Mice expressing a mutant Krt75 (K6hf) allele develop hair and nail defects resembling pachyonychia congenita.

Abstract

KRT75 (formerly known as K6hf) is one of the isoforms of the keratin 6 (KRT6) family located within the type II cytokeratin gene cluster on chromosome 12 of humans and chromosome 15 of mice. KRT75 is expressed in the companion layer and upper germinative matrix region of the hair follicle, the medulla of the hair shaft, and in epithelia of the nail bed. Dominant mutations in members of the KRT6 family, such as in KRT6A and KRT6B cause pachyonychia congenita (PC) -1 and -2, respectively. To determine the function of KRT75 in skin appendages, we introduced a dominant mutation into a highly conserved residue in the helix initiation peptide of Krt75. Mice expressing this mutant form of Krt75 developed hair and nail defects resembling PC. This mouse model provides in vivo evidence for the critical roles played by Krt75 in maintaining hair shaft and nail integrity. Furthermore, the phenotypes observed in our mutant Krt75 mice suggest that KRT75 may be a candidate gene for screening PC patients who do not exhibit obvious mutations in KRT6A, KRT6B, KRT16, or KRT17, especially those with extensive hair involvement.

Full text

Page 1

2386 East Heritage Way, Suite B, Salt Lake City, Utah 84109 USA
Phone +1-877-628-7300 • Email—Info@pachyonychia.org
www.pachyonychia.org


15 March 2005



Use of Articles in the Pachyonychia Congenita Bibliography

The articles in the PC Bibliography may be restricted by copyright laws. These have
been made available to you by PC Project for the exclusive use in teaching, scholar-
ship or research regarding Pachyonychia Congenita.

To the best of our understanding, in supplying this material to you we have followed
the guidelines of Sec 107 regarding fair use of copyright materials. That section reads
as follows:

Sec. 107. - Limitations on exclusive rights: Fair use
Notwithstanding the provisions of sections 106 and 106A, the fair use
of a copyrighted work, including such use by reproduction in copies
or phonorecords or by any other means specified by that section, for
purposes such as criticism, comment, news reporting, teaching
(including multiple copies for classroom use), scholarship, or
research, is not an infringement of copyright. In determining whether
the use made of a work in any particular case is a fair use the factors
to be considered shall include - (1) the purpose and character of the
use, including whether such use is of a commercial nature or is for
nonprofit educational purposes; (2) the nature of the copyrighted
work; (3) the amount and substantiality of the portion used in relation
to the copyrighted work as a whole; and (4) the effect of the use upon
the potential market for or value of the copyrighted work. The fact
that a work is unpublished shall not itself bar a finding of fair use if
such finding is made upon consideration of all the above factors.

We hope that making available the relevant information on Pachyonychia Congenita
will be a means of furthering research to find effective therapies and a cure for PC.

Page 2

Mice Expressing a Mutant Krt75 (K6hf ) Allele
Develop Hair and Nail Defects Resembling
Pachyonychia Congenita
Jiang Chen1, Karin Jaeger2,3, Zhining Den4, Peter J. Koch1,4,5, John P. Sundberg2and Dennis R. Roop1,4,5
KRT75 (formerly known as K6hf) is one of the isoforms of the keratin 6 (KRT6) family located within the type II
cytokeratin gene cluster on chromosome 12 of humans and chromosome 15 of mice. KRT75 is expressed in the
companion layer and upper germinative matrix region of the hair follicle, the medulla of the hair shaft, and in
epithelia of the nail bed. Dominant mutations in members of the KRT6 family, such as in KRT6A and KRT6B cause
pachyonychia congenita (PC) -1 and -2, respectively. To determine the function of KRT75 in skin appendages, we
introduced a dominant mutation into a highly conserved residue in the helix initiation peptide of Krt75. Mice
expressing this mutant form of Krt75 developed hair and nail defects resembling PC. This mouse model
provides in vivo evidence for the critical roles played by Krt75 in maintaining hair shaft and nail integrity.
Furthermore, the phenotypes observed in our mutant Krt75 mice suggest that KRT75 may be a candidate gene
for screening PC patients who do not exhibit obvious mutations in KRT6A, KRT6B, KRT16, or KRT17, especially
those with extensive hair involvement.
Journal of Investigative Dermatology (2008) 128, 270–279; doi:10.1038/sj.jid.5701038; published online 13 September 2007
INTRODUCTION
The keratin 6 (KRT6) cluster consists of several genes that
encode intermediate filament (IF) proteins belonging to the
type II keratin family. In humans, functional KRT6 genes
include KRT6A, KRT6B, KRT6C (formerly known as KRT6E/
H), KRT75 (formerly known as K6hf) and KRT71-KRT74
(formerly known as K6irs1-K6irs4), whereas in the mouse
Krt6a, Krt6b, and Krt71-Krt75 make up this family of
genes (These designations are used according to the
new nomenclature for mammalian keratins (Schweizer
et al., 2006).).These genes share striking sequence simi-
larities and are widely expressed in epithelial tissues, especially
the skin, hair follicles, and nails. However, each member of
the KRT6 gene family shows a cell- and tissue-type-specific
expression pattern. KRT6A and KRT6B are constitutively
expressed in the outer root sheath of anagen-stage hair
follicles, epithelia of the nail bed, and stratified epithelia
lining the oral cavity and the esophagus (Moll et al., 1982;
Ouhayoun et al., 1985; Stark et al., 1987; O’Guin et al.,
1990; Langbein and Schweizer, 2005). KRT75 is expressed
in the companion layer, upper germinative matrix region of
the hair follicle, and medulla of the hair shaft (Winter et al.,
1998; Wojcik et al., 2001; Wang et al., 2003). In addition,
the mouse keratin 75 protein (K75) is also synthesized in the
nail bed epithelia of mice (Wojcik et al., 2001).
In addition to constitutive expression, several KRT6
isoforms are specifically induced in response to hyperproli-
ferative stimuli, such as wounding. For example, KRT6A is
induced in all layers of the epidermis under hyperprolifera-
tive conditions, whereas the induction of KRT6B is restricted
to the more differentiated layers of the epidermis (Wojcik
et al., 2000). The in vivo functions of Krt6 genes have been
evaluated in genetically engineered mouse models for Krt6a
(Krt6atm1Der)andKrt6a/Krt6b
Krt6btm1Der) (Wojcik et al., 2000, 2001; Wong et al., 2000).
Interestingly, the absence of Krt6a or Krt6a/K6b did not
prevent normal development and function of epithelial
tissues and ectodermal appendages. However, loss of these
proteins altered the response of these tissues to injury and
mechanical stress. For instance, delayed re-epithelialization
of the skin was observed in Krt6atm1Dermice following
wounding (Wojcik et al., 2000), and hyperplastic changes
secondary to mechanical stress associated with food intake
(Krt6a/Krt6btm1Cou,Krt6a/
ORIGINAL ARTICLE
270Journal of Investigative Dermatology (2008), Volume 128
& 2007 The Society for Investigative Dermatology
Received 7 May 2007; accepted 24 June 2007; published online
13 September 2007
1Department of Molecular and Cellular Biology, Baylor College of Medicine,
Houston, Texas, USA;2The Jackson Laboratory, Bar Harbor, Maine, USA;
3Department of Dermatology, Medical University of Vienna, Vienna, Austria
and4Department of Dermatology, Baylor College of Medicine, Houston,
Texas, USA
Correspondence: Dr Dennis R. Roop, Department of Dermatology and
Regenerative Medicine and Stem Cell Biology Program, University of
Colorado at Denver Health Sciences Center, PO Box 6511, Mail Stop 8320,
Aurora, Colorado 80045, USA. E-mail: Dennis.Roop@UCHSC.edu
5Current address: Department of Dermatology and Regenerative Medicine
and Stem Cell Biology Program, University of Colorado at Denver and Health
Sciences Center, Aurora, Coloardo 80045, USA
Abbreviations: BAC, bacterial artificial chromosome; ES, embryonic stem
IF, intermediate filament; K75, human and mouse keratin 75 (formerly known
as K6hf) protein; KRT6, keratin 6; KRT75, human keratin 75 (formerly known
as human K6hf) gene; Krt75, mouse keratin 75 (formerly known as mouse
K6hf) gene; Krt75tm1Der, mouse keratin 75-targeted mutation; PC,
pachyonychia congenita; PC-1, Type I PC; SEM, scanning electron
microscopy; SM-CSM, selection counter selection marker

