Regeneration of ovine articular cartilage defects by cell-free polymer-based implants.

Abstract

The aim of our study was the evaluation of a cell-free cartilage implant that allows the recruitment of mesenchymal stem and progenitor cells by chemo-attractants and subsequent guidance of the progenitors to form cartilage repair tissue after microfracture. Chemotactic activity of human serum on human mesenchymal progenitors was tested in 96-well chemotaxis assays and chondrogenic differentiation was assessed by gene expression profiling after stimulating progenitors with hyaluronan in high-density cultures. Autologous serum and hyaluronan were combined with polyglycolic acid (PGA) scaffolds and were implanted into full-thickness articular cartilage defects of the sheep pre-treated with microfracture. Defects treated with microfracture served as controls. Human serum was a potent chemo-attractant and efficiently recruited mesenchymal progenitors. Chondrogenic differentiation of progenitors upon stimulation with hyaluronan was shown by the induction of typical chondrogenic marker genes like type II collagen and aggrecan. Three months after implantation of the cell-free implant, histological analysis documented the formation of a cartilaginous repair tissue. Controls treated with microfracture showed no formation of repair tissue. The cell-free cartilage implant consisting of autologous serum, hyaluronan and PGA utilizes the migration and differentiation potential of mesenchymal progenitors for cartilage regeneration and is well suited for the treatment of cartilage defects after microfracture.

Full text

Page 1

Biomaterials 28 (2007) 5570–5580
Regeneration of ovine articular cartilage defects by cell-free
polymer-based implants
Christoph Erggeleta, Katja Neumannb,1, Michaela Endresb,c,1, Kathrin Haberstrohc,
Michael Sittingerc, Christian Kapsb,c,?
aDepartment of Traumatology and Orthopaedic Surgery, University of Freiburg, Hugstetter Street 55, 79106 Freiburg, Germany
bTransTissue Technologies GmbH, Tucholskystrasse 2, 10117 Berlin, Germany
cTissue Engineering Laboratory, Department of Rheumatology, Charite ´ Campus Mitte, Charite ´—Universita ¨tsmedizin Berlin,
Charite ´platz 1, 10117 Berlin, Germany
Received 29 June 2007; accepted 3 September 2007
Available online 25 September 2007
Abstract
The aim of our study was the evaluation of a cell-free cartilage implant that allows the recruitment of mesenchymal stem and
progenitor cells by chemo-attractants and subsequent guidance of the progenitors to form cartilage repair tissue after microfracture.
Chemotactic activity of human serum on human mesenchymal progenitors was tested in 96-well chemotaxis assays and chondrogenic
differentiation was assessed by gene expression profiling after stimulating progenitors with hyaluronan in high-density cultures.
Autologous serum and hyaluronan were combined with polyglycolic acid (PGA) scaffolds and were implanted into full-thickness
articular cartilage defects of the sheep pre-treated with microfracture. Defects treated with microfracture served as controls. Human
serum was a potent chemo-attractant and efficiently recruited mesenchymal progenitors. Chondrogenic differentiation of progenitors
upon stimulation with hyaluronan was shown by the induction of typical chondrogenic marker genes like type II collagen and aggrecan.
Three months after implantation of the cell-free implant, histological analysis documented the formation of a cartilaginous repair tissue.
Controls treated with microfracture showed no formation of repair tissue. The cell-free cartilage implant consisting of autologous serum,
hyaluronan and PGA utilizes the migration and differentiation potential of mesenchymal progenitors for cartilage regeneration and is
well suited for the treatment of cartilage defects after microfracture.
r 2007 Elsevier Ltd. All rights reserved.
Keywords: Cartilage regeneration; Microfracture; Cell-free implant; Stem cells; Chemotaxis
1. Introduction
Chondral or osteochondral lesions of the articular
cartilage were found in about 60% of the patients in
consecutive knee arthroscopies. Up to 20% of the patients
showed focal chondral or osteochondral defects [1,2]. Since
articular cartilage has a low intrinsic regenerative capacity
and cartilage lesions may potentially lead to severe
osteoarthritis, a variety of reparative techniques evolved
that aim covering of the cartilage defect, formation of
cartilaginous repair tissue and resurfacing of the articular
cartilage. Among others, bone marrow-stimulating techni-
ques like drilling [3], abrasion [4] or microfracturing [5] are
frequently used surgical options for the treatment of focal
cartilage defects.
The microfracture technique is a minimally invasive
procedure that induces a healing response by establishing
access to the subchondral bone marrow in regions of
articular damage. Arthroscopically, debridement of the
defect is performed by removing all free or marginally
attached cartilage in and around the defect. Damage to the
subchondral bone should be avoided and a well-attached
healthy cartilage rim is prepared that circumscribes the
defect. Adjacent to the cartilage rim and in the center of the
ARTICLE IN PRESS
www.elsevier.com/locate/biomaterials
0142-9612/$-see front matter r 2007 Elsevier Ltd. All rights reserved.
doi:10.1016/j.biomaterials.2007.09.005
?Corresponding author. Tissue Engineering Laboratory, Department of
Rheumatology, Charite ´ Campus Mitte (CCM), Charite ´—Universita ¨ tsmedi-
zin Berlin, Charite ´ platz 1, 10117 Berlin, Germany. Tel.: +4930450513293;
fax: +4930450513957.
E-mail address: christian.kaps@charite.de (C. Kaps).
1Both authors contributed equally.

