontaneously, and enzymatic catalysis, respectively.
It has been shown that potyviral CPs when puri-
Escherichia
coli, yeast or a baculovirus system form long rod-
by electron microscopy (EM; McDonald et al., 1976;
et al., 1991; Ed-
wards et al., 1994). Additionally, a model for these
rod-shaped particles has been proposed (Shukla &
Ward, 1989; Jagadish et al., 1996) and the conditions
-
et al.,
-
-glucuronides to -glu-
curonic acid and aglycones (Gallagher, 1992; Wenzl
et al.
E. coli gusA gene, it is a stable enzyme that has de-
sirable properties for the construction and analysis
of gene fusions (Gallagher, 1992). Both the structure-
forming capacity of the CP and the catalytic activity
of GUS are easy to analyse; CP oligomerizes form-
measurable enzymatic activity.
-
activity. In proteolysis experiments (using a serine
proteinase, either proteinase K or trypsin) we dem-
onstrated that when fused to the target domains,
Vol. 54 525
Engineered resistance against proteinases
SPI2 or CMTI I generally preserved their inhibitory
superior to that of the commercial inhibitor of serine
proteinases AEBSF (4-(2-aminoethyl)benzenesulfonyl
MATERIALS AND METHODS
Plasmid construction. Recombinant DNA ma-
nipulations were carried out using standard protocols
(Sambrook & Russell, 2001). The genes encoding the
target proteins were prepared as follows. Total RNA
potato leaf tissue using the RNeasy Plant Mini Kit
synthesis with oligo(dT)
21
as primer and the Super-
Script II reverse transcriptase (Invitrogen), as recom-
gene (Timmermans et al., 1990) served as templates
for PCR reactions with primers corresponding to
the DNA regions encoding the N- and C-termini of
CP and GUS, respectively. The CP coding sequence
1
and CP
2
as forward and re-
verse primers, respectively, and the GUS gene was
1
and GUS
2
as forward and re-
verse primers, respectively (Table 1). The primers
used were extended to introduce an NcoI site with
an ATG codon and an Xho
-
action mixture with Pfu DNA polymerase (Promega)
as recommended by the supplier. The annealing
o
C (for the CP primer pair) or
o
C (for the GUS primer pair). The resulting PCR
agarose gels, extracted using the Gel Extraction Kit
(Qiagen), and cloned into the SmaI site of the pBlue-
script II KS plasmid (pBl, Stratagene). Subsequently,
the inserts were cleaved from the pBl recombinant
vectors with XhoI and Nco
a 1% agarose gel, extracted as above and cloned be-
tween the XhoI and NcoI sites of the pET28a plasmid
(Novagen). The resulting recombinant plasmids are
designated pCP and pGUS.
Krystyna Grzelak, IBB PAS) and pAED4 (containing
Bolewska et al.
reactions with primers corresponding to the DNA
regions encoding the N- and C-termini of the SPI2
and CMTI I proteinase inhibitors and extended to
introduce an NcoI site into both ends of the ampli-
-
tion of the SPI2 gene were SPI
1
and SPI
2
as forward
and reverse primers, respectively (Table 1), and
those used to amplify the CMTI I gene were CMTI
1
and CMTI
2
as forward and reverse primers, respec-
tively (Table 1). PCR was carried out as indicated
above for CP and GUS with the annealing tempera-
o
o
C (for the CMTI
-
Gel Extraction Kit, and cloned into the SmaI site of
pBl. The pBl plasmid containing the SPI2 or CMTI I
sequence was digested with NcoI. The inserts were
NcoI
site of the previously obtained pCP and pGUS. The
resulting recombinant plasmids were pSPI::CP, pC-
MTI::CP, pSPI::GUS and pCMTI::GUS (Fig. 1). The
ET2188 (complementary to the region upstream of
the T7 promoter; Table 1) as forward primer, and
SPI
2
or CMTI
2
as reverse primer. All inserts and fu-
sion genes were sequenced and proven to be correct.
The molecular mass of the expected proteins was
predicted on the basis of their amino-acid composi-
tion using ProtParam from the ExPASy Proteomics
Server.
Expression in E. coli and purication of recom-
binant proteins. The E. coli
(Novagen) was transformed with the recombinant
plasmids according to the Novagen manual. Since
Table 1. List of primers.
Primer Restriction site
CP
1
GGACCATGGAAGCAAATGACACAATC NcoI
CP
2
GACCTCGAGCATGTTCTTGACTCC XhoI
SPI
1
GGACCATGGCCGCAGTTTGCACCACCGAGT NcoI
SPI
2
GACCCATGGAACATTCACCTTCATGATC NcoI
GUS
1
GACCATGGTGTTACGTCCTGTAGAAAC NcoI
GUS
2
GACTCGAGTTGTTTGCCTCCCTGCT XhoI
CMTI
1
GACCATGGCGCGTGTTTGCCCGCGTATCCT NcoI
CMTI
2
GACCATGGCACCGCAGTAACCGTGTTCCA NcoI
ET2188 GATCTCGATCCCGCGAAAT
NcoI and XhoI sites are underlined.