Page 3

were reported in the oral cavities of Krt6a/Krt6btm1Couand
Krt6a/Krt6btm1Dermice (Wong et al., 2000; Wojcik et al.,
2001). In contrast to Krt6a and Krt6b, Krt75 expression is not
induced in the epidermis in response to mechanical stress or
wounding (Wojcik et al., 2001).
Mutations in KRT6A and KRT6B result in pachyonychia
congenita (PC) (OMIM #167200 and #167210). PC is a rare,
autosomal dominant form of ectodermal dysplasia, charac-
terized by distally progressive hypertrophic onychodystrophy
and focal hyperkeratosis of palms and soles (Leachman et al.,
2005). Germline mutations in KRT6A and KRT16 are
associated with Type I PC (PC-1), whereas mutations in
KRT6B and KRT17 are associated with Type II PC (PC-2)
(Smith et al., 2005). KRT16 and KRT17 encode type I keratins
(K16 and K17) that form keratin IF together with K6A and
K6B, respectively. Codon 171 (AAC) and 172 (AAC) of
KRT6A both encode asparagines (N). Previous reports
referred to deletion of one of these codons as either
N171del or N172del. The Human Genome Variation Society
(www.hgvs.org) has recently recommended that when a
codon is deleted from a series of identical codons, the
deletion should be designated as the last codon in the series.
Therefore, in accordance with this recommendation, we have
now designated N171del as N172del. We previously
suggested thatN172delwas
(Lin et al., 1999) and a recent review as confirmed that
N172del is the most common mutation in PC-1 (Lane and
McLean, 2004). This residue is located at the beginning of the
initiation motif of the highly conserved helical rod domain
(also called the helix initiation peptide) of keratins. The short
initiation motif is believed to be critical in mediating keratin
assembly and maintaining IF stability. Analogous mutations
in this evolutionarily conserved amino-acid residue have
been reported in white sponge nevus (OMIM #193900),
caused by deletion of the corresponding asparagine in KRT4
(Rugg et al., 1995), ichthyosis bullosa of Siemens caused by
mutations in KRT2 (Whittock et al., 2001), and epidermolytic
palmoplantar keratoderma caused by mutations in KRT9
(Reis et al., 1994). Many studies have noted that there is
considerable variation in clinical severity of diseases caused
by these mutations. Consequently, other genetic and/or
environmental modifiers have been suggested to contribute
significantly to disease severity.
Mouse models with targeted deletions of Krt6a, Krt6b, and
Krt17 have been developed (Wojcik et al., 2000, 2001; Wong
et al., 2000; McGowan et al., 2002). However, these models
did not fully recapitulate the clinical features of PC as seen in
humans, in particular the nail changes, which occur in almost
all PC patients (Leachman et al., 2005). One explanation for
this discrepancy is that PC cases are caused by dominant
mutations, which result in the accumulation of mutated
keratins acting in a dominant interfering manner to prevent
the normal assembly of IF within affected cells. The Krt6a-,
Krt6b-, and Krt17-targeted deletion mouse models represent
recessive mutations, which result in a lack of expression. The
lack of K6a, K6b, or K17 proteins in these null mouse models
was partially compensated for by other keratins, which we
believe prevented the development of overt PC phenotypes.
amutational ‘‘hotspot’’
To explore the role of mouse Krt75 in hair and nail
formation and generate a mouse model that more closely
mimicked human PC, we genetically engineered a dominant
mutation into the mouse Krt75 locus. We present, the first
reported ‘‘knock-in’’ model for a dominant type II keratin
mutation. We report that deletion of the highly conserved
asparagine residue (N159) in the initiation motif of the helical
rod domain of Krt75 caused collapse of the keratin IFs
in vitro, and produced hair and nail abnormalities in vivo.
RESULTS
Generation of a Krt75 dominant mutation that interferes with
normal IF assembly in cultured cells
Dominant-negative mutations have been identified in the
KRT6A gene of PC-1 patients. The most frequent mutation is a
deletion of codon 172, encoding asparagine (N). It is thought
that this mutation leads to the synthesis of a defective K6a
protein that interferes with the assembly of a functional
keratin IF cytoskeleton. A comparison of the NH2-terminal
rod domains of human K6A and mouse K75 reveals a high
degree of amino-acid sequence homology (Figure 1a). N172
of human K6A corresponds to N159 of mouse K75. There-
fore, we hypothesized that a deletion of N159 (N159del)
KRT6A
GAGCGTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTCATC
-E--R--E--Q--I--K--T--L--N--N--K--F--A--S--F--I--
(172)
(159)
GAACGGGAGCAGATCAAGACTCTGAACAACAAGTTCGCCTCCTTCATT
-E--R--E--Q--I--K--T--L--N--N--K--F--A--S--F--I--
K6A
KRT75
K75
–
Figure 1. Alignment of nucleotide and peptide sequences of human KRT6A
and mouse Krt75, and immunofluorescence labeling of PtK2 cells transfected
with wild-type and mutant Krt75 expression vectors. (a) The 16 amino acids
at the beginning of the initiation motif of the human K6A (NM005554) and
mouse K75 (XM128143) are identical. The amino acid corresponding to N172
of human KRT6A is underlined for mouse Krt75. Deletion of codon 159 in
mouse Krt75(N159del) was generated to reproduce the corresponding
mutation in human KRT6A that is frequently detected in PC patients.
(b, c) The endogenous keratin IF network was labeled with an anti-keratin18
(K18) antibody (green). Ectopically expressed K75 was labeled with a
polyclonal antibody (red). Both (b) wild-type (þ/þ) and (c) mutant
(K75tm1Der) K75 were colocalized with the endogenous keratin filament
structure (yellow). (c) Mutant K75 caused the collapse of the keratin
IF network around the nucleus. Bar¼50mm.
www.jidonline.org271
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 4

