Regulation of p21Waf1 expression and TNFα biosynthesis by glutathione modulators in PMA induced-THP1 differentiation: Involvement of JNK and ERK pathways

Instituto do Coração, InCor, Universidade de São Paulo, São Paulo, Brazil.
Biochemical and Biophysical Research Communications (Impact Factor: 2.3). 12/2007; 363(4):965-70. DOI: 10.1016/j.bbrc.2007.09.091
Source: PubMed

Oxidative modifications of proteins are fundamental biochemical events that regulate cellular signaling, protein expression, and function. The redox status is balanced by reductants in which GSH plays a major role. This study investigated whether or not p21Waf1 expression and TNFalpha biosynthesis in macrophage differentiation/activation were regulated by GSH modulators and whether or not the JNK and ERK pathway were involved. We observed an increase of p21Waf1 expression and TNFalpha biosynthesis in the THP1 monocyte/macrophage cell line treated with PMA. Treatment of THP1 cultures with NAC prior to adding PMA abrogates the expression of p21Waf1 mRNA and decreases the level of TNFalpha whereas GSH depletion by BSO enhances the levels of TNFalpha with minor effects on p21Waf1 expression. To assess whether or not ERK and JNK were involved in the redox mechanism of p21Waf1 and TNFalpha, we used pharmacological inhibitors for JNK and ERK. Both PD98095 and dicoumarol were capable of blocking TNFalpha production but had only a small effect on p21Waf1 expression. We next observed that activation of JNK was significantly inhibited in cells pretreated with NAC with no effect on ERK. Taken together, our findings suggest that the modulation of GSH regulate the magnitude the cell response to PMA in which JNK and ERK have a particular role in redox signaling.