526 2007
M. Milner and others
-
o
C
-
cin. When the OD
600
reached 0.6–0.9, expression
of the recombinant proteins was induced with 0.4
-thiogalactoside (IPTG) and the
cultures were further incubated at 26–28
o
addition of IPTG, growth of the transformed cells
was monitored at OD
600
every hour. To follow
the expression of the recombinant proteins, equal
amounts of cell extracts (corresponding to 1 ml
of culture cells, OD
600
on a 12% polyacrylamide-SDS gel, stained with
Coomassie Brilliant Blue and the protein expres-
-
-
ware (ZERO-Dscan of Scanalytics, Inc.). Finally,
centrifugation, lysed and the recombinant proteins
agarose resin according to the QIA expressionist
manual (Qiagen). The column fractions were ana-
eluted proteins was determined using the Protein
Assay kit (Bio-Rad) with bovine serum albumin
-
combinant proteins were dialyzed overnight at 4
o
C
the case of the CP and its SPI2 fusion, the dialyzed
proteins were concentrated by 2 h ultracentrifuga
-
g, 4
o
C) and the pellets redissolved in
imaging.
Negative stain electron microscopy. Sam-
ples of CP, SPI::CP and CMTI::CP fusions at approx.
-
et al., 1968). Micrographs were taken with
-
cation of 40 000 times.
GUS uorometric assay. The activity of re-
combinant GUS, SPI::GUS and CMTI::GUS was
measured as described (Rao & Flynn, 1990). The
-
liferone (MU), which is a product of the enzymatic
-glucuronide
(MUG). The assays were performed using micro-
-
ume of MUG added to the reaction mixture), 220
pM (0.011 pmoles) recombinant GUS or one of its
fusions, and either 7 mM MUG in time course as-
says or 0.8 to 7.2 mM MUG to determine Michae-
lis constants (K
m
) and maximal velocities (V
max
).
The control assay was performed without GUS or
its fusions. The reaction mixtures were incubated
o
C for the times indicated and terminated by
2
CO
. The mixtures
for standard curve determinations contained 200
2
CO
and MU concentrations rang-
performed in a Synergy
TM
-
croplate reader (Bio-Tek Instruments) with the ex-
pmoles of MU, calculated on the basis of the MU
standard curve. The K
m
and V
max
values were de-
Figure 1. Schematic representation of
the DNA constructs.
A. pCP or pGUS; B. pSPI::CP or pSPI::
GUS; C. pCMTI::CP or pCMTI::GUS;
-
(600 amino acids); SPI2, silk proteinase
C.
maxima -
ids). Not to scale.
Vol. 54 527
Engineered resistance against proteinases
Proteinase assays. Proteinase K (Fermentas)
or trypsin (bovine pancreas, Boehringer Mannhe-
im) were used as target enzymes of the proteinase
inhibitors and their fusions. Inhibition of protei-
nase K and trypsin activity was measured using
azocoll (Calbiochem), a red dye-labeled standard
proteinase substrate (Chavira et al., 1984). The as-
with a microtiter plate photometer. Azocoll was
treated as described (Nirmala et al., 2001) and used
of SPI2 and its fusions or CMTI I and its fusions
to each well. In negative controls (no proteolytic
and in positive controls (no inhibitory activity) the
o
C for 2 h
and centrifuged (1800 r.p.m., 2 min, 4
o
C) to pellet
-
ferred to another microtiter plate. The absorbance
of the azo-dye liberated by the proteolytic activ-
ity of proteinase K or trypsin was measured at 492
nm in a Synergy
TM
-
sorbance between the positive and negative con-
trols was taken as representing 100% proteinase
activity. For each sample, a plot of percentage of
proteinase activity versus concentration of protein-
ase inhibitor was established to calculate the IC
(concentration of the inhibitors corresponding to
values. The inhibitory activity titre of the samples
assayed was calculated from triplicate measure-
ments.
Determination of the inhibitory dissocia-
tion constants. The inhibition of proteinase K and
trypsin activity was measured spectrophotometri-
cally with succinylated casein (Calbiochem) as
substrate. The increase in concentration of amino
2
) appearing by hydrolysis of the suc-
cinylated casein was measured with trinitroben-
zene sulfonic acid (TNBS; Sigma). TNBS reacts
2
groups forming an adduct that
method can be used for kinetic analyses of protei-
nase activity (Surovtsev et al., 2001). The kinetic
constants were determined by incubating the en-
zymes in the absence or presence of two concen-
trations of SPI2, SPI::CP and SPI::GUS (for pro-
teinase K) or CMTI I and CMTI::CP (for trypsin),
with increasing substrate concentrations. The av-
erage molecular mass of succinylated casein was
-
-
-
pmoles) or trypsin (10.4 pmoles). In negative con-
o
C for
2
2
-TNBS) resulting from the
proteolytic activity of proteinase K or trypsin was
measured in a multi-detection microplate reader
2
2
-TNBS ex-
–1
cm
–1
) was used as
determined by Mathrubutham et al. www.
). Ini-
tial rate studies and dissociation constant deter-
minations were performed by the nonlinear least-
according to the equation: v = V
max
K
m
K
i
)) where K
m
is the Michaelis constant, V
max
is the
maximum reaction velocity at saturating substrate
concentration S, K
i
is the dissociation constant for
the enzyme–inhibitor complex, and I is the inhibi-
tor concentration.
