Multiple, conserved cryptic recombination signals in VH gene segments: detection of cleavage products only in pro B cells.

Abstract

Receptor editing is believed to play the major role in purging newly formed B cell compartments of autoreactivity by the induction of secondary V(D)J rearrangements. In the process of immunoglobulin heavy (H) chain editing, these secondary rearrangements are mediated by direct V(H)-to-J(H) joining or cryptic recombination signals (cRSs) within V(H) gene segments. Using a statistical model of RS, we have identified potential cRSs within V(H) gene segments at conserved sites flanking complementarity-determining regions 1 and 2. These cRSs are active in extrachromosomal recombination assays and cleaved during normal B cell development. Cleavage of multiple V(H) cRSs was observed in the bone marrow of C57BL/6 and RAG2:GFP and microMT congenic animals, and we determined that cRS cleavage efficiencies are 30-50-fold lower than a physiological RS. cRS signal ends are abundant in pro-B cells, including those recovered from microMT mice, but undetectable in pre- or immature B cells. Thus, V(H) cRS cleavage regularly occurs before the generation of functional preBCR and BCR. Conservation of cRSs distal from the 3' end of V(H) gene segments suggests a function for these cryptic signals other than V(H) gene replacement.

Full text

Page 1

The Journal of Experimental Medicine
ARTICLE
JEM © The Rockefeller University Press $30.00
Vol. 204, No. 13, December 24, 2007 3195-3208 www.jem.org/cgi/doi/10.1084/jem.20071224
3195
Developmentally immature B cells expressing
autoreactive antigen receptors are tolerized by
three mechanisms: anergy, clonal deletion, and
receptor editing. Whereas anergy and deletion
inactivate or remove self-reactive clones, recep-
tor editing alters clonal specifi city through sec-
ondary rearrangements of the Ig ? and - ? loci, or
V H gene replacement ( 1 ). V H gene replacement
represents an atypical V(D)J recombination event
mediated by a physiological recombination sig-
nal (RS) adjacent to an upstream germline V H
gene segment and a cryptic RS (cRS) located
near the 3 ? end of a rearranged V H gene segment
( 2 – 4 ). In the Igh locus, the D gene segments lo-
cated between the V H and J H gene clusters are
doubly fl anked by RSs containing 12-bp spacers
(12-RS); these mediate recombination with the
23-RS of J H and V H gene segments ( 5 ). V H → DJ H
rearrangements that complete IgH assembly in
pro–B cells deplete the Igh locus of 12-RS ( 6 ) and
preclude subsequent rearrangements that follow
the 12/23 rule ( 5 ).
V H replacement alters the specifi city of the
B cell antigen receptor (BCR) and can rescue
developing B cells that would otherwise be elimi-
nated by apoptosis. Such replacements were fi rst
noted in mice with autoreactive, site-directed
transgene (SDT) receptors ( 3, 7 ), but replace-
ment of innocent ( 8, 9 ) or nonproductive ( 10 )
VDJ SDT has been observed as well. Presum-
ably, V H replacement in the absence of self-
reactivity is the consequence of strong selection
for a diverse B cell repertoire. Under an antigen-
dependent model of receptor editing, binding of
an autoantigen to an antigen receptor is required,
but pressure to diversify the B cell repertoire via
V H gene replacement is presumably antigen in-
dependent ( 3, 11, 12 ).
It is diffi cult to predict whether mouse V H
replacements are antigen dependent or inde-
pendent because the stage of normal B cell
develop ment at which V H replacements are ini-
tiated in vivo is unknown. Recently, signal ends
(SEs) at V H cRSs were noted in human imma-
ture B cells, but the cloned human V H replace-
ments included N-nucleotide additions, which
are characteristic of IgH rearrangement in pro–
B cells ( 11, 13 ). N-nucleotides are also noted ( 3 )
in mouse V H replacements, providing further
evidence that V H replacements may be induced
at the pro–B cell stage.
CORRESPONDENCE
Garnett Kelsoe:
ghkelsoe@duke.edu
Abbreviations used: BCR, B
cell antigen receptor; CDR,
complementarity determining
region; cRS, cryptic recombina-
tion signal; Cys, cysteine; FW,
Ig frame work region; LM,
ligation-mediated; RIC , RS
information content; RS, physi-
ological recombination signal;
SDT, site-directed transgene;
SE, signal end.
M. Davila and F. Liu contributed equally to this paper.
The online version of this article contains supplemental material.
Multiple, conserved cryptic recombination
signals in V H gene segments: detection
of cleavage products only in pro–B cells
Marco Davila, 1 Feifei Liu, 1 Lindsay G. Cowell, 2 Anne E. Lieberman, 2
Emily Heikamp, 1 Anjali Patel, 1 and Garnett Kelsoe 1
Departments of Immunology 1 and Biostatistics and Bioinformatics 2 , Duke University, Durham, NC 27710
Receptor editing is believed to play the major role in purging newly formed B cell compart-
ments of autoreactivity by the induction of secondary V(D)J rearrangements. In the process
of immunoglobulin heavy (H) chain editing, these secondary rearrangements are mediated
by direct V H -to-J H joining or cryptic recombination signals (cRSs) within V H gene segments.
Using a statistical model of RS, we have identifi ed potential cRSs within V H gene segments
at conserved sites fl anking complementarity-determining regions 1 and 2. These cRSs
are active in extrachromosomal recombination assays and cleaved during normal B cell
development. Cleavage of multiple V H cRSs was observed in the bone marrow of C57BL/6 and
RAG2:GFP and ? MT congenic animals, and we determined that cRS cleavage effi ciencies
are 30 – 50-fold lower than a physiological RS. cRS signal ends are abundant in pro–B cells,
including those recovered from ? MT mice, but undetectable in pre– or immature B cells.
Thus, V H cRS cleavage regularly occurs before the generation of functional preBCR and
BCR. Conservation of cRSs distal from the 3 ? end of V H gene segments suggests a function
for these cryptic signals other than V H gene replacement.