Page 2

defect, multiple perforations are introduced in the sub-
chondral bone. These microfractures allow the influx of
blood, blood-derived cells and bone marrow-derived
mesenchymal stem and progenitor cells (MSCs) into the
defect, forming a blood clot. Mesenchymal progenitor cells
have a multipotential differentiation capacity that allows
development along the chondrogenic lineage [6] and may
be induced by growth factors from the subchondral bone to
develop a cartilaginous repair tissue [7–9]. The clinical
results after microfracture treatment of full-thickness
defects, especially in patients aged 40–45 or younger, have
shown good to excellent results with improvement in
function and reduction of pain [10–12]. On the cellular
level, the repair tissue induced by microfractures has been
shown to be of a hyaline to fibrous appearance with limited
short-term durability. Therefore, methods for the advance-
ment of the microfracture technique are demanded that
may enhance the content of key matrix components and
improve the cartilaginous repair tissue [13].
In recent years, a variety of biocompatible biomaterials
have been shown to support and enable the regeneration of
cartilage defects by cell-based tissue engineering ap-
proaches. The use of autologous chondrocytes (autologous
chondrocyte implantation, ACI) has been shown exten-
sively to be well suited for the repair of cartilage defects
[14–16]. Advanced cartilage tissue engineering grafts
combine the regenerative potential of autologous cells with
biocompatible graft-stabilizing scaffolds for the treatment
of focal cartilage defects. Clinically applied scaffolds are
based on e.g. hyaluronan [17], collagen [18] or synthetic
polymers [19].
Especially alpha-hydroxypolyesters are frequently used
synthetic polymers in cartilage tissue engineering. In
particular, polylactic (PLA) and polyglycolic (PGA) acids
as well as their copolymer poly-lactic-co-glycolic acid
(PLGA) have been studied in detail. For instance,
perichondral cells have been shown to form a cartilaginous
extracellular matrix with chondrocyte-like cells when
embedded in PLA and implanted in rabbit osteochondral
defects [20]. The implantation of autologous chondrocytes,
pluronic and PGA in porcine articular defects gave rise to
well-integrated hyaline cartilage with good biochemical
and biomechanical properties [21]. PLGA has been shown
to support the development of human articular chondro-
cytes towards hyaline cartilage in vitro [22] and showed
formation of hyaline-like cartilage with firm bonding of the
repair tissue to the adjacent cartilage and to the subchon-
dral bone in an equine defect model [23]. These bioresorb-
able polymer-based scaffolds allow the homogenous three-
dimensional distribution of cells within the biomaterial,
may guide the formation of the repair tissue, ensure initial
mechanical stability and manageability during surgery
and, in case of performing ACI, avoid the use of addi-
tional cover materials like periosteum, resorbable sheets or
foils [24].
Taking advantageofthe
guiding properties of bioresorbable polymers and the
mechanicaland tissue-
differentiation potential of mesenchymal progenitor cells
that are activated by the microfracture procedure, this
study evaluates the suitability of a cell-free cartilage
implant consisting of PGA, hyaluronan and autologous
serum for articular cartilage regeneration. Here we show
that human serum acts as a chemo-attractant and
stimulates the migration of human MSCs. Hyaluronan
supports the differentiation of human MSCs along the
chondrogenic lineage as shown by gene expression analysis.
Ovine full-thickness articular defects covered with cell-free
implants and pre-treated with microfracture showed
formation of a cartilaginous repair tissue, partially filling
the defect. In defects treated with microfracture only, no
repair tissue was evident. Therefore, covering of defects
pre-treated with microfracture by a cell-free cartilage
implant based on a PGA scaffold and hyaluronan is
considered to be a promising approach to regenerate
articular defects.
2. Materials and methods
2.1. Isolation and cell culture of human mesenchymal progenitor
cells
As described previously, human adult MSCs were isolated from bone
marrow aspirates (n ¼ 8, age 48–69) [25,26] and from subchondral bone
marrow (n ¼ 3, age 40–62) [27]. The bone marrow aspirates were derived
from donors who were examined to exclude hematopoietic neoplasm and
were histologically diagnosed as normal. The study was approved by the
Ethical Committee of the Charite ´ Universita ¨ tsmedizin Berlin. MSCs from
subchondral bone marrow were isolated from excised bone obtained from
the lateral tibia head during high tibial closed wedge osteotomy. Cells were
grown in complete Dulbecco’s modified eagle (DME) medium (Biochrom,
Germany) containing 2ng/ml basic fibroblast growth factor (bFGF, Tebu,
Germany) and 10% fetal bovine serum (FBS, Perbio, Belgium) or 5%
human serum (German Red Cross, Germany). The medium was
exchanged every 2–3 days. MSCs were routinely tested for the presence
of the typical MSC-related cell surface antigens SH2 and SH3 as well as
for the absence of CD34 and CD45.
2.2. Preparation of cell-free cartilage implants and MSC
recruitment assay
Resorbable felt (15?20?1.1mm3) of pure PGA (Alpha Research
Deutschland GmbH, Germany) was soaked in 330ml hyaluronic acid (HA,
10mg/ml Ostenils, TRB Chemedica AG, Germany). Implants were
freeze-dried for 16h using a lyophilisator (Leybold-Heraeus, Germany)
and stored in a desiccator at room temperature. To evaluate the capacity
of human serum to recruit MSCs, freeze-dried felts of PGA and HA were
incubated with 1ml of human serum from whole blood (German Red
Cross, Germany) for 10min. After dripping off the surplus of serum, the
felt was centrifuged in a reaction tube for 10min at 720g. After recovery of
the fluid, the mixture of HA and serum was diluted in a 1:1 ratio with
DME medium containing 0.5% bovine serum albumin (BSA) and used for
the cell migration assay. Cell-free implants re-hydrated with 1ml
physiological saline served as controls.
For the cell migration assay, the ChemoTXsAssay System (Neurop-
robe, USA) with a polycarbonate membrane (pore size: 8mm, pore
density: 1?103pores/mm2) was used according to the manufacturer’s
recommendations and as described previously [27]. All tests were
performed in triplicate. Individual mixtures of HA and serum obtained
from cell-free implants (n ¼ 5) were used as chemo-attractant. Mixtures
obtained from individual cell-free implants (n ¼ 3) that were re-hydrated
ARTICLE IN PRESS
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5571