Comparative proteolysis. I. Recombinant
-
teinase K digestion. In the reaction mixtures 970
nM SPI::GUS or GUS was digested in the presence
of proteinase K. The molar ratio between the SPI::
GUS fusion and proteinase K was about 12 times
-
nase K activity. The incubations were performed
o
proteinase K. Subsequently, the reactions were di-
II. Recombinant CP, its fusion to SPI2 and
proteinase K digestion in the absence or presence
of SPI2 alone or AEBSF (Sigma). In the reaction
mixtures the molar ratio between the inhibitors
and proteinase K was about 12 times higher than
-
o
Negative controls were reactions without protei-
nase K. Subsequently, the digestion results were
528 2007
M. Milner and others
RESULTS
Protein expression and purication
The recombinant proteins CP, GUS and the
four fusion proteins SPI::CP, CMTI::CP, SPI::GUS
and CMTI::GUS, tagged with 6 histidine residues
in E. coli
-
pected molecular masses of the recombinant CP and
the recombinant GUS and its fusions SPI::GUS and
-
tively. The molecular masses of all recombinant pro-
shown).
Growth of the transformed cells was moni-
OD
600
(Fig. 2A, C). Untransformed control cultures
were treated with the same concentrations of IPTG.
Growth of the cells expressing the CP or its fusions
-
ence the rate of transformant growth (Fig. 2A, C). Al-
though the CMTI::CP production level was slightly
lower than that of CP or SPI::CP, it seemed that the
growth of these three transformants inversely corre-
lated with overproduction of CP variants (Fig. 2A,
B). The growth rate of cells overproducing recom-
binant GUS or its fusion to proteinase inhibitors was
comparable to that of the control culture and did
not seem to be negatively correlated with expression
of the foreign proteins (Fig. 2C, D).
Characterization of puried recombinant proteins
The preservation of structural and physi-
by negative stain electron microscopy (NS-EM).
Analysis of CP and SPI::CP revealed the presence
sign of helical packing in Fourier transform from
NS-EM images was detected suggesting that in
Figure 2. Growth of bacterial cultures in relation to the level of expression of recombinant proteins.
A and C E. coli cells
were transformed with pCP, pSPI::CP or pCMTI::CP (A) or pGUS, pSPI::GUS or pCMTI::GUS (C); controls were untrans-
formed cells. B and D. Expression level of recombinant proteins: CP, SPI::CP or CMTI::CP (B); GUS, SPI::GUS or CMTI::
-
using the ZERO–Dscan (Scanalytics, Inc.) program.
Vol. 54 529
Engineered resistance against proteinases
-
stant, identical diameter (M. Milner, J. Conway and
such as Johnsongrass mosaic virus, i.e. highly het-
erogeneous in length but of constant diameter (Mc-
et al., 1991). At
-
binant CP or SPI::CP tended to disaggregate and at
(not shown). As opposed to SPI::CP, self-assembly
few short and badly ordered aggregates could be
To evaluate the enzymatic activity of GUS,
SPI::GUS and CMTI::GUS, the proteins were tested
employing MUG as a substrate, and the appearance
of the reaction product MU was measured spec-
were enzymatically active, CMTI::GUS possessing
the lowest activity (Table 2; Fig. 4A). The linear-
ity of increasing product (MU) concentra-
by time course assays (Fig. 4). To ensure
maximum saturation of the enzyme with
the substrate, the substrate concentration
for the time course assays was based on
preliminary kinetic data as 7 times the
K
m
. Nonlinear regression on MUG satu-
ration curves was performed to calculate
the K
m
and V
max
of GUS and its fusions
(Table 2). The
K
m
values for the three en-
zymes were quite similar but the values
Table 2. Comparison of enzymatic properties of GUS and its fu-
sions: SPI::GUS and CMTI::GUS.
GUS SPI::GUS CMTI::GUS
K
m
[mM]
V
max
8.8 ± 0.14
V
max
K
m
60.72
Each protein was tested with MUG as substrate, and the MU product was
constants and maximal velocities were determined by the nonlinear least-
Figure 3. Electron microscopy (negative stain) of recombinant CP, SPI::CP and CMTI::CP particles.
A, C and E B, D and F -
A, C, E, respectively.
530 2007
M. Milner and others
the fusion proteins, the lowest V
max
being for CMTI::
GUS. Although the ratio of V
max
to K
m
is not an ide-
-
cy. The V
max
K
m
ratio suggested that the fusion with
proteinase inhibitors changed the enzymatic activity
of the GUS target protein especially when fused to
(Table 2; Fig. 4A).
features and functions of both target proteins were
retained, with some reduction of the target protein
enzymatic activity. On the contrary, fusion with
CMTI I resulted in structural changes of the CP im-
-
tion of GUS activity.
Inhibitory properties of recombinant proteins
SPI2 is known to inhibit fungal and bacte-
rial serine proteinases with the strongest inhibition
directed against proteinase K (Nirmala et al., 2001).