Available from: Hugo P Monteiro, May 16, 2014
  • Source
    • "To amplify MK2, MK3, and MK5 cDNA following primers were used: MK2 forward: GAATCTGTACGCAGGGAGGAAG; MK2 reverse: CATACTGGCCCATTCGGAT; MK3 forward GTTGTCCAAGCAGGTGCTGGG, MK3 reverse: TTAAGCACTGCGTCTTTCTCC; MK5 forward: CCCTACACTTACAACAAGAGCTGTG, and MK5 reverse: CTTTATCTGTGAATCCACGACCATTC. The primers for rRNA have been previously described [33]. The PCR conditions were denaturation at 94°C for 30 sec, annealing for 30 sec at 60°C, and extension for 1 min at 72°C. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Classical mammalian mitogen-activated protein kinase (MAPK) pathways consist of a cascade of three successive phosphorylation events resulting in the phosphorylation of a variety of substrates, including another class of protein kinases referred to as MAPK-activating protein kinases (MAPKAPKs). The MAPKAPKs MK2, MK3 and MK5 are closely related, but MK2 and MK3 are the major downstream targets of the p38MAPK pathway, while MK5 can be activated by the atypical MAPK ERK3 and ERK4, protein kinase A (PKA), and maybe p38MAPK. MK2, MK3, and MK5 can phosphorylate the common substrate small heat shock protein 27 (HSP27), a modification that regulates the role of HSP27 in actin polymerization. Both stress and cAMP elevating stimuli can cause F-actin remodeling, but whereas the in vivo role of p38MAPK-MK2 in stress-triggered HSP27 phosphorylation and actin reorganization is well established, it is not known whether MK2 is involved in cAMP/PKA-induced F-actin rearrangements. On the other hand, MK5 can phosphorylate HSP27 and cause cytoskeletal changes in a cAMP/PKA-dependent manner, but its role as HSP27 kinase in stress-induced F-actin remodeling is disputed. Therefore, we wanted to investigate the implication of MK2 and MK5 in stress- and PKA-induced HSP27 phosphorylation. Using HEK293 cells, we show that MK2, MK3, and MK5 are expressed in these cells, but MK3 protein levels are very moderate. Stress- and cAMP-elevating stimuli, as well as ectopic expression of active MKK6 plus p38MAPK or the catalytic subunit of PKA trigger HSP27 phosphorylation, and specific inhibitors of p38MAPK and PKA prevent this phosphorylation. Depletion of MK2, but not MK3 and MK5 diminished stress-induced HSP27 phosphorylation, while only knockdown of MK5 reduced PKA-induced phosphoHSP27 levels. Stimulation of the p38MAPK, but not the PKA pathway, caused activation of MK2. Our results suggest that in HEK293 cells MK2 is the HSP27 kinase engaged in stress-induced, but not cAMP-induced phosphorylation of HSP27, while MK5 seems to be the sole MK to mediate HSP27 phosphorylation in response to stimulation of the PKA pathway. Thus, despite the same substrate specificity towards HSP27, MK2 and MK5 are implicated in different signaling pathways causing actin reorganization.
    Journal of Molecular Signaling 05/2011; 6(1):4. DOI:10.1186/1750-2187-6-4
  • Source
    • "We have previously demonstrated that the inhibition of the ERK pathway abrogated NO-mediated TRX nuclear translocation leading to decreased cell viability [15]. We also showed that the ERK pathway plays a critical role in NO-induced proliferation of rabbit endothelial cells and in PMA-induced human monocyte/macrophage differentiation [14] [27]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: p21Ras protein plays a critical role in cellular signaling that induces either cell cycle progression or apoptosis. Nitric oxide (NO) has been consistently reported to activate p21Ras through the redox sensitive cysteine residue (118). In this study, we demonstrated that the p21Ras-ERK pathway regulates THP-1 monocyte/macrophage apoptosis induced by S-nitrosoglutathione (SNOG). This was apparent from studies in THP-1 cells expressing NO-insensitive p21Ras (p21Ras(C118S)) where the pro-apoptotic action of SNOG was almost abrogated. Three major MAP kinase pathways (ERK, JNK, and p38) that are downstream to p21Ras were investigated. It was observed that only the activation of ERK1/2 MAP kinases by SNOG in THP-1 cells was attributable to p21Ras. The inhibition of the ERK pathway by PD98059 markedly attenuated apoptosis in SNOG-treated THP-1 cells, but had a marginal effect on SNOG-treated THP-1 cells expressing NO-insensitive p21Ras. The inhibition of the JNK and p38 pathways by selective inhibitors had no marked effects on the percentage of apoptosis. The induction of p21Waf1 expression by SNOG was observed in THP-1 cells harboring mutant and wild-type p21Ras, however in cells expressing mutant Ras, the expression of p21Waf1 was significantly attenuated. The treatment of THP-1 cells expressing wild-type p21Ras with PD98059 resulted in significant attenuation of p21Waf1 expression. These results indicate that the redox sensitive p21Ras-ERK pathway plays a critical role in sensing and delivering the pro-apoptotic signaling mediated by SNOG.
    Biochemical and Biophysical Research Communications 06/2008; 369(4):1001-6. DOI:10.1016/j.bbrc.2008.02.117 · 2.30 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Reversible phosphorylation of protein tyrosine residues by polypeptide growth factor-receptor protein tyrosine kinases is implicated in the control of fundamental cellular processes including the cell cycle, cell adhesion, and cell survival, as well as cell proliferation and differentiation. During the last decade, it has become apparent that receptor protein tyrosine kinases and the signaling pathways they activate belong to a large signaling network. Such a network can be regulated by various extracellular cues, which include cell adhesion, agonists of G protein-coupled receptors, and oxidants. It is well documented that signaling initiated by receptor protein tyrosine kinases is directly dependent on the intracellular production of oxidants, including reactive oxygen and nitrogen species. Accumulated evidence indicates that the intracellular redox environment plays a major role in the mechanisms underlying the actions of growth factors. Oxidation of cysteine thiols and nitration of tyrosine residues on signaling proteins are described as posttranslational modifications that regulate, positively or negatively, protein tyrosine phosphorylation (PTP). Early observations described the inhibition of PTP activities by oxidants, resulting in increased levels of proteins phosphorylated on tyrosine. Therefore, a redox circuitry involving the increasing production of intracellular oxidants associated with growth-factor stimulation/cell adhesion, oxidative reversible inhibition of protein tyrosine phosphatases, and the activation of protein tyrosine kinases can be delineated.
    Antioxidants and Redox Signaling 06/2008; 10(5):843-89. DOI:10.1089/ars.2007.1853 · 7.41 Impact Factor
Show more