Page 3

with physiological saline, DME medium containing 0.5% BSA (negative
control, n ¼ 3) and DME medium containing 10% FBS (positive control,
n ¼ 3) served as controls. All migration assays were performed in
triplicate. After migration of MSCs (passage 3), cells were fixed with
acetone/methanol 1:1 (v/v), rapidly stained with Hemacolor and counted
in three representative visual fields. The number of migrated MSCs was
extrapolated to the total area of the well (25mm2).
Forstatisticalevaluation, the
ences in pair-wise group comparisons were considered significant at
po0.05.
t-test was appliedanddiffer-
2.3. Chondrogenic differentiation of human mesenchymal
progenitor cells
For differentiation studies, MSCs (passage 3) obtained from individual
donors (n ¼ 3) were pooled in equal amounts and 250,000 MSCs were
centrifuged to form a high-density culture [28]. Differentiation was
induced for up to 2 weeks with DME medium supplemented with ITS+1
(insulin–transferrin–sodium–selenite, Sigma, Germany), 0.1mM dexa-
methasone (Sigma, Germany), 1mM sodium pyruvate (Sigma, Germany),
0.17mM ascorbic acid-2-phosphate (Sigma, Germany), 0.35mM proline
(Sigma, Germany) and 10% (v/v) HA (10mg/ml Ostenils). DME medium
supplemented with ITS+1, dexamethasone, sodium pyruvate, ascorbic
acid and proline served as control. The medium was exchanged every
second day.
2.4. Polymerase chain reaction (PCR)
Per point in time, 25 high-density MSC pellets were homogenized in
1ml TriReagent (Sigma, Germany) using an UltraTurrax. Bromochloro-
propane was added, incubated at room temperature for 10min and
centrifuged at 12,000g for 15min. The supernatants were used for the
isolation of total RNA using the Qiagen Rneasy Mini Kit (Qiagen,
Germany) according to the manufacturer’s protocol. Subsequently, total
RNA (3mg) was reverse transcribed with the iScript cDNA Synthesis Kit
according to the manufacturer’s recommendations (BIO-RAD, Ger-
many). The relative expression level of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH, up 5–030: GGCGATGCTGGCGCTGAGTAC,
down 50–30: TGGTCCACACCCATGACGA) was used to normalize
marker gene expression. Real-time PCR using the i-Cycler PCR System
(BIO-RAD, Germany) was performed with 1ml of cDNA sample using the
SYBR Green PCR Core Kit (Applied Biosystems, USA). Relative
quantitation of the expression of type IIa1 collagen (up 50–30: CCGG-
GCAGAGGGCAATAGCAGGTT, down 50–30: CAATGATGGGGAG-
GCGTGAG), cartilage link protein (up 50–30: GCGTCCGCTACCC-
CATCTCTA,down50–30: GCGCTCTAAGGGCACATTCAGTT),
cartilage oligomeric matrix protein (up 50–30: GGGTGGCCGCCTG-
GGGGTCTT, down 50–30: CTTGCCGCAGCTGATGGGTCTC) and
aggrecan (up 50–30: CCAGTGCACAGAGGGGTTTG, down 50–30: TCC-
GAGGGTGCCGTGAG) was performed and is given as fold change
compared to non-stimulated controls.
2.5. Implantation of cell-free implants in cartilage defects of the
sheep and histology
The study was designed in accordance with the German law for animal
protection and has been approved by the Review Board for the Care of
Animal Subjects at the Regierungspra ¨ sidium Tu ¨ bingen, Germany. Eight
adult Merino sheep (female, age: 3 years) were used in this study. For
anesthesia, sheep were fasted for 24h and pre-medicated with an
intramuscular injection of 0.05mg/kg atropine, 0.1mg/kg xylazine and
10.0mg/kg ketamine. Anesthesia was induced through a cephalic-vein
cannula with 2–3mg/kg propofol, and after endotracheal intubation,
maintained by inhalation of 1.5–2.0% isoflurane delivered in oxygen and
air (FiO2 0.4). Respiratory rate and tidal volume were adjusted to
maintain end-expiratory carbon dioxide tension (PetCO2) between 35 and
45mmHg. To ensure analgesia 4mg/kg carprofen and 4mg/kg fentanyl
were given preemptively by intravenous bolus injections followed by a
continuous infusion of 4mg/kg fentanyl throughout the surgical proce-
dure. All surgical procedures were performed under aseptic conditions.
The left stifle joint was opened by an antero-medial approach and the
medial condyle of the femur was exposed. Degenerative joint disease and
skeletal abnormalities were excluded by visual inspection and full-
thickness cartilage defects of 11?8mm2were created in the weight
bearing cartilage using a scalpel and a sharp spoon. Nine microfracture
perforations were introduced in the subchondral bone using a chondro-
picks. The depth of the perforations was 2mm and bleeding was
observed. Freeze-dried cell-free cartilage implants (11?8?1.1mm3), as
described above, were soaked in autologous sheep serum for 10min, used
for covering of the defect (n ¼ 4) and securely fixed trans-osseously as
described previously [29]. Cartilage defects with microfracture perfora-
tions but without covering with cell-free implants served as controls
(n ¼ 4). Wound closure was performed in layers and protected by a
plaster. Post-operatively, maintenance of analgesia was achieved by daily
application of 4mg/kg carprofen for at least 2 days. Sheep were allowed to
move freely in boxes for 10 days and out at feed, thereafter. At 14 days
(n ¼ 2) and 3 months (n ¼ 6), sheep were anesthetized and killed by
administration of 100mg/kg thiopentone and 2mmol/kg potassium
chloride intravenously.
Joints were fixed in formalin, decalcified and embedded in paraffin.
Sections (6mm) were stained with safranin O/fast Green and sections
through the center of the defect (n ¼ 3 per group) were evaluated
histologically.
3. Results
3.1. Human serum is a chemo-attractant and stimulates the
migration of human MSC
For analyzing the activity of human serum to recruit
human mesenchymal progenitors, the ChemoTXsAssay
System was used. MSCs are separated from the chemo-
attractant by a porous polycarbonate membrane and
migrate through the membrane when a chemotactic
stimulus is given (Fig. 1). Using human serum from whole
blood as a chemo-attractant, MSCs were recruited and
migrated through the membrane and attached to the lower
surface of the membrane (Fig. 1A). In contrast, only few
MSCs migrated when serum was absent (Fig. 1B). The
average number of MSCs recruited by different chemo-
attractants is given in Fig. 1C. The positive control (FBS)
recruited about 4.849 MSCs/25mm2. In contrast, 181
MSCs migrated spontaneously, when medium was used as
a negative control. The number of migrating MSCs
was significantly (po0.05) enhanced by using HA as a
chemo-attractant that recruited about 633 MSCs in the
absence of serum. The mixture of HA and human serum
significantly (po0.0001) elevated the number of recruited
MSCs and guided 2.524 MSCs to migrate through the
membrane.
3.2. HA induces the expression of cartilage matrix
molecules in human MSCs
Bone marrow-derived MSCs were stimulated for up to
2 weeks in high-density micro-mass culture with HA.
MSCs developed a compact pellet of vital cells that
ARTICLE IN PRESS
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5572