Likewise, CMTI I is active against trypsin and some
medically important serine proteinases (Otlewski et
al. et al., 1994). Considering its avail-
ability, proteinase K was chosen to study the inhibi-
tory capacity of SPI2 analysed alone or fused to CP
or to GUS. Similarly, CMTI I and its both fusions
were analysed in reactions with trypsin. The inhibi-
tory activities of the recombinant proteins towards
proteinase K or trypsin were determined by quanti-
The IC
is the concentration of inhibitor required for
values
CP and SPI::GUS, respectively) were in a similar, na-
nomolar range as the values obtained for SPI2 alone
CP and SPI::GUS were much stronger inhibitors of
proteinase K than the commercially available AEBSF
6
nM). Even the highest IC
value obtained
for SPI::GUS (80.6 nM) was about thirty thousand
6
nM).
Similarly, the IC
of proteins fused to CMTI I were
Figure 4. Enzymatic activity of GUS and its fusions.
A. Each protein (0.011 pmole) was tested with 7 mM MUG as substrate and the appearance of MU was measured spec-
B. Enzymatic activity of 0.011 pmoles of SPI::GUS or
Table 3. Inhibition of proteinase K activity by SPI2 and
its fusions versus that by AEBSF.
IC
[nM] K
i
[nM]
SPI
SPI::CP
SPI::GUS 80.6 ± 4.2
CP no inhibition
GUS no inhibition
AEBSF
6
IC
of proteinase activity. Proteinase K activity was measured as de-
scribed in Materials and Methods with 28.7 nM proteinase K. The
inhibition of proteinase K activity was observed with neither CP
(up to 4200 nM) nor with GUS (up to 166 nM). The inhibitory dis-
sociation constants (K
i
) were determined by the nonlinear least-
Table 4. Inhibition of trypsin activity by CMTI I and its
fusions versus that by AEBSF.
IC
[nM] K
i
[nM]
CMTI 4.8 ± 0.47
CMTI::CP
CMTI::GUS no inhibition
CP no inhibition
GUS no inhibition
AEBSF
IC
proteinase activity. Trypsin activity was measured as described in
-
hibition of trypsin activity was observed with neither CMTI::GUS
The inhibitory dissociation constants (K
i
) were determined by the
Vol. 54 531
Engineered resistance against proteinases
compared to the IC
calculated for non-fused CMTI
I and AEBSF (Table 4). For CMTI::GUS, inhibition
of trypsin activity was not observed. Although the
IC
-
dred times higher than the IC
for CMTI I alone
(4.8 nM), it was still about six times lower than the
IC
for AEBSF (Table 4). Inhibition of proteinase K
or trypsin was not observed for either target protein
Inhibition kinetics experiments allowed us
to compare the inhibition mechanisms of SPI2 and
-
ues of the apparent catalytic constants (not shown)
and inhibition parameters (inhibitory dissociation
K
i
) for SPI2 and its fusions, or CMTI
using succinylated casein as substrate and protein-
ase K or trypsin, respectively. Calculation of the best
estimate of the K
i
for the reversible enzyme-inhibi-
tor complex was performed by nonlinear regression
analysis. Initial kinetic assessment, at two inhibi-
tor concentrations, illustrated by Lineweaver-Burk
-
dicated the same competitive-type inhibition for the
SPI2 and CMTI I inhibitors and their fusions. The
K
i
values were generally in agreement with the IC
appear to be rather strong inhibitors. Nevertheless, a
change of the K
i
values of SPI::GUS and especially of
CMTI::CP in comparison to the K
i
of SPI2 and CMTI
I suggested that fusion of the inhibitor with the tar-
get protein reduced the strength of the interactions
between the inhibitory domain of the fusion protein
To further test whether fusion with small
the target proteins during the enzymatic reaction,
comparative proteolytic digestions were performed.
The results of proteinase K digestions were moni-
enzymatic activity of GUS and its SPI2 fusion (Fig.
K inhibition, the molar ratio between the inhibi-
tors and proteinase K was about 12 times higher
activity. In such conditions the enzymatic activity
of GUS was lost but the activity of SPI::GUS was
Figure 5. Lineweaver–Burk plots of the inhibition of pro-
teinase K by SPI2 and its fusions.
A. Proteinase K activity was measured in the absence
) SPI2.
B. Proteinase K activity was measured in the absence
) SPI::CP.
C
) SPI::GUS.
represents the mean value of three experiments and “I”
indicates the inhibitor concentration. The straight lines in-
-
Rafael, CA,
USA).
532 2007
M. Milner and others
totally retained (Fig. 4B). In further analyses the
proteinase K digestion in the absence or presence
of SPI2 or AEBSF (Fig. 7). CP or BSA (Fig. 7, lanes
7, 6) were readily hydrolysed by proteinase K. In
contrast, when SPI2 was added to the digestion
mixtures the CP and BSA (Fig. 7, lanes 9, 8) were
protected from proteolysis. When lower amounts of
SPI2 were tested, inhibition of proteinase K activity
was partial or not observed (not shown). Similarly,
inhibition of proteinase K was achieved when SPI::
CP was used (Fig. 7, lanes 10 and 11). SPI2 fused to
CP protected from hydrolysis by proteinase K not
only its fusion partner domain (CP) but also added
BSA (Fig. 7, lane 10). In contrast, AEBSF used at a
concentration equal to the concentration of SPI::CP
was unable to prevent proteolysis (Fig. 7, lanes 12
).