Page 2

3196
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
RESULTS
Identifi cation of potential cRSs in V H gene segments
We used a probabilistic model of mouse RSs ( 17 – 19 ) to scan
390 mouse V H gene segments for cRSs by computing the
RS information content ( RIC ) ( 19 ) for all possible 28- ( RIC 12 )
and 39-bp signals ( RIC 23 ). The RIC 12 and RIC 23 algorithms
are capable of identifying and evaluating physiological RSs
and cRSs directly from DNA sequence ( 17 – 19 ). A 212-kbp
region of chromosome 8 (AC084823) that is not subject to
physiological V(D)J recombination was similarly analyzed. RIC
scores approaching zero indicate increasing similarity to physio-
logical mouse RSs and higher recombination potentials ( 17 ).
All 28- and 39-bp DNA sequences beginning with a CA di-
nucleotide have a fi nite RIC score and are potential cRSs.
We previously determined that RIC 12 ≥ ? 40 constituted a
threshold value for physiological RS activity, and therefore we
expect RIC values for 12-cRSs to be lower ( 18 ). Indeed, a
known mouse V H cRS ( 3 ) has a RIC 12 of ? 45.3 ( 18 ). Thus, we
set a preliminary detection threshold for 12-cRSs as RIC 12 >
? 45. Physiological 23-RSs are identifi ed by RIC 23 > ? 60 ( 18 );
we selected a correspondingly lower threshold of RIC 23 > ? 65
for identifi cation of 23-cRSs.
Our scan identifi ed potential cRSs in both DNA strands.
cRSs in V H gene segments that share orientation with the
physiological V H RSs are defi ned to be in orientation 1 (O1).
V H cRSs in the opposite orientation are O2 cRSs. In our
analyses of AC084823, we arbitrarily defi ned putative cRSs
in the listed sequence as O1 cRSs and those in the comple-
mentary strand as O2 cRSs. The analyzed V H gene segments
contained 8,647 potential 12-cRSs and 8,312 potential 23-
cRSs in the O1 orientation (Table S1, available at http://
www.jem.org/cgi/content/full/jem.20071244/DC1). In O2,
these V H gene segments contained 8,976 and 8,109 poten-
tial 12- and 23-cRSs, respectively. Of these, only 223 (O1)
and 299 (O2) had RIC 12 > ? 45, and a smaller subset, 135
(O1) and 302 (O2), had RIC 23 > ? 65 (Table S1). In the
larger AC084823 sequence, 