Page 4

showed, after histological staining, virtually no formation
of a cartilaginous extracellular matrix (data not shown). In
contrast, gene expression analysis of typical cartilage
marker genes (Fig. 2) showed that prolonged culture of
MSCs in the presence of HA for 14 days induced the
expression of type IIa1 collagen (2.8 fold), cartilage link
protein (2.1 fold), cartilage oligomeric matrix protein
(1.8 fold) and aggrecan (3.9 fold) compared to untreated
controls.
3.3. Microfracture treatment and implantation of the cell-
free polymer-based implant in sheep articular defects
After showing that serum may have the capacity to guide
MSCs into the implant and that HA may promote the
chondrogenic differentiation of MSCs, the capacity of HA
and serum to regenerate articular cartilage was analyzed in
a sheep articular cartilage defect model (Fig. 3). The
bioresorbable felt-like textile scaffold of pure PGA was
ARTICLE IN PRESS
0
1.000
2.000
3.000
4.000
5.000
6.000
pos control
(10% FBS)
neg control
(medium)
HAHA/serum
number of migrated MSC/25 mm2
*
**
Fig. 1. Chemotactic recruitment of human mesenchymal progenitors by human serum. Upon stimulation with human serum, human mesenchymal stem
and progenitor cells (MSCs) migrated through the pores of the polycarbonate membrane, attached to the under-side of the membrane and were stained
with hemacolor (A). MSCs were not evident in negative controls stimulated with medium (B). Quantitation of migrated progenitors (C) showed that
hyaluronic acid (HA) significantly (*po0.05) stimulated the migration of the progenitors compared to negative controls. Using the combination of HA
and human serum, the amount of migrating mesenchymal progenitors was significantly (**po0.0001) elevated compared to negative controls and to
progenitors stimulated with HA. The bars show the mean number of migrated MSCs and the standard deviation is given.
control
[d 7]
control
[d 14]
HA
[d 7]
HA
[d 14]
0
1
2
3
4
5
fold change
type IIa1 collagen
0
1
2
3
4
5
fold change
control
[d 7]
control
[d 14]
HA
[d 7]
HA
[d 14]
cartilage link protein
0
1
2
3
4
5
fold change
control
[d 7]
control
[d 14]
HA
[d 7]
HA
[d 14]
cartilage oligomeric matrix protein
0
1
2
3
4
5
fold change
control
[d 7]
control
[d 14]
HA
[d 7]
HA
[d 14]
aggrecan
Fig. 2. Semi-quantitative real-time gene expression analysis of typical chondrogenic marker genes in human mesenchymal progenitors upon stimulation
with hyaluronan. The expression of the chondrogenic marker genes type II collagen, cartilage link protein, cartilage oligomeric matrix protein and aggrecan
increased when human mesenchymal progenitors were cultured in high-density in the presence of hyaluronan for up to 14 days. The expression of marker
genes is given as fold change compared to non-stimulated progenitors. The mean of each triplicate well is plotted and the error bars represent standard
deviation.
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5573

Page 5

soaked with HA, freeze-dried and was re-hydrated directly
prior to the implantation by adding autologous serum. For
implantation, a full-thickness articular cartilage defect was
created (Fig. 3A). To provide access to progenitors residing
in the subchondral bone marrow, microfracture perfora-
tions (Fig. 3B) were introduced into the subchondral bone
until bleeding was observed (Fig. 3C). Thereafter, the cell-
free implant was used to cover the defect and securely
anchored by trans-osseous fixation with resorbable sutures
(Fig. 3D).
At day 14, histological analysis of the defect area was
performed (Fig. 4). The cartilage defect treated with
microfracture perforations but without covering by the
cell-free implant showed complete debridement of the
articular cartilage down to the subchondral bone and no
development of repair tissue (Fig. 4A). The cell-free
implant covering the defect (Fig. 4B) showed a superficial
layer of a cell-rich fibrous tissue towards the joint space
(white arrows, Fig. 4C) and a layer firmly bonding the
implant to the subchondral bone (black asterisk, Fig. 4D).
In the central region of the implant (Fig. 4E), the fibers
of the polymer (black double arrow, Fig. 4F), Safranin
O-stained extracellular matrix and cells (Fig. 4F, white
arrows) were evident.
3.4. Histological evaluation of repair tissue formation in
sheep articular defects
After 3 months, defects treated with microfracture, only,
showed macroscopically no development of a repair tissue
(Fig. 5A). The articular cartilage defects showed debride-
ment down to the subchondral bone with some protrusion
of tissue from the cartilage rim (cartilage flow). In the
center of the defect, remnants of the microfracture
perforations with bleeding of the subchondral bone tissue
were evident (Fig. 5A, black arrows). Defects treated with
microfracture and covering with the cell-free implant
showed formation of a repair tissue that is characterized
by a hyaline appearance (Fig. 5B). The repair tissue
partially filled the defect and exhibited small cavities with
ARTICLE IN PRESS
Fig. 3. Implantation of the cell-free implant in full-thickness defects after pre-treatment with microfracture. Full-thickness cartilage defects (11?8mm2)
were created by debridement of the articular cartilage down to the subchondral bone (A). Microfracture perforations were introduced in the subchondral
bone using a chondropicks(B) and bleeding of the subchondral tissue was observed (C). The cell-free implant consisting of the polyglycolic acid scaffold,
hyaluronan and autologous serum was used to cover the defect and fixed by trans-osseous suturing (D).
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5574