DISCUSSION
The aim of our study was to determine
whether selected small proteinase inhibitors fused
to a target protein could be used as tools protect-
ing the target proteins from proteolysis. To this
end, SPI2 from G. mellonella silk (Nirmala et al.,
2001) and CMTI I from C. maxima (Bolewska et al.,
E. coli GUS as target proteins.
Both SPI2 and CMTI I are small inhibitors with a
Figure 6. Lineweaver–Burk plots of the inhibition of trypsin by CMTI I and CMTI::CP.
A ) CMTI I. B. Trypsin
) CMTI::CP. The reciprocal of the ve-
-
San
Rafael, CA, USA).
Figure 7. SDS/PAGE analysis of recom-
binant CP and SPI::CP aer proteolytic
digestion with proteinase K in the ab-
sence or presence of inhibitors.
-
binant CP, SPI::CP and BSA (used as inter-
K. The inhibitors were present in the reac-
-
terials and Methods). Protein ladder: lane
The components of the digestion mixtures
are marked by black ovals in the diagram
above the gel.
Vol. 54 533
Engineered resistance against proteinases
well-known rigid structure stabilized by conserved
-
competitive inhibitors and share the same canoni-
cal-like mechanism of inhibition. They inhibit prote-
reactive site residue P1 into a cavity of the active
site of the proteinase (Laskowski et al., 2000). Con-
sidering the composition of the fusion proteins it is
worth noting that the P1 residues of SPI2 and CMTI
I are situated in the N-terminal regions of each se-
quence. Moreover, the C-terminus of CMTI I makes
Krowarsch, 1996). Similarly, the C-terminus of SPI2
seems to be spatially distant from the active centre
of the inhibitor and its P1 residue (I. Zhukov, un-
published results). The above data strongly suggest
that fusion of the target protein to the C-terminus
of SPI2 or CMTI I should be neutral with respect to
the functions of the two inhibitors. Selection of the
target proteins was performed to allow easy testing
of the CP to self-organize and the enzymatic activ-
ity of GUS. Both their genes and the target proteins
selected are genetically and biochemically very well
-
with the N- and C-terminal regions exposed on the
-
ver, surface exposition of the long and highly im-
munogenic N-terminus prevails over exposition of
the C-terminus (Shukla et al., 1988) suggesting that
fusing an additional polypeptide to the N-terminus
-
pacity. The tolerance of the N-terminal fusion has
previously been demonstrated for other potyvirus-
es (Jagadish et al., 1996; Fernandez-Fernandez et al.,
1998). GUS was chosen as a second target since it
allows easy testing of the enzymatic properties of
its projected fusion proteins, and since it tolerates
large amino-terminal fusions without loss of enzy-
et
al. et al.
C-terminus of each inhibitor was fused to the N-
terminus of the CP or GUS.
The expression of the recombinant proteins
-
cient, especially for CP, SPI::CP and GUS (Fig. 2B,
D); in the case of CMTI::CP and both SPI::GUS and
CMTI::GUS, the expression level was lower. Al-
though the expression level of the fusion proteins
was lower than that of the target proteins (CP and
could be obtained; even with CMTI::GUS, the recom-
binant protein with the lowest expression level, it
one litre of culture. The growth of cells producing
GUS and its fusions was not correlated with protein
expression level, since neither high expression of
GUS alone nor low production of GUS fused to the
D). In contrast, expression of CP and its fusions was
deleterious to cell growth (Fig. 2A, B). In this case
the accumulation of proteins and their oligomeriza-
bacterial metabolism (Jagadish et al.
et al. et al.,
1998).
Despite numerous similarities between the
two proteinase inhibitors, when fused to the target
slightly decreased the enzymatic activity of GUS,
-
and 4A; Table 2). Since literature data suggest that
both target proteins should easily tolerate an addi-
tional polypeptide at their N-terminus (Elmayan &
Tepfer, 1994; Jagadish et al., 1996; Fernandez-Fern-
andez et al. et al. et al.,
impact exerted on the target protein by the inhibi-
acids) than SPI2 and its structure is stabilized by
mutation of even one amino acid can considerably
(Zhukov et al., 2000). Therefore, it is probable that
the fusion of the CMTI I C-terminus with the tar-
get protein could have an impact on the proper
folding of the inhibitory domain and consequently
might structurally destabilize the target domain. In
bridges. Nuclear magnetic resonance spectroscopy
suggests that the structure and folding processes of
SPI2 are very stable (I. Zhukov, unpublished data).
Therefore, the additional domain fused to the C-ter-
minus of SPI2 should be well tolerated and proper
folding of both fusion domains would be achieved.
Additionally, according to a BLAST query, domains
with homology to SPI2 seem to be present in vari-
ous multidomain proteins (not shown). On the con-
trary, homologues of CMTI I were not detected in
multidomain proteins. These observations could re-
of SPI2-like domains with numerous polypeptides.