would lead to a mutant K75 protein (K75tm1Der) with
dominant-negative properties.
Wild-type and mutated versions of mouse Krt75 were
expressed in PtK2 cells. This rat kangaroo kidney cell line
expresses simple epithelia-type keratins, such as keratin 8
(K8) and keratin 18 (K18). Ectopically expressed K75 co-
assembled into the endogenous keratin IF cytoskeleton of
these cells (Figure 1b, also see Wojcik et al., 2001).
Expression of the N159del mutant, however, resulted in a
collapse of the endogenous IF cytoskeleton around the
nucleus (Figure 1c). These experiments demonstrate that
deletion of codon N159 leads to a mutant protein that
interferes with normal cytoskeleton architecture. Interest-
ingly, this dominant-negative effect is not restricted to a loss
of codon N159. Expression of Krt75 cDNA constructs with an
N159K missense mutation (corresponding to the N172K
mutation in KRT6A, which is also found in PC patients)
induced a similar collapse of the keratin IF cytoskeleton in
PtK2 cells (data not shown).
Generation of N159del mutant Krt75 mice
Our in vitro experiment suggested that a deletion of codon
N159 in Krt75 would lead to the synthesis of a mutant protein
with dominant-negative properties, which could potentially
result in hair and nail defects in vivo. To test this hypothesis,
we generated a mouse line in which codon N159 is deleted
from the endogenous Krt75 allele (see Figures S1 and S2
for a detailed description of how the targeting vector was
generated).
Two independent recombinant embryonic stem (ES) cell
clones were used to generate the N159del (mouse keratin 75-
targeted mutation (Krt75tm1Der)) mice (see Figure 2 for
characterization of recombinant ES clones and founder
mice). The genetically independent mouse lines derived from
these ES cell clones showed the same phenotypes (see
below). Heterozygous mutant (þ/Krt75tm1Der) intercrosses
yielded homozygous mutant (Krt75tm1Der/Krt75tm1Der), hetero-
zygous and wild-type progeny with a frequency consistent
with simple Mendelian inheritance for a dominant mutation.
All mutant mice were affected, with homozygous mice
affected more severely than heterozygous mice (see below).
Previous reports have also documented that humans homo-
zygous for certain dominant keratin mutations exhibit more
severe clinical symptoms than their heterozygous parents
(Hu et al., 1997). The birth weight, growth rate, and fertility
of heterozygous and homozygous mice were comparable
to those of wild-type littermates. To confirm that the mutated
Krt75 allele was expressed in mutant mice, we conducted
semi-quantitative reverse transcription–PCR (RT–PCR) experi-
ments. As shown in Figure 2d, wild-type and mutant alleles
were expressed at similar levels in heterozygous mice,
whereas only mutant transcripts were detected in homo-
zygous mutant mice.
Mutant Krt75 mice showed degenerative keratinization within
the precortex and hair shaft
Krt75tm1Dermice developed an apparent rough coat within 2
weeks of age. The typical rough coat of a homozygous
mutant mouse at 12 weeks of age is shown in Figure 3a.
Heterozygous micedeveloped
however,thephenotype
gross hair phenotype was not restricted to a particular
anatomic location or hair type and these changes persisted
throughout life.
To determine whether structural abnormalities of the hair
shaft caused the rough appearance of the mutant coat, hairs
were manually removed and studied from the dorsal thoracic
region of wild-type and mutant mice at 1, 3, and 8 weeks of
age, with consistent findings. As shown in Figure 3, hair shafts
from 8-week-old wild-type mice had regular septation and
septulation patterns specific for each hair type (Figure 3c and
d). Heavily pigmented hairs of mutant littermates had defects
ranging from loose irregular aggregation of pigment, clump-
ing of pigment within the medulla, clumping with focal
asimilar
less
coatdefect;
Thewas prominent.
123456
123456
789
+/+
+/+
+/+
+/+
+/+
Krt75tm1Der
Krt75tm1Der
Krt75tm1Der/Xmn I
Krt75tm1Der
Krt75tm1Der
+/Krt75tm1Der
+/Krt75tm1Der
+/+
+/Krt75tm1Der
Krt75tm1Der/
Krt75tm1Der
Krt75tm1Der/
Krt75tm1Der
Krt75tm1Der/
Krt75tm1Der
neo
Figure 2. Characterizations of recombinant ES cells and mice.
(a) Genotyping of targeted ES cells with the 30Krt75 probe. Southern blots
using MfeI- and PmeI-digested recombinant ES cells DNA (heterozygous)
identified 12.1kb (wild-type allele) and 7.3kb (recombinant allele) bands
(lane 1, 6 and 9) (Figure S2). The 30probe was generated by PCR with primers
K6hf-30-Probe2-F and K6hf-30-Probe2-R shown in Table S1. (b) Genotyping
of recombinant ES cells lacking the neo-cassette after cre-mediated
recombination. Cre-recombinase was transiently expressed in the above
targeted ES cell clones. Daughter ES cell clones were genotyped by Southern
blot for the excision of the neo-cassette (lane 5). (c) Genotyping of mutant
mice by PCR using genomic DNA as a template. The same primer pair
(K6hf-Exon1-F and K6hf-Intron1-R in Table S1) amplified a slightly larger
fragment from the mutant allele than from the wild-type allele, due to the
insertion of a loxP site in intron 1 of the mutant allele (upper panel).
Heterozygous mutant mice (þ/Krt75tm1Der) carry both the wild-type and the
mutant allele. However, homozygous mutant mice (Krt75tm1Der/Krt75tm1Der)
carry exclusively the mutant alleles. Digestion of the PCR products with XmnI
resulted in the cleavage of the mutant band. This is due to the introduction of
an XmnI restriction site in the mutant allele. (d) Analysis of mutant Krt75
expression in mice by semi-quantitative RT–PCR. A 50biotin-labeled primer
was used to amplify the Krt75 cDNA followed by XmnI digestion, gel
separation, and chemiluminescent detection of the biotin-labeled PCR
product. Only the mutant transcripts could be digested. Note that only one
primer was labeled with biotin, therefore, after digestion, only one mutant
DNA fragment could be detected. Of the two homozygous mutant mice
(Krt75tm1Der/Krt75tm1Der) shown here, only mutant DNA was detectable. In the
heterozygous mice (þ/Krt75tm1Der), a comparable amount of both wild-type
and mutant DNA was detected, indicating that both alleles are expressed at
similar levels.
272Journal of Investigative Dermatology (2008), Volume 128
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 5