Page 6

no or marginal repair tissue formation (Fig. 5B, black
arrow). In all samples treated with the cell-free implant, a
distinct area was evident with marginal development of
repair tissue (Fig. 5B, black asterisk), which may occur due
to anatomical properties of the sheep stifle joint and/or
localization of the patella and ligaments scraping the
implant.
Histological analysis of defects treated with microfrac-
ture as well as the repair tissue formed after microfracture
treatment and covering with the cell-free implant was
performed by staining with Safranin O and is shown for
each individual defect (Fig. 6). After 3 months, the defects
treated with microfracture without covering with the cell-
free implant showed no formation of repair tissue,
histologically (Fig. 6A–C). The articular cartilage was
removed completely down to the subchondral bone and
few incidental remnants of the cartilage were evident
(Fig. 6B, black arrow). The microfracture perforations in
the subchondral bone, were filled with a cell-rich repair
tissue, showed ongoing osseous tissue formation and
achieved the level of the subchondral calcified layer of
the end-plate, but not of the articular cartilage (Fig. 6C,
black arrow). As shown in high-power magnification
micrographs (Fig. 6D–F), the mature cortical bone of the
end-plate (Fig. 6D, black asterisk) is sharply defined from
the calcified zone of the subchondral bone plate (Fig. 6D,
black arrows). Articular cartilage or repair tissue covering
the subchondral bone was not evident.
Histological analysis of the repair tissue of defects after
microfracture treatment and implantation of the cell-free
implant showed the formation of a cartilaginous tissue with
intense staining of proteoglycans (Fig. 6G, H). The repair
tissue developed in one of the defects showed a cell-rich but
unstructured tissue with an emerging extracellular matrix
containing proteoglycans (Fig. 6I). Development of a
proteoglycan-containing tissue is shown by the bright and
ARTICLE IN PRESS
Fig. 4. Histological analysis of cartilage defects, 14 days after treatment with microfracture and implantation of the cell-free implant. At day 14, safranin
O staining showed that the articular cartilage was completely removed down to the subchondral bone and no development of repair tissue in the defect
treated with microfracture was apparent (A). The cell-free implant covered the defect (B), showed a layer of cell-rich fibrous tissue in the superficial zone of
the implant (C, white arrows) and firm bonding to the subchondral bone (D, black asterisk). In the center of the implant (E), fibers of the polymer
(F, black double arrow), extracellular matrix and cells were evident (F, white arrows).
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5575

Page 7

faint pink staining of the tissue located towards the joint
space (Fig. 6L, black arrows). Subjacent to the cell-rich
repair tissue, a just developing calcified zone (Fig. 6L,
black asterisks) can be seen contiguous with the underlying
cortical bone. Specimens with cartilaginous repair tissue
showed progressive remodeling of the subchondral bone
tissue (Fig. 6G, H, black arrows) adjacent to the cortical
bone (Fig. 6G, asterisk). The repair tissue was void of
polymer fibers and showed viable cells (Fig. 6J, K). The
cells were round-shaped with some cells of fibroblastic
appearance and mainly showed a columnar distribution
with some clustering. There were no signs of abnormal
calcification, infiltration of immunological cells, apoptosis
of cells nor necrosis within the repair tissue.
4. Discussion
In the present study, we demonstrated that the cell-free
cartilage implant made of a textile PGA scaffold and HA
allows the in situ recruitment of MSCs by serum as a
chemo-attractant and subsequent guidance of the progeni-
tors towards formation of cartilage repair tissue. Using a
96-well chemotaxis assay system, we showed that human
serum is a potent chemo-attractant and stimulated the
migration of human MSCs from bone marrow. Culture of
human MSCs in the presence of HA in high-density micro-
masses stimulated the progenitors to differentiate along the
chondrogenic lineage as shown by the induction of typical
chondrogenic marker genes. In the ovine cartilage defect
model, histological analysis documented that covering of
defects pre-treated with microfracture by the cell-free
implant led to the development of a cartilaginous repair
tissue that was rich in cells, showed a typical proteoglycan-
rich extracellular matrix and partially filled the defect. In
contrast, control defects treated with microfracture, only,
formed no repair tissue.
Perforation of the subchondral bone is followed by the
migration or flow of mesenchymal progenitors from the
bone marrow and subsequent formation of a fibrous to
cartilaginous repair tissue [5]. The mechanisms and factors
that guide the migration and differentiation of mesenchy-
mal cells in microfracture-mediated repair have still to be
elucidated. Early events in the reparative sequence include
the formation of a hematoma with fibrin deposition and
binding of platelets. It is suggested that these platelets
release vasoactive factors, growth factors and cytokines
that may influence cell migration, differentiation and tissue
development [7]. In addition, the bone and its marrow
contains growth factors and cytokines that may be
important key molecules for vascularization, cell migration
and repair of osteochondral defects [30,31]. Recently, it has
been shown that chemokines [32,33], bone morphogenetic
proteins (BMP) [34] and human synovial fluid [27]
stimulate mesenchymal stem cells to migrate in vitro. As
shown here, human serum that contains a variety of
chemokines and growth factors is also a potent elicitor of
stem cell migration and may support the influx of stem cells
into the defect during microfracture. This is consistent with
a report of Kramer and colleagues that shows that
multipotential mesenchymal stem cells were evident in a
porcine collagen I/III matrix that was soaked with blood
during the microfracture procedure for 5min and subse-
quently fixed with fibrin glue and serum [35]. Therefore, the
autologous serum used in the cell-free implant may, in co-
operation with synovial fluid and factors from the blood,
enhance or promote the migratory activity of mesenchymal
stem cells activated by microfracture and may attract to as
well as enrich MSCs within the implant.
MSCs have the capacity to develop into a variety of
mesenchymal tissues including bone and cartilage [6].
Especially their chondrogenic developmental capacity
may value MSCs as an attractive cell source for regen-
erative medicine [36]. Initiation of chondrogenesis in MSCs
was achieved by culturing MSCs three-dimensionally in the
presence of transforming growth factors and selected
BMPs [28,37,38]. Interestingly, as also shown here, the
chondrogenic differentiation sequence of MSCs may not
only be initiated by distinct growth and differentiation
factors but structural components of mesenchymal tissues
like HA. HA is frequently used for the treatment of pain
associated with knee osteoarthritis, lubricates the joint, is a
shock absorber, has a protective effect on articular
cartilage and may exert its effect by enhancement of
chondrocyte HA and proteoglycan synthesis as well as by
suppressing potentially pro-inflammatory mediators [39].
As shown here, in human MSCs, HA induced the
ARTICLE IN PRESS
Fig. 5. Macroscopic view of cartilage defects, 3 months after treatment
with microfracture and implantation of the cell-free implant. Three
months after treatment with microfracture only (A), the defects showed no
formation of a repair tissue. The subchondral bone was still visible and
some cartilage flow was evident. Remnants of the microfracture
perforations showed bleeding of the subchondral bone tissue (A, black
arrows). Defects covered with the cell-free implant after pre-treatment
with microfracture (B) exhibited a cartilaginous repair tissue of a hyaline
appearance with some cavities (B, black arrow). All defects covered with
the implant showed a spatially confined area with marginal repair tissue
formation, which may due to anatomical characteristics of the sheep stifle
joint (B, black asterisk).
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5576