This is in agreement with our observation that
CMTI I in the fusion proteins could lead to destabi-
lization of the target polypeptide domains whereas
fusion with SPI2 seems to be rather neutral to the
function of the targets analysed. Such incompatibil-
ity of partner domains also seems to be responsible
534 2007
M. Milner and others
for the loss of inhibitory properties of the CMTI I
domain in the CMTI::GUS fusion (Table 4).
The IC
values obtained and the results of
proteolysis experiments showed that both SPI2 and
CMTI I used alone or as fusions were much stronger
inhibitors of proteinase K and trypsin than AEBSF,
a commercial inhibitor recommended for irreversible
and 4). Interestingly, in vitro proteolysis experiments
demonstrated that SPI fused to the target protein
protected its fusion partner domain against prote-
olysis as well other proteins present in the digestion
mixture (Fig. 4B and 7).
Fusion of SPI2 to the target proteins preserved
the structural features of the CP as well as the enzy-
matic activity of GUS and displayed excellent inhibi-
tory activity against proteinase K, indicating proper
folding of the SPI2 domain in these fusion products.
activities in the model systems presented as well as
the observed evolutionary tendency of SPI2-type in-
hibitors to be a component of multidomain proteins
strongly suggest potential biotechnological applica-
tions of SPI::target protein fusions. Overexpression
-
ties inside the host cells or, as in the case of Bacillus
expression systems, are due to a large number of ex-
tracellular proteinases. In such cases the use of in-
hibitor::target protein fusions could be preferable to
addition of a protease inhibitor separately, or to the
coexpression of two independent constructs, one con-
taining the inhibitor and the other the target protein.
-
tor could meet the barrier of the cell wall and would
not be able to protect the target proteins inside the
host cells. In the second case, on the contrary to the
coexpression of two proteins overproduction of the
inhibitor::target protein would guarantee identical
expression levels of both the inhibitor and target do-
In Bacillus expression systems the problems with
degradation of foreign, secreted proteins have been
mutants. Nevertheless, reports have suggested that
growth of such mutants is limited to some extent in
protein-rich industrial media (Schallmey et al., 2004).
Considering the strong inhibition of bacterial protei-
nases (especially subtilisin from B. subtilis) by SPI2,
the use of SPI::target protein in Bacillus expression
systems could be advantageous. Moreover, during
-
get protein would always copurify with the protein
of interest, even during fractionation that normally
would lead to loss of protection for separately ex-
pressed components. It is worth noting that both
SPI2 and CMTI I used alone appeared to be much
stronger proteinase inhibitors than a commercially
available inhibitor of this class of proteinases. There-
fore, the practical application of these inhibitors as
replacements or supplements of commercially avail-
able inhibitors or inhibitor cocktails should be con-
sidered. Finally, molecular engineering of the active
centre of the inhibitor (including the P1 residue)
may enlarge the present range of target proteinases
(Laskowski & Kato, 1980; Otlewski & Krowarsch,
1996; Grzesiak et al., 2000).
Acknowledgements
This work was partly supported by the
French-Polish Centre of Plant Biotechnology (CNRS,
KBN) and by the French Atomic Energy Commis-
sion (CEA).
We are indebted to Krystyna Grzelak and
We also thank Andrzej Bierzynski (IBB, PAS) for the
are grateful to James Conway (IBS, CEA, Grenoble)
for making NS-EM accessible for our samples and to
help with the interpretation and analysis of the NS-
for her constant help, useful comments and encour-
agements. We are grateful to Krystyna Grzelak for
her helpful comments and her interest in this study
-
able advice. We thank Frantisek Sehnal (Institute of
Entomology CzAS) for giving us the possibility to
study the SPI2 inhibitor.
REFERENCES
Barrett AJ, Rawlings ND, O'Brien EA (2001) The MEROPS database as a protease information system. J Struct Biol 134:
95-102.
MEDLINE
Bode W, Huber R (2000) Structural basis of the endoproteinase-protein inhibitor interaction. Biochim Biophys Acta 1477:
241-252.
MEDLINE
Bode W, Greyling HJ, Huber R, Otlewski J, Wilusz T (1989) The refined 2.0 Å X-ray crystal structure of the complex
formed between bovine beta-trypsin and CMTI-I, a trypsin inhibitor from squash seeds (Cucurbita maxima). Topological
similarity of the squash seed inhibitors with the carboxypeptidase A inhibitor from potatoes. FEBS Lett 242: 285-292.
MEDLINE
Bode W, Huber R (1992) Natural protein proteinase inhibitors and their interaction with proteinases. Eur J Biochem 204:
433-451.
MEDLINE
Bolewska K, Krowarsch D, Otlewski J, Jaroszewski L, Bierzynski A (1995) Synthesis, cloning and expression in
Escherichia coli of a gene coding for the Met8-->Leu CMTI I - a representative of the squash inhibitors of serine
proteinases. FEBS Lett 377: 172-174.
MEDLINE
Chavira R Jr, Burnett TJ, Hageman JH (1984) Assaying proteinases with azocoll. Anal Biochem 136: 446-450.