distention of the shaft, segregation of pigment with a light
brown colored medullary abnormality, to breakage of the hair
shaft in the middle of these deformities (Figure 3e–p). Hair
shafts that had observable blebs under light microscopy
comprised 3.0270.52% of counted hair shafts in hetero-
zygous mutant mice and 7.8872.27% of homozygous mice
(Figure 3b), suggesting a dose-dependent effect of the
mutation. Defects could be seen in mildly to nonpigmented
hair shafts when the microscope condenser was removed to
highlight features of the cuticle (Figure 4a–e). The focal
12
10
Bleb-positive hair fibers (%)
8
6
4
2
0
+/+
+/Krt75tm1Der
Krt75tm1Der/
Krt75tm1Der
cdefghijklmnop
Figure 3. Hair-associated phenotypes of the mutant mice. (a) Gross appearance of 12-week-old mice. The wild-type (þ/þ) mouse had a shiny uniformly
smooth coat, whereas a homozygous mutant (Krt75tm1Der/Krt75tm1Der) mouse exhibited a rough coat. (b) Percentage of ‘‘bleb’’-positive hair shafts in plucked
dorsal hair of 8-week-old littermates; n¼10 for homozygous mutant mice (Krt75tm1Der/Krt75tm1Der), n¼4 for heterozygous mutant mice (Krt75tm1Der/þ).
(c–p) Variations in hair shaft defects in 8-week-old mutant mice. (c, d) Normal hair shafts have well demarcated septation and septulation patterns accentuated to
various degrees by pigmentation. By contrast, both heterozygous and homozygous mice carrying the mutant Krt75tm1Derallele exhibited various degrees of focal
change ranging from (e–g) pigment clumping, (h–n) focal bulges, (o) structural weakness, and (p) fracture. Mean7SD. Bar¼100mm.
k
Figure 4. Progressive changes leading to hair shaft rupture. (a–e) Light microscopy with the condenser removed to increase light refraction. Lightly pigmented
hairs illustrated (a, b) slight focal swelling, (c) changes in medulla cells from rectangular to round clumping, (d) separation of cells with breakage of cuticle,
and (e) breakage of shaft with dispersion of abnormal rounded medullary cells. (f–k) Hair shaft defects observed by SEM. Characteristic findings include
(f–g) focal swellings in a subpopulation of hair shafts on unmodified skin, (h–i) split cuticles, (j) broken ends of the hair shaft exposing the rounded ghost cells,
(k) and the torn cuticle. Bar¼200mm in (a–e); bar¼10mm in (f–k).
www.jidonline.org273
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 6

distentions of the hair shafts were associated with clusters
of loose aggregates of round cells associated with fracturing
of the cuticle, leading to breakage of the shaft. All of the
4 major mouse pelage hair types were affected, including
the vibrissae (Figure S3). These changes were observable
in three dimensions by scanning electron microscopy
(SEM). While most hair shafts appeared to be normal, focal
swellings were observed in some (Figure 4f and g). In other
regions, the cuticle split (Figure 4h and i) and eventually broke
(Figure 4j and k). At these break sites, the cuticle fragmented
in a linear manner (Figure 4k), exposing the rounded ghost
cells (Figure 4j).
Histological evaluation of skin sections from 8-week-old
mutant mice revealed that while some of the hair follicles
appeared to be normal (Figure 5a), others had focal swellings
in the precortical region of anagen VI-stage follicles
immediately above the dermal papilla. Cells in this region
were brightly eosinophilic with basophilic nuclei (Figure 5b).
Fading nuclear staining in these cells resulted in the
formation of ‘‘ghost’’ cells (Figure 5c and d). More normal
appearing septated structures developed under these struc-
tures, pushing them to the surface (Figure 5e). Longitudinal
sections of affected hair shafts in the histological sections
revealed multiple defects within individual shafts that varied
in severity (Figure 6a). Changes in these hematoxylin and
eosin-stained sections demonstrated the details of ghost cells
in the focal distended areas that separated as the cuticle
ruptured (Figure 6b–d).
Element analysis of hair shafts is a useful semi-quantitative
method to evaluate structural integrity (Mecklenburg et al.,
2004). Sulfur concentration measured as a percent of total
elementsof clinicallynormal,
(1.9870.40%) were within normal ranges for other strains
and stocks of mice (Mecklenburg et al., 2004). By contrast,
sulfur levels within the focal swellings of hair shafts were
significantly lower (1.2470.40%) than that of controls
(Figure 6e). Interestingly, sulfur levels along the length of
the defective hair shafts varied between 1.01 and 3.39% (data
not shown), which is consistent with the above observation
that various degrees of abnormalities can occur along the
defective hair shaft. The phenotype was restricted to hair
follicles and hair shafts. We did not observe structural defects
in the interfollicular epidermis as determined by histology,
which is consistent with previous studies demonstrating that
Krt75 expression is restricted to hair follicles.
wild-typehair shafts
Mutant Krt75 mice developed loosely attached and
hypertrophic nails
Nails on the hind feet of adult mutant mice were frequently
lost (data not shown). When mutant mice were inspected on
a cage rack, their nail plates were often ripped off from the
nail bed during the process of removing mice from the cage
rack and returning them to their cage. This was never
observed in wild-type littermates handled in a similar
manner. Furthermore, nails of mutant mice showed progres-
sive thickening, distally (Figure 7). This phenotype was
most frequently observed in adult mice, especially homo-
zygous mutant males (Figure 7c and f). Close examination
of deformed toe nails showed that these nail plates
appeared opaque, had a rough surface, and overgrew in
med
med
med
med
dp
dp
dp
dp
dp
bulb
Figure 5. Krt75tm1Der/Krt75tm1Dermutant mice have abnormal late anagen-stage hair follicles. (a) Normal hair follicle of 8-week-old Krt75tm1Der/Krt75tm1Der
mutant mice. (b–e) Degenerative changes in the precortex of the hair bulb. (b) Initial changes include hyper-eosinophilia and rounding of precortical cells,
while nuclei retain basophilic staining (yellow arrow). (c, d) These changes continue forming bulbous swellings (red arrows) consisting of round cells with ghost-
like nuclear remnants. (e) A normal shaft then forms below these abnormal structures, forcing them to the surface. Bar¼50mm. dp, dermal papilla; med,
medulla.
274Journal of Investigative Dermatology (2008), Volume 128
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 7