Page 8

expression of typical chondrogenic marker genes including
type II collagen and aggrecan. The chondrogenesis-indu-
cing properties of HA were also shown in the equine and
rabbit model. In the equine model, HA as well as
autologous synovial fluid stimulated chondrogenesis of
MSCs in different concentrations [40] and transplantation
of autologous MSCs embedded in HA gel sponges showed
good repair of rabbit osteochondral defects [41]. This
suggests that HA may induce or at least support the
chondrogenic development of mesenchymal progenitors.
ARTICLE IN PRESS
Fig. 6. Histological analysis of cartilage defects, 3 months after treatment with microfracture and implantation of the cell-free implant. Safranin O
staining of the individual specimens of defects, that were treated with microfracture but without covering with the cell-free implant, showed no formation
of repair tissue (A–F). The articular cartilage was completely removed and occasionally some remains of the cartilage were evident (B, black arrow).
Microfracture perforations were visible and were filled with repair tissue that achieved the level of the subchondral calcified layer (C, black arrow). Defects
treated with microfracture explicitly showed the calcified zone of the subchondral plate (D, black arrows) and mature cortical bone (D, black asterisk).
Tissue covering the defect was not evident. All defects that were covered with the cell-free implant after pre-treatment with microfracture developed repair
tissue (G–L). Histologically, the repair tissue showed cartilaginous characteristics (G, H) or was unstructured with faint staining of proteoglycans (L, black
arrows) and a calcified zone just evolving (L, black asterisks). Adjacent to the cortical bone (G, black asterisk) the subchondral bone tissue showed
progressive remodeling (G, H, black arrows). The cartilaginous repair tissue was rich in round-shaped cells with columnar distribution and showed intense
staining of proteoglycans (J, K).
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5577

Page 9

In the cell-free implant, human serum and HA with their
migration and differentiation stimulating properties were
combined with the initially mechanically stable PGA
scaffold and used for covering of ovine full-thickness
cartilage defects pre-treated with microfracture. Three
months after implantation of the cell-free implant in large
defects, the defects showed the formation of a cell-rich
repair tissue of cartilaginous appearance and partial filling
of the defect. The effectiveness of covering defects pre-
treated with microfracture was also shown in the canine
model. Articular defects of the trochlear grooves of adult
dogs were treated with microfracture, with covering by a
type II collagen membrane after pre-treatment with
microfracture, and with autologous chondrocytes em-
bedded in the collagen matrix. The best filling of the defect
was achieved by covering the defect after microfracture
[42]. In contrast, using the ovine model, covering of defects
with a porcine collagen matrix after pre-treatment with
microfracture did not enhance the healing response
compared to microfracture without covering after 4 and
12 months. Instead, regeneration of hyaline-like cartilage
was achieved after introducing microfracture perforations
and implanting the collagen matrix augmented with
chondrocytes [43,44]. Recently, the use of cell-free collagen
matrices combined with fibrin glue and autologous serum
in terms of autologous matrix-induced chondrogenesis
(AMIC) is suggested to be a promising treatment option to
cover defects after microfracture [45]. In osteochondral
defects, Gotterbarm and colleagues used a cell-free two-
layered implant consisting of tri-calcium phosphate for
bone development and a superficial type I/III collagen
layer for cartilage regeneration. Treatment of porcine
defects with the osteochondral implant improved defect
filling and subchondral bone repair. The addition of a
mixture of growth factors improved the mechanical and
histological properties of the repair tissue in the early
(12 weeks) but not in the late phase (52 weeks) of cartilage
regeneration [46].
All these cell-free approaches have in common that the
use of cell-free cartilage or osteochondral implants may
have the advantage that only one surgical intervention is
necessary and donor site morbidity is avoided, in contrast
to cell-based grafts. Since cell-free implants are storable
and have a considerably longer shelf life than cell-based
grafts, the cell-free implants can be used on demand for the
treatment of focal cartilage defects. In addition, from the
surgical point of view, the textile structure of textile
polymer-based scaffolds and especially PGA scaffolds
ensures secure fixation of the implant in the defect by
cartilage suturing, trans-osseous suturing or by resorbable
pins [47–49]. The enhanced biomechanical stability of the
scaffolds allows for early loading of the treated defect, as
demonstrated in this study. This contrasts with longer
periods of limited weight bearing recommended after
microfracture treatment. From the cellular point of view,
covering of the defect after pre-treatment with microfrac-
ture may enhance the healing response by supporting cell
migration and cell differentiation. In addition, the textile
structure of the implant may allow enrichment of the
amount of cells at the defect site and may prevent acute
negative events caused by bleeding into the joint cavity. In
a dog model, a single bleeding resulted in a disturbed
cartilage matrix turnover and mild synovitis in the short
term. However, in the long term, the joints recovered and
normal cartilage metabolism as well as absence of synovial
inflammation were evident [50,51].
5. Conclusions
In summary, we have shown that the components of the
cell-free implant, HA and serum, induce and/or support the
migration and chondrogenic differentiation of human
mesenchymal progenitor cells derived from bone marrow.
Covering of full-thickness ovine cartilage defects by the
cell-free implant after pre-treatment with microfracture
showed the formation of cartilaginous repair tissue. In
contrast, in this model, large articular defects treated with
microfracture, only, showed no healing and formed no
repair tissue. Therefore, the implantation of polymer-based
cell-free implants of HA embedded in a textile PGA
scaffold soaked with autologous serum into cartilage
defects is suggested to be a promising approach to cover
and regenerate articular cartilage defects after microfrac-
ture, clinically.
Acknowledgments
The authors are very grateful to Samuel Vetterlein for
the excellent technical assistance.
Supported by the Investitionsbank Berlin and the
European RegionalDevelopment
10023712, 10129206).
Fund(Grants
References
[1] Curl WW, Krome J, Gordon ES, Rushing J, Smith BP, Poehling GG.
Cartilage injuries: a review of 31,516 knee arthroscopies. Arthroscopy
1997;13:456–60.
[2] Hjelle K, Solheim E, Strand T, Muri R, Brittberg M. Articular
cartilage defects in 1,000 knee arthroscopies. Arthroscopy 2002;18:
730–4.
[3] Pridie KH. A method of resurfacing osteoarthritic knee joints. J Bone
Joint Surg [Br] 1959;41:418–9.
[4] Johnson LL. Arthroscopic abrasion arthroplasty: a review. Clin
Orthop Relat Res 2001;391:S306–17.
[5] Steadman JR, Rodkey WG, Rodrigo JJ. Microfracture: surgical
technique and rehabilitation to treat chondral defects. Clin Orthop
Relat Res 2001;391:S362–9.
[6] Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R,
Mosca JD, et al. Multilineage potential of adult human mesenchymal
stem cells. Science 1999;284:143–7.
[7] Shapiro F, Koide S, Glimcher MJ. Cell origin and differentiation in
the repair of full-thickness defects of articular cartilage. J Bone Joint
Surg Am 1993;75:532–53.
[8] Steadman JR, Rodkey WG, Briggs KK, Rodrigo JJ. The micro-
fracture technic in the management of complete cartilage defects in
the knee joint. Orthopade 1999;28:26–32.
ARTICLE IN PRESS
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5578