MEDLINE
Cimerman N, Kosorok MD, Korant BD, Turk B, Turk V (1996) Characterization of cystatin C from bovine parotid glands:
cysteine proteinase inhibition and antiviral properties. Biol Chem Hoppe Seyler 377: 19-23.
MEDLINE
Edwards SJ, Hayden MB, Hamilton RC, Haynes JA, Nisbet IT, Jagadish MN (1994) High level production of potyvirus-
like particles in insect cells infected with recombinant baculovirus. Arch Virol 136: 375-380.
MEDLINE
Elmayan T, Tepfer M (1994) Synthesis of a bifunctional metallothionein/beta-glucuronidase fusion protein in transgenic
tobacco plants as a means of reducing leaf cadmium levels. Plant J 6: 433-440.
MEDLINE
Enghild JJ, Thogersen IB, Salvesen G, Fey GH, Figler NL, Gonias SL, Pizzo SV (1990) Alpha-macroglobulin from
Limulus polyphemus exhibits proteinase inhibitory activity and participates in a hemolytic system. Biochemistry 29: 10070-
10080.
MEDLINE
Fernandez-Fernandez MR, Martinez-Torrecuadrada JL, Casal JI, Garcia JA (1998) Development of an antigen presentation
system based on plum pox potyvirus. FEBS Lett 427: 229-235.
MEDLINE
Gallagher SR (ed) (1992) GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression. Academic Press, Inc.
San Diego.
Grzesiak A, Buczek O, Petry I, Szewczuk Z, Otlewski J (2000) Inhibition of serine proteinases from human blood clotting
system by squash inhibitor mutants. Biochim Biophys Acta 1478: 318-324.
MEDLINE
Gutierrez-Campos R, Torres-Acosta JA, Saucedo-Arias LJ, Gomez-Lim MA (1999) The use of cysteine proteinase
inhibitors to engineer resistance against potyviruses in transgenic tobacco plants. Nat Biotechnol 17: 1223-1226.
MEDLINE
Hammond JM, Sproat KW, Wise TG, Hyatt AD, Jagadish MN, Coupar BE (1998) Expression of the potyvirus coat protein
mediated by recombinant vaccinia virus and assembly of potyvirus-like particles in mammalian cells. Arch Virol 143: 1433-
1439.
MEDLINE
Hayashi K, Takehisa T, Hamato N, Takano R, Hara S, Miyata T, Kato H (1994) Inhibition of serine proteases of the blood
coagulation system by squash family protease inhibitors. J Biochem (Tokyo) 116: 1013-1018. MEDLINE
Holak TA, Gondol D, Otlewski J, Wilusz T (1989) Determination of the complete three-dimensional structure of the
trypsin inhibitor from squash seeds in aqueous solution by nuclear magnetic resonance and a combination of distance
geometry and dynamical simulated annealing. J Mol Biol 210: 635-648.
MEDLINE
Huang X, Springer PS, Kaloshian I (2003) Expression of the Arabidopsis MCM gene PROLIFERA during root-knot and
cyst nematode infection. Phytopathology 93: 35-41.
Jagadish MN, Ward CW, Gough KH, Tulloch PA, Whittaker LA, Shukla DD (1991) Expression of potyvirus coat protein
in Escherichia coli and yeast and its assembly into virus-like particles. J Gen Virol 72: 1543-1550.
MEDLINE
Jagadish MN, Hamilton RC, Fernandez CS, Schoofs P, Davern KM, Kalnins H, Ward CW, Nisbet IT (1993) High level
production of hybrid potyvirus-like particles carrying repetitive copies of foreign antigens in Escherichia coli.
Biotechnology (N Y) 11: 1166-1170.
MEDLINE
Jagadish MN, Edwards SJ, Hayden MB, Grusovin J, Vandenberg K, Schoofs P, Hamilton RC, Shukla DD, Kalnins H,
McNamara M, Haynes J, Nisbet IT, Ward CW, Pye D (1996) Chimeric potyvirus-like particles as vaccine carriers.
Intervirology 39: 85-92.
MEDLINE
Kondo H, Ijiri S, Abe K, Maeda H, Arai S (1992) Inhibitory effect of oryzacystatins and a truncation mutant on the
replication of poliovirus in infected Vero cells. FEBS Lett 299: 48-50.
MEDLINE
Kurland CG, Dong H (1996) Bacterial growth inhibition by overproduction of protein. Mol Microbiol 21: 1-4.
MEDLINE
Laskowski M Jr, Kato I (1980) Protein inhibitors of proteinases. Annu Rev Biochem 49: 593-626.
MEDLINE
Laskowski M Jr, Qasim MA, Lu SM (2000) Interaction of standard mechanism, canonical protein inhibitors with serine
proteinases. In Protein-protein recognition: The Frontiers in Molecular Biology Series (Kleanthous C, ed) Oxford
University Press.
Leluk J, Otlewski J, Wieczorek M, Polanowski A, Wilusz T (1983) Preparation and characteristics of trypsin inhibitors
from the seeds of squash (Cucurbita maxima) and zucchini (Cucurbita pepo var. Giromontia). Acta Biochim Polon 30: 127-
138.