both lateral and vertical directions, resulting in ‘‘ski slope-
like’’ hypertrophic nails (Figure 7e and f). Histologically,
there was a separation of the nail bed from the underlying
connective tissue, with large areas of hemorrhage (Figure 7h)
in some nails. This presumably is the early lesion leading to
avulsion of the nail plate. Slightly overgrown nail plates were
associated with extension of the stratum granulosum and
corneum under the nail plate beyond normal limits. This
causes a loss of adhesion and can result in detachment when
nails catch on rough surfaces.
Reduced levels of K6a and K6b did not exacerbate the mutant
Krt75 hair and nail phenotypes
We were curious to know whether the hair and nail
phenotypes observed in our mice might be due to an
interference of the mutant K75 protein with K6a and K6b.
Since we previously generated Krt6a/Krt6b-null mice (Krt6a/
Krt6btm1Der) (Wojcik et al., 2001), it was possible to test
this hypothesis experimentally. Krt6a, Krt6b, and Krt75 genes
are tightly linked (within 140kb) on mouse chromosome 15.
Therefore, it was not possible to generate Krt75 homozygous
mutants on a Krt6a/Krt6btm1Derdouble homozygous mutant
background through breeding. However, it was possible
to generate mice that were heterozygous for the mutant
Krt75 allele, and also heterozygous for Krt6a/Krt6btm1Der
alleles. These mice synthesized only 50% of the K6a and
K6b proteins. Therefore, if the mutant Krt75 phenotypes
result in part by interfering with wild-type K6a and K6b
proteins, we would have predicted that the loss of one of
the wild-type Krt6a and Krt6b alleles would exacerbate
the mutant Krt75 hair and nail phenotypes observed in
mutant Krt75 heterozygotes. Since this was not observed,
our results suggest that the mutant K75 proteins do not
interfere with K6a and K6b in vivo, at least not in the
heterozygous state.
DISCUSSION
Human hair shaft abnormalities are grouped into four major
classes: fractures, irregularities, coiling and twisting, and
extraneous matter on the hair shaft (Whiting, 1994; Whiting
and Howsden, 1996). Changes seen in hair shafts from
Krt75tm1Dermice exhibit various forms of trichorrhexis
nodosa, trichoptilosis, monilethrix, pseudomolethrix, tapered
hair, and bayonet hair, depending on the stage of degen-
erative change. Other mutant mice often have weak hair
shafts that twist, split, and break, but very few develop
nodular focal swellings that break off with a bulbous end
(Sundberg, 1994; Hogan et al., 1995). The best mouse
mutations studied to date that resembles the Krt75tm1Der
model described here are the allelic mutations in the
desmoglein 4 gene originally described as lanceolate hair
(Montagutelli et al., 1996; Sundberg et al., 2000). These
mutant mice also develop bulbous changes in the precortical
region of late anagen-stage hair follicles. Cells also appear to
undergo coagulative necrosis forming ghost cells, although
the cells organize in a laminated pattern as opposed to
rounding up. Hair shafts emerge with a series of irregular
focal nodules that break off to form a bulbous end with a
point resembling a lance head. These desmoglein 4
spontaneous mouse mutations were later found to accurately
model a rare human disease called localized autosomal
recessive hypotrichosis (Kljuic et al., 2003), and later found in
several other species (Jahoda et al., 2004). A variety of
mutations are under investigation, which result in subtle hair
medulla defects in genes that regulate hair precortex function
(Potter et al., 2006). Structural genes, such as the keratins, are
at the end of a complex gene network. Using groups of
mutations in genes that are involved in various stages of
precortex development and hair medulla formation are
Sulfur content (% weight)
2.5
P=0.038
+/+
Krt75tm1Der/Krt75tm1Der
2.0
1.5
1.0
0.5
0.0
Figure 6. Abnormal bulbous hair shafts observed in longitudinal sections and
reduced sulfur content within the focal lesions. (a–d) Longitudinal sections of
hair shafts cut in paraffin sections. (a) Most of the shafts appear to be relatively
normal, with focal deformities (indicated by arrows) containing eosinophilic
ghost-like cells (boxed area) in their central region. (b) Higher magnification
of boxed area reveals ghost-like cells. (c) Lightly pigmented hairs lose
pigmentation in deformed areas and (d) cells locate near poles as shafts
near rupture state. (e) Sulfur content of wild-type hair shafts measured by
energy-dispersive X-ray spectroscopy shows that the wild-type hair shafts
(þ/þ, n¼15) contain a sulfur content that is within the normal range
(1.9870.40%), whereas the sulfur content was reduced (1.2470.40%) within
the focal swellings of mutant hair shafts (Krt75tm1Der/Krt75tm1Der, n¼11).
Mean7SD. The reduction of sulfur content within the focal swellings was
statistically significant (P¼0.038). Note that the the condenser was removed
to increase the contrast of cuticules. Bar¼100mm.
www.jidonline.org275
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 8

certainly advantageous in defining the functions of these
genes in this complex network.
In humans, a polymorphism of KRT75 was linked to
pseudofolliculitis barbae, the ingrowth of facial hair triggered
by frequent shaving (Winter et al., 2004). This mutation was
located at the initiation motif of the highly conserved helical
rod domain, only three residues downstream from the
mutational ‘‘hot spot’’ reproduced in this study (see
Introduction). It was speculated that this KRT75 mutation
compromised the cuticle of the hair shaft, resulting in the
ingrowth of hair shaft. However, KRT75 is expressed in both
the companion layer and upper matrix region of the hair
follicle, as well as the medulla of the hair shaft. Whether the
expression of KRT75 in the medulla and other regions of the
hair follicle also contributed to hair ingrowth was not clear. In
our current study, we clearly observed pathological changes
in the precortical and hair medulla cells, as well as the
rupture of the hair cuticle. However, we could not
demonstrate whether the rupture of the hair cuticle was a
sequential process secondary to the focal swelling of the
medulla, or perhaps that the hair cuticle was compromised in
the first place. Nevertheless, this mouse model provides
in vivo evidence for the critical role played by Krt75 in
maintaining hair shaft integrity.
Since Krt75 is also expressed in the nail epithelia of mice,
we expected the mutant mice to develop nail phenotypes,
such as congenital nail thickening, the most consistent
phenotype observed in PC patients, with a mutation at the
corresponding residue of KRT6A. However, the hypertrophic
nail phenotype of the mutant Krt75 mice was not routinely
observed in all mice. It was primarily restricted to the nails of
the hind paws of adult male mice and was more frequently
observed as a result of fighting when males were housed
together. Although the observed variations in nail phenotype
may be due to the fact that these mice were on a segregating
genetic background, it is still in line with the fact that in PC
patients, not all digital nails are necessarily involved and the
severity of nail phenotypes can vary from individual to
individual even within one family with an identical mutation
(Leachman et al., 2005). In addition, a subset of PC patients
has no nail changes until the second or third decade of life.
This subtype was designated as PC tarda (Paller, Moore and
Scher, 1991). Based on a small number of cases, it was
speculated that the late onset of PC was associated with
mutations occurring in less critical regions of the keratin
proteins (Connors et al., 2001; Xiao et al., 2004; Smith et al.,
2005). In our current study, the mutation introduced into the
Krt75 gene is located at the beginning of 1A, the helix
initiation peptide, which is believed to be critical for
keratin–keratin interactions (Steinert et al., 1993). Corre-
sponding mutations in KRT6A and KRT6B cause PC
phenotypes at or shortly after birth, and are usually severe.
The reason that the Krt75 mutation did not affect all nails to
the same degree is not clear, but it could be dependent on the
amount of mechanical stress that individual nails are
subjected to, that result in avulsion.
In summary, we have generated a ‘‘knock-in’’ mouse
model in which one endogenous Krt75 allele was replaced
with an allele containing a deletion of the highly conserved
asparagine residue (N159). Mice expressing this mutant form
of Krt75 developed spontaneous hair and nail phenotypes
that partially resembled phenotypes observed in PC patients
who harbor a corresponding mutation in KRT6A. On the basis
of the phenotypes observed in our mutant Krt75 mice, we
suggest that KRT75 may be a candidate gene for screening PC
patients who do not exhibit obvious mutations in KRT6A,
KRT6B, KRT16, or KRT17, especially those with extensive
hair involvement.
MATERIALS AND METHODS
Mouse Krt75 expression vectors
The full-length mouse Krt75 cDNA was cloned in the expres-
sion vector pcDNA3.1 as previously reported (Wojcik et al.,
2001). Codon N159 of mouse Krt75 (Figure 1a) was deleted using
def
h
p
p
Figure 7. Nail-associated phenotypes of the mutant mice. (a–c) Gross appearance of paws of wild-type (þ/þ), heterozygous (þ/Krt75tm1Der), and homozygous
(Krt75tm1Der/Krt75tm1Der) mutant mice. Note the development of hypertrophic nails in (b) heterozygous and (c) homozygous littermates (indicated by arrows).
(d–f) A lateral view of framed toes in (a–c). (g–h) Histology of toe nails of wild-type andKrt75tm1Der/Krt75tm1Dermice, indicated by open arrows in (a) and (c), respectively.
The mutant nail shows the severely curved nail plate and hemorrhage in the nail bed compartment. Bar¼500mm in (a–f); 200mm in (g) and (h). p, nail plate.
276 Journal of Investigative Dermatology (2008), Volume 128
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 9