Page 10

[9] Gill TJ, Asnis PD, Berkson EM. The treatment of articular cartilage
defects using the microfracture technique. J Orthop Sports Phys Ther
2006;36:728–38.
[10] Steadman JR, Briggs KK, Rodrigo JJ, Kocher MS, Gill TJ, Rodkey
WG. Outcomes of microfracture for traumatic chondral defects of the
knee: average 11-year follow-up. Arthroscopy 2003;19:477–84.
[11] Knutsen G, Engebretsen L, Ludvigsen TC, Drogset JO, Grontvedt T,
Solheim E, et al. Autologous chondrocyte implantation compared
with microfracture in the knee. A randomized trial. J Bone Joint Surg
Am 2004;86-A:455–64.
[12] Kreuz PC, Erggelet C, Steinwachs MR, Krause SJ, Lahm A,
Niemeyer P, et al. Is microfracture of chondral defects in the knee
associated with different results in patients aged 40 years or younger?
Arthroscopy 2006;22:1180–6.
[13] Frisbie DD, Oxford JT, Southwood L, Trotter GW, Rodkey WG,
Steadman JR, et al. Early events in cartilage repair after subchondral
bone microfracture. Clin Orthop Relat Res 2003;407:215–27.
[14] Browne JE, Anderson AF, Arciero R, Mandelbaum B, Moseley Jr
JB, Micheli LJ, et al. Clinical outcome of autologous chondrocyte
implantation at 5 years in US subjects. Clin Orthop Relat Res
2005;436:237–45.
[15] Minas T. Autologous chondrocyte implantation in the arthritic knee.
Orthopedics 2003;26:945–7.
[16] Peterson L, Minas T, Brittberg M, Nilsson A, Sjogren-Jansson E,
Lindahl A. Two- to 9-year outcome after autologous chondrocyte
transplantation of the knee. Clin Orthop Relat Res 2000;374:212–34.
[17] Hollander AP, Dickinson SC, Sims TJ, Brun P, Cortivo R, Kon E,
et al. Maturation of tissue engineered cartilage implanted in injured
and osteoarthritic human knees. Tissue Eng 2006;12:1787–98.
[18] Behrens P, Bitter T, Kurz B, Russlies M. Matrix-associated
autologouschondrocyte transplantation/implantation
MACI)—5-year follow-up. Knee 2006;13:194–202.
[19] Ossendorf C, Kaps C, Kreuz PC, Burmester GR, Sittinger M,
Erggelet C. Treatment of posttraumatic and focal osteoarthritic
cartilage defects of the knee with autologous polymer-based three-
dimensional chondrocyte grafts: 2-year clinical results. Arthritis Res
Ther 2007;9:R41.
[20] Chu CR, Coutts RD, Yoshioka M, Harwood FL, Monosov AZ,
Amiel D. Articular cartilage repair using allogeneic perichondrocyte-
seeded biodegradable porous polylactic acid (PLA): a tissue-
engineering study. J Biomed Mater Res 1995;29:1147–54.
[21] Liu Y, Chen F, Liu W, Cui L, Shang Q, Xia W, et al. Repairing large
porcine full-thickness defects of articular cartilage using autologous
chondrocyte-engineered cartilage. Tissue Eng 2002;8:709–21.
[22] Kaps C, Frauenschuh S, Endres M, Ringe J, Haisch A, Lauber J,
et al. Gene expression profiling of human articular cartilage grafts
generated by tissue engineering. Biomaterials 2006;27:3617–30.
[23] Barnewitz D, Endres M, Kruger I, Becker A, Zimmermann J, Wilke
I, et al. Treatment of articular cartilage defects in horses with
polymer-based cartilage tissue engineering grafts. Biomaterials 2006;
27:2882–9.
[24] Sittinger M, Hutmacher DW, Risbud MV. Current strategies for cell
delivery in cartilage and bone regeneration. Curr Opin Biotechnol
2004;15:411–8.
[25] Haynesworth SE, Goshima J, Goldberg VM, Caplan AI. Character-
ization of cells with osteogenic potential from human marrow. Bone
1992;13:81–8.
[26] Neumann K, Endres M, Ringe J, Flath B, Manz R, Haupl T, et al.
BMP7 promotes adipogenic but not osteo-/chondrogenic differentia-
tion of adult human bone marrow-derived stem cells in high-density
micro-mass culture. J Cell Biochem 2007; Epub May 11.
[27] EndresM,NeumannK,Haupl
Sittinger M, et al. Synovial fluid recruits human mesenchymal
progenitors from subchondral spongious bone marrow. J Orthop Res
2007;Epub June 4.
[28] Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU.
In vitro chondrogenesis of bone marrow-derived mesenchymal
progenitor cells. Exp Cell Res 1998;238:265–72.
(MACT/
T,ErggeletC,RingeJ,
[29] Erggelet C, Sittinger M, Lahm A. The arthroscopic implantation of
autologous chondrocytes for the treatment of full-thickness cartilage
defects of the knee joint. Arthroscopy 2003;19:108–10.
[30] Buckwalter JA, Martin JA, Olmstead M, Athanasiou KA, Rosen-
wasser MP, Mow VC. Osteochondral repair of primate knee femoral
and patellar articular surfaces: implications for preventing post-
traumatic osteoarthritis. Iowa Orthop J 2003;23:66–74.