MEDLINE
Mandal S, Kundu P, Roy B, Mandal RK (2002) Precursor of the inactive 2S seed storage protein from the Indian mustard
Brassica juncea is a novel trypsin inhibitor. Charaterization, post-translational processing studies, and transgenic
expression to develop insect-resistant plants. J Biol Chem 277: 37161-37168.
MEDLINE
McDonald JG, Bancroft JB (1977) Assembly studies on potato virus Y and its coat protein. J Gen Virol 35: 351-263.
McDonald JG, Beveridge TJ, Bancroft JB (1976) Self-assembly of protein from a flexuous virus. Virology 69: 327-331.
MEDLINE
Nadler J (2003) New anti-HIV protease inhibitors provide more treatment options. AIDS Patient Care STDS 17: 551-564.
MEDLINE
Nirmala X, Kodrik D, Zurovec M, Sehnal F (2001) Insect silk contains both a Kunitz-type and a unique Kazal-type
proteinase inhibitor. Eur J Biochem 268: 2064-2073.
MEDLINE
Otlewski J, Krowarsch D (1996) Squash inhibitor family of serine proteinases. Acta Biochim Polon 43: 431-444.
MEDLINE
Otlewski J, Zbyryt T, Krokoszynska I, Wilusz T (1990) Inhibition of serine proteinases by squash inhibitors. Biol Chem
Hoppe Seyler 371: 589-594.
MEDLINE
Palucha A, Loniewska A, Satheshkumar S, Boguszewska-Chachulska AM, Umashankar M, Milner M, Haenni AL, Savithri
HS (2005) Virus-like particles: models for assembly studies and foreign epitope carriers. Prog Nucleic Acid Res Mol Biol
80: 135-168.
MEDLINE
Rao AG, Flynn P (1990) A quantitative assay for beta-D-glucuronidase (GUS) using microtiter plates. Biotechniques 8: 38-
40.
MEDLINE
Rawlings ND, Tolle DP, Barrett AJ (2004) Evolutionary families of peptidase inhibitors. Biochem J 378: 705-716.
MEDLINE
Sambrook I, Russell DW (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New
York.
Schallmey M, Singh A, Ward OP (2004) Developments in the use of Bacillus species for industrial production. Can J
Microbiol 50: 1-17.
MEDLINE
Shi HY, Zhang W, Liang R, Abraham S, Kittrell FS, Medina D, Zhang M (2001) Blocking tumor growth, invasion, and
metastasis by maspin in a syngeneic breast cancer model. Cancer Res 61: 6945-6951.
MEDLINE
Shukla DD, Ward CW (1989) Structure of potyvirus coat proteins and its application in the taxonomy of the potyvirus
group. Adv Virus Res 36: 273-314.
MEDLINE
Shukla DD, Strike PM, Tracy SL, Gough KH, Ward CW (1988) The N and C termini of the coat proteins of potyviruses are
surface located and the N terminus contains the major virus-specific epitopes. J Gen Virol 69: 1497-1507.
Stachowiak K, Otlewski J, Polanowski A, Dyckes DF (1990) Monitoring protein cleavage and concurrent disulfide bond
assignment using thermospray LC/MS. Pept Res 3: 148-154.
MEDLINE
Surovtsev VI, Fjodorov TV, Baydus AN, Borozdina MA, Gusev VV, Chuprunov VP (2001) Use of trinitrophenylation for
quantification of protease and peptidase activities. Biochemistry (Mosc) 66: 531-534.
MEDLINE
Takahashi M, Tezuka T, Korant B, Katunuma N (1999) Inhibition of cysteine protease and growth of Staphylococcus
aureus V8 and poliovirus by phosphorylated cystatin alpha conjugate of skin. Biofactors 10: 339-345.
MEDLINE
Timmermans MC, Maliga P, Vieira J, Messing J (1990) The pFF plasmids: cassettes utilising CaMV sequences for
expression of foreign genes in plants. J Biotechnol 14: 333-344.
MEDLINE
Valentine RC, Shapiro BM, Stadtman ER (1968) Regulation of glutamine synthetase. XII. Electron microscopy of the
enzyme from Escherichia coli. Biochemistry 7: 2143-2152.
MEDLINE
Vilaine F, Rembur J, Chriqui D, Tepfer M (1998) Modified development in transgenic tobacco plants expressing a
rolA::GUS translational fusion and subcellular localization of the fusion protein. Mol Plant Microbe Interact 11: 855-859.
MEDLINE
Wenzl P, Wong L, Kwang-won K, Jefferson RA (2005) A functional screen identifies lateral transfer of beta-glucuronidase
(gus) from bacteria to fungi. Mol Biol Evol 22: 308-316. MEDLINE
Xiao G, Liu YE, Gentz R, Sang QA, Ni J, Goldberg ID, Shi YE (1999) Suppression of breast cancer growth and metastasis
by a serpin myoepithelium-derived serine proteinase inhibitor expressed in the mammary myoepithelial cells. Proc Natl
Acad Sci USA 96: 3700-3705.
MEDLINE
Zhukov I, Jaroszewski L, Bierzynski A (2000) Conservative mutation Met8 --> Leu affects the folding process and
structural stability of squash trypsin inhibitor CMTI-I. Protein Sci 9: 273-279.