a PCR-based mutagenesis strategy (site-directed
Stratagene, La Jolla, CA). Similar methods were used to generate a
cDNA clone carrying a missense mutation in which the asparagine
residue was replaced with a lysine residue (N159K). These mutations
are analogous to the N172del and N172K mutations found in KRT6A
in PC-1. Primers used to generate these mutations were K6hf-
N159del-F and K6hf-N159del-R, and K6hf-N159K-F and K6hf-
N159K-R (Table S1). All cDNA clones were confirmed by DNA
sequencing.
mutagenesis,
Expression of wild-type and mutant K75 in cultured cells
Wild-type or mutant mouse Krt75 cDNAs was transfected into PtK2
cells, a rat kangaroo kidney epithelial cell line (ATCC, Manassas,
VA), which expresses K18 but not K6, using the FuGENE 6
transfection reagent (Roche Diagnostics, Indianapolis, IN). Cells
were analyzed 48hours after transfection by immunofluorescence
microscopy.
Gene targeting vector construction
A bacterial artificial chromosome (BAC) clone containing the full-
length mouse Krt75 gene locus was identified in a 129/SvJ genomic
library (Incyte Genomics, St Louis, MO) and used to construct the
gene targeting vector via bacterial homologous recombination (ET
recombination) (Zhang et al., 1998, 2000) as outlined in Figure S1.
All primer sequences used in the construction of targeting vector are
listed in Table S1. Briefly, the 1.3kb RpsL-neo selection counter
selection marker (SM-CSM; Gene Bridges, Dresden, Germany) was
generated by PCR using primers BAC-K6hf-N159del-Selection-F and
BAC-K6hf-N159del-Selection-R. These primers contain 50bp Krt75
sequences (underlined) corresponding to a region upstream and
downstream of codon 159, respectively. After transforming pSC101-
BAD-gbaAtet(Gene Bridges, Dresden, Germany) into the Escherichia
coli host containing the Krt75 BAC, homologous recombination was
induced by adding L-arabinose. After introduction of the SM-CSM
PCR products into the BAC host cells, homologous recombination
replaced codon 159 with SM-CSM (Figure S1). Correctly targeted
BAC clones were selected by kanamycin resistance, which is
encoded by SM-CSM. In a second round of recombination, the
SM-CSM was replaced by a 362bp PCR-generated Krt75 fragment
that contained the N159 deletion mutation. Primers used to generate
this DNA fragment were BAC-K6hf-N159del-Counter-F and BAC-
K6hf-N159del-Counter-R.
Subsequently, a PGK-neo cassette (Gene Bridges, Dresden,
Germany) was generated by PCR (Figure S1). The neo-cassette has
dual prokaryotic (Tn5) and eukaryotic (PGK) promoters and is
flanked by loxP sites. PCR amplification introduced a 60-bp
sequence to each side of the cassette, which allowed insertion of
this marker into intron 1 sequences of the Krt75 BAC (Figure S1).
Primers used to amplify the neo-cassette were BAC-K6hf-Neo-Insert-
F and BAC-K6hf-Neo-Insert-R. Finally, the modified Krt75 locus
was subcloned by bacterial homologous recombination into a
pUC-TK plasmid vector, which contains a herpes simplex virus
thymidine kinase (TK) gene under the control of a PGK promoter.
Sequences homologous to Krt75 were added to the pUC-TK
vector using primers (Left and Right) by PCR, through which
the modified Krt75 was cloned during recombination. The final
gene targeting vector was linearized with Pvu I before electropora-
tion into ES cells.
ES cell targeting and generation of mutant mice
The targeting vector (Figure S2) was electroporated into W4/129S6
ES cells (Taconic, Hudson, NY), and addition of G418 (geneticin)
and FIAU (1(1-2-deoxy-2-fluoro–darabinofuransyl)-5-iodouracil) to
the cell culture medium was used to select for recombinant ES cell
clones. Southern blot analysis, using mouse Krt75-specific probes
(Figure S2) and a neo-cassette probe, confirmed homologous
recombination in 25% of the ES clones. To excise the neo-cassette
from the Krt75 gene locus, recombinant ES cells were electroporated
with a cre-expression vector (Arin et al., 2001), and neo-sensitive
clones were tested by Southern blot to verify loss of the neo-cassette.
Two targeted ES cell clones were injected into C57BL/6J blastocysts.
Chimeric mice were obtained and backcrossed with C57BL/6J mice.
Progeny carrying the targeted alleles (þ/Krt75tm1Der) were identified
by PCR analysis of genomic DNA obtained from tail biopsies.
Homozygous pups (Krt75tm1Der/Krt75tm1Der) were obtained from
heterozygous (þ/Krt75tm1Der) intercrosses.
All animal studies were approved by the Baylor College of
Medicine Institutional Animal Care and Use Committee (IACUC)
and were performed in compliance with stipulations of that body.
Mice were maintained in a conventional barrier facility at 22721C
and 30–70% relative humidity, exposed to a 14-hour light cycle,
allowed free access to sterilized acidified water (pH 2.8–3.2), and fed
irradiated LabDiets5053 (Pico Lab, St Louis, MO) ad libitum. The
health status of each animal room was evaluated every 13 weeks.
RNA extraction and semi-quantitative RT–PCR
Total RNA was isolated from ear biopsies of adult mice. 0.5mg total
RNA was reverse transcribed into cDNA with AMV reverse
transcriptase (Promega, Madison, WI) and poly d(T)15 primers
(Roche Diagnostics, Indianapolis, IN). Subsequently, the cDNA
was amplified with mouse Krt75-specific primers. The primers used
to amplify the mouse Krt75 were K6hf-50-UTR-Biotin-F and K6hf-
cDNA-R that were derived from different exons to avoid amplifica-
tion of genomic DNA (Table S1). The forward primer was 50labeled
with biotin for semi-quantitative chemiluminescent detection.
Primers used to amplify mouse b-actin (Actb) were b-actin-F and
b-actin-R (Table S1). Semi-quantification was performed as pre-
viously described (Cao et al., 2001), except that the restriction
digestion was performed with XmnI, which cleaves the mutant but
not the wild-type Krt75 sequence. Biotin-labeled nucleic acids were
detected with a Chemiluminescent Nucleic Acid Detection Module
(Pierce, Rockford, IL) as described in the instructions of the
manufacturer.
Tissue processing, histologic analysis, and immunofluorescence
Mice were euthanized by CO2asphyxiation. Skin for both routine
histology and immunohistochemistry was fixed overnight in Fekete’s
acid–alcohol–formalin solution (61% ethanol, 3.2% formaldehyde,
0.75 N acetic acid), transferred to 70% ethanol, embedded in
paraffin, sectioned at 5–6mm and, finally, placed on microscope
slides (Superfrost/Plus, Fisherbrand, Pittsburgh, PA) and stained with
hematoxylin and eosin for routine histopathologic analysis. Double-
immunofluorescence labeling was performed as described pre-
viously (Wojcik et al., 2001). The following primary antibodies were
used: guinea pig anti-K75 (Wojcik et al., 2001) and mouse anti-K18
(Sigma-Aldrich, St Louis, MO). Secondary antibodies were Alexa-
conjugated fluorochromes 594 goat anti-guinea pig and 488 goat
www.jidonline.org277
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 10

anti-mouse antibodies (Molecular Probes, Eugene, OR). Photographs
were taken with a Nikon Eclipse E600 microscope in conjunction
with the MetaVue v6.1r5 imaging software (Universal Imaging
Corp., Downingtown, PA).
Mounting hair
Hair samples were removed manually by plucking lightly with
hemostats from the dorsal and ventral thorax of mice at 1, 3, and 8
weeks of age. At least three age- and sex-matched mice were used
for each genotype (wild type, heterozygous, and homozygous).
Small clusters of hairs were mounted with Permount mounting
media (Fisher Scientific, Fair Lawn, NJ) on glass slides and examined
by white and polarized light microscopy.
SEM of the hair shafts and skin and element analysis
Plucked hairs as well as unmanipulated hairs were examined by
SEM. To prepare unmanipulated hairs, skin was taken (1cm2) from
the dorsal thorax from male wild type, heterozygous, and homo-
zygous mutant mice at 1, 3, and 8 weeks of age, and fixed overnight
in 2.5% glutaraldehyde in 0.1 M phosphate buffer at 41C. Samples
were then washed twice in phosphate buffer for an hour, post-fixed
in 2% osmium tetroxide in phosphate buffer overnight at 41C,
washed twice in phosphate-buffered saline then dehydrated in
graded ethanol (40, 60, 80, and 95% ethanol, each for an hour at
room temperature), and finally, three times in 100% ethanol for
1hour at room temperature. Critical point drying was performed by
gently flushing specimens four times with CO2for 5minutes while
gradually increasing temperature in the critical point drier (Balziers,
Union, FL) to 411C. Over a period of 30 to 40minutes, pressure was
released slowly to allow CO2 to evaporate while allowing the
sample to return to room temperature. The samples were then
attached to a clean aluminum SEM stub using double-sided tape and
sputter coated with 4nm of gold (Bechtold, 2000). Samples were
then examined at 20kV with a JOEL model S-3000N SEM (Hitachi,
Tokyo, Japan). The same specimens were analyzed for elemental
content at ?2,000 using an attached X-ray microanalysis system
(EDAX Inc., Mahwah, NJ) (Mecklenburg et al., 2004).
Statistics
t-test was used to calculate significance. Po0.05 was considered
statistically significant.
CONFLICT OF INTEREST
The authors state no conflict of interest.
ACKNOWLEDGMENTS
We thank Dr Maranke Koster and Daisy Dai from the Roop laboratory for
critical reading of this paper. We also thank Daniel Young from the Roop
laboratory and Kathleen Silva and Lesley Bechtold from The Jackson
Laboratory for excellent technical support. This project was supported in
part by grants from the National Institutes of Health AR052263-17 to DRR and
RR000173 and AR053639 to JPS, the Council for Nail Disorders to JC, KJ, and
JPS, and mentorship grants from the North American Hair Research Society to
JC and KJ.
SUPPLEMENTARY MATERIAL
Table S1. Primers used in this study.
Figure S1. Bacterial homologous recombination strategies used in the
construction of Krt75 targeting vector.
Figure S2. Strategy to generate a mouse model expressing the Krt75 N159del
mutation (equivalent to the human KRT6A N172del mutation).
Figure S3. Changes in vibrissae.
REFERENCES
Arin MJ, Longley MA, Wang XJ, Roop DR (2001) Focal activation of a mutant
allele defines the role of stem cells in mosaic skin disorders. J Cell Biol
152:645–9
Bechtold LS (2000) Ultrastructural evaluation of mouse mutations. In:
(Sundberg JP, Boggess D, eds), Systematic Characterization of Mouse
Mutations. Boca Raton: CRC Press, pp 121–9
Cao T, Longley MA, Wang XJ, Roop DR (2001) An inducible mouse model for
epidermolysis bullosa simplex: implication for gene therapy. J Cell Biol
152:651–6
Connors JB, Rahil AK, Smith FJ, McLean WH, Milstone LM (2001) Delayed-
onset pachyonychia congenita associated with a novel mutation in the
central 2B domain of keratin 16. Br J Dermatol 144:1058–62
Hogan ME, King LE Jr, Sundberg JP (1995) Defects of pelage hairs in 20 mouse
mutations. J Invest Dermatol 104(Suppl):31S–2S
Hu ZL, Smith L, Martins S, Bonifas JM, Chen H, Epstein EH Jr (1997) Partial
dominance of a keratin 14 mutation in epidermolysis bullosa simplex—
increased severity of disease in a homozygote. J Invest Dermatol 109:
360–4
Jahoda CA, Kljuic A, O’Shaughnessy R, Crossley N, Whitehouse CJ, Robinson
M et al. (2004) The lanceolate hair rat phenotype results from a missense
mutation in a calcium coordinating site of the desmoglein 4 gene.
Genomics 83:747–56
Kljuic A, Bazzi H, Sundberg JP, Martinez-Mir A, O’Shaughnessy R, Mahoney
MG et al. (2003) Desmoglein 4 in hair follicle differentiation and
epidermal adhesion: evidence from inherited hypotrichosis and acquired
pemphigus vulgaris. Cell 113:249–60
Lane EB, McLean WH (2004) Keratins and skin disorders. J Pathol 204:355–66
Langbein L, Schweizer J (2005) Keratins of the human hair follicle. Int Rev
Cytol 243:1–78
Leachman SA, Kaspar RL, Fleckman P, Florell SR, Smith FJD, McLean WHI
et al. (2005) Clinical and pathological features of pachyonychia
congenita. J Investig Dermatol Symp Proc 10:3–17
Lin MT, Levy ML, Bowden PE, Magro C, Baden L, Baden HP et al. (1999)
Identification of sporadic mutations in the helix initiation motif of keratin
6 in two pachyonychia congenita patients: further evidence for a
mutational hot spot. Exp Dermatol 8:115–9
McGowan KM, Tong X, Colucci-Guyon E, Langa F, Babinet C, Coulombe PA
(2002) Keratin 17 null mice exhibit age- and strain-dependent alopecia.
Genes Dev 16:1412–22
Mecklenburg L, Paus R, Halata Z, Bechtold LS, Fleckman P, Sundberg JP
(2004) FOXN1 is critical for onycholemmal terminal differentiation in
nude (Foxn1) mice. J Invest Dermatol 123:1001–11
Moll R, Moll I, Wiest W (1982) Changes in the pattern of cytokeratin
polypeptides in epidermis and hair follicles during skin development in
human fetuses. Differentiation 23:170–8
Montagutelli X, Hogan ME, Aubin G, Lalouette A, Guenet JL, King LE Jr et al.
(1996) Lanceolate hair (lah): a recessive mouse mutation with alopecia
and abnormal hair. J Invest Dermatol 107:20–5
O’Guin WM, Schermer A, Lynch M, Sun TT (1990) Cellular and
Molecular Biology of Intermediate Filaments. New York: Plenum
Publishing Corp
Ouhayoun JP, Gosselin F, Forest N, Winter S, Franke WW (1985) Cytokeratin
patterns of human oral epithelia: differences in cytokeratin synthesis in
gingival epithelium and the adjacent alveolar mucosa. Differentiation
30:123–9
Paller AS, Moore JA, Scher R (1991) Pachyonychia congenita tarda. A late-
onset form of pachyonychia congenita. Arch Dermatol 127:701–3
Potter CS, Peterson RL, Barth JL, Pruett ND, Jacobs DF, Kern MJ et al. (2006)
Evidence that the Satin Hair Mutant gene Foxq1 is among multiple and
functionally diverse regulatory targets for Hoxc13 during hair follicle
differentiation. J Biol Chem 281:29245–55
278 Journal of Investigative Dermatology (2008), Volume 128
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation

Page 11

Reis A, Hennies HC, Langbein L, Digweed M, Mischke D, Drechsler M et al.
(1994) Keratin 9 gene mutations in epidermolytic palmoplantar
keratoderma (EPPK). Nat Genet 6:174–9
Rugg EL, McLean WH, Allison WE, Lunny DP, Macleod RI, Felix DH et al.
(1995) A mutation in the mucosal keratin K4 is associated with oral white
sponge nevus. Nat Genet 11:450–2
Schweizer J, Bowden PE, Coulombe PA, Langbein L, Lane EB, Magin TM et al.
(2006) New consensus nomenclature for mammalian keratins. J Cell Biol
174:169–74
Smith FJD, Liao H, Cassidy AJ, Stewart A, Hamill KJ, Wood P et al. (2005) The
genetic basis of pachyonychia congenita. J Investig Dermatol Symp Proc
10:21–30
Stark HJ, Breitkreutz D, Limat A, Bowden P, Fusenig NE (1987) Keratins
of the human hair follicle: hyperproliferative keratins consistently
expressed in outer root sheath cells in vivo and in vitro. Differentiation
35:236–48
Steinert PM, Marekov LN, Fraser RD, Parry DA (1993) Keratin intermediate
filament structure. Crosslinking studies yield quantitative information on
molecular dimensions and mechanism of assembly. J Mol Biol 230:
436–52
Sundberg J (1994) Handbook of Mouse Mutations with Skin and Hair
Abnormalities. Animal Models and Biomedical Tools. Boca Raton,
Florida: CRC Press., Inc.
Sundberg JP, Boggess D, Bascom C, Limberg BJ, Shultz LD, Sundberg BA et al.
(2000) Lanceolate hair-J (lahJ): a mouse model for human hair disorders.
Exp Dermatol 9:206–18
Wang Z, Wong P, Langbein L, Schweizer J, Coulombe PA (2003) Type II
epithelial keratin 6hf (K6hf ) is expressed in the companion layer, matrix,
and medulla in anagen-stage hair follicles. J Invest Dermatol 121:
1276–82
Whiting DA (1994) Hair shaft defects. In: (Olsen EA, ed), Disorders of
Hair Growth. Diagnosis and Treatment. New York: McGraw Hill Inc.,
pp 91–137
Whiting DA, Howsden FL (1996) Color Atlas of Differential Diagnosis of Hair
Loss. NJ: Canfield Publishing
Whittock NV, Ashton GH, Griffiths WA, Eady RA, McGrath JA (2001) New
mutations in keratin 1 that cause bullous congenital ichthyosiform
erythroderma and keratin 2e that cause ichthyosis bullosa of Siemens.
Br J Dermatol 145:330–5
Winter H, Langbein L, Praetzel S, Jacobs M, Rogers MA, Leigh IM et al. (1998)
A novel human type II cytokeratin, K6hf, specifically expressed in the
companion layer of the hair follicle. J Invest Dermatol 111:955–62
Winter H, Schissel D, Parry DA, Smith TA, Liovic M, Birgitte Lane E et al.
(2004) An unusual Ala12Thr polymorphism in the 1A alpha-helical
segment of the companion layer-specific keratin K6hf: evidence for a risk
factor in the etiology of the common hair disorder pseudofolliculitis
barbae. J Invest Dermatol 122:652–7
Wojcik SM, Bundman DS, Roop DR (2000) Delayed wound healing in keratin
6a knockout mice. Mol Cell Biol 20:5248–55
Wojcik SM, Longley MA, Roop DR (2001) Discovery of a novel murine
keratin 6 (K6) isoform explains the absence of hair and nail defects in
mice deficient for K6a and K6b. J Cell Biol 154:619–30
Wong P, Colucci-Guyon E, Takahashi K, Gu C, Babinet C, Coulombe PA
(2000) Introducing a null mutation in the mouse K6alpha and K6beta
genes reveals their essential structural role in the oral mucosa. J Cell Biol
150:921–8
Xiao SX, Feng YG, Ren XR, Tan SS, Li L, Wang JM et al. (2004) A novel
mutation in the second half of the keratin 17 1A domain in a large
pedigree with delayed-onset pachyonychia congenita type 2. J Invest
Dermatol 122:892–5
Zhang Y, Buchholz F, Muyrers JP, Stewart AF (1998) A new logic for DNA
engineering using recombination in Escherichia coli. Nat Genet 20:
123–8
Zhang Y, Muyrers JP, Testa G, Stewart AF (2000) DNA cloning by
homologous recombination in Escherichia coli. Nat Biotechnol 18:
1314–1317
www.jidonline.org 279
J Chen et al.
Mouse Model for a Dominant Krt75 Mutation