[31] Buckwalter JA, Brown TD. Joint injury, repair, and remodeling: roles
in post-traumatic osteoarthritis. Clin Orthop Relat Res 2004;423:
7–16.
[32] Sordi V, Malosio ML, Marchesi F, Mercalli A, Melzi R, Giordano T,
et al. Bone marrow mesenchymal stem cells express a restricted set of
functionally active chemokine receptors capable of promoting
migration to pancreatic islets. Blood 2005;106:419–27.
[33] Ringe J, Strassburg S, Neumann K, Endres M, Notter M, Burmester
GR, et al. Towards in situ tissue repair: human mesenchymal stem
cells express chemokine receptors CXCR1, CXCR2 and CCR2, and
migrate upon stimulation with CXCL8 but not CCL2. J Cell Biochem
2007;101:135–46.
[34] Fiedler J, Roderer G, Gunther KP, Brenner RE. BMP-2, BMP-4, and
PDGF-bb stimulate chemotactic migration of primary human
mesenchymal progenitor cells. J Cell Biochem 2002;87:305–12.
[35] Kramer J, Bohrnsen F, Lindner U, Behrens P, Schlenke P, Rohwedel
J. In vivo matrix-guided human mesenchymal stem cells. Cell Mol
Life Sci 2006;63:616–26.
[36] Barry FP, Murphy JM. Mesenchymal stem cells: clinical applications
and biological characterization. Int J Biochem Cell Biol 2004;36:
568–84.
[37] Sekiya I, Larson BL, Vuoristo JT, Reger RL, Prockop DJ.
Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage
formation of human adult stem cells from bone marrow stroma. Cell
Tissue Res 2005;320:269–76.
[38] Majumdar MK, Wang E, Morris EA. BMP-2 and BMP-9 promotes
chondrogenic differentiation of human multipotential mesenchymal
cells and overcomes the inhibitory effect of IL-1. J Cell Physiol 2001;
189:275–84.
[39] Moreland LW. Intra-articular hyaluronan (hyaluronic acid) and
hylans for the treatment of osteoarthritis: mechanisms of action.
Arthritis Res Ther 2003;5:54–67.
[40] Hegewald AA, Ringe J, Bartel J, Kruger I, Notter M, Barnewitz D,
et al. Hyaluronic acid and autologous synovial fluid induce
chondrogenic differentiation of equine mesenchymal stem cells:
a preliminary study. Tissue Cell 2004;36:431–8.
[41] Kayakabe M, Tsutsumi S, Watanabe H, Kato Y, Takagishi K.
Transplantation of autologous rabbit BM-derived mesenchymal
stromal cells embedded in hyaluronic acid gel sponge into osteochon-
dral defects of the knee. Cytotherapy 2006;8:343–53.
[42] Breinan HA, Martin SD, Hsu HP, Spector M. Healing of canine
articular cartilage defects treated with microfracture, a type-II
collagen matrix, or cultured autologous chondrocytes. J Orthop
Res 2000;18:781–9.
[43] Dorotka R, Bindreiter U, Macfelda K, Windberger U, Nehrer S.
Marrow stimulation and chondrocyte transplantation using a
collagen matrix for cartilage repair. Osteoarthritis Cartil 2005;13:
655–64.
[44] Dorotka R, Windberger U, Macfelda K, Bindreiter U, Toma C,
Nehrer S. Repair of articular cartilage defects treated by micro-
fracture and a three-dimensional collagen matrix. Biomaterials 2005;
26:3617–29.
[45] Behrens P. Matrix-coupled microfracture-a new concept for cartilage
defect repair (in German). Arthroskopie 2005;18:193–7.
[46] Gotterbarm T, Richter W, Jung M, Berardi Vilei S, Mainil-Varlet P,
Yamashita T, et al. An in vivo study of a growth-factor enhanced, cell
free, two-layered collagen–tricalcium phosphate in deep osteochon-
dral defects. Biomaterials 2006;27:3387–95.
[47] Drobnic M, Radosavljevic D, Ravnik D, Pavlovcic V, Hribernik M.
Comparison of four techniques for the fixation of a collagen scaffold
in the human cadaveric knee. Osteoarthritis Cartil 2006;14:337–44.
ARTICLE IN PRESS
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5579

Page 11

[48] Knecht S, Erggelet C, Endres M, Sittinger M, Kaps C, Stussi E.
Mechanical testing of fixation techniques for scaffold-based tissue-
engineered grafts. J Biomed Mater Res B Appl Biomater 2007;83:50–7.
[49] Petersen W, Zelle S, Zantop T. Arthroscopic implantation of a three
dimensional scaffold for autologous chondrocyte transplantation.
Arch Orthop Trauma Surg 2007; Epub May 16.
[50] Roosendaal G, TeKoppele JM, Vianen ME, van den Berg HM,
Lafeber FP, Bijlsma JW. Blood-induced joint damage: a canine in
vivo study. Arthritis Rheum 1999;42:1033–9.
[51] Hooiveld M, Roosendaal G, Vianen M, van den Berg M, Bijlsma J,
Lafeber F. Blood-induced joint damage: longterm effects in vitro and
in vivo. J Rheumatol 2003;30:339–44.
ARTICLE IN PRESS
C. Erggelet et al. / Biomaterials 28 (2007) 5570–5580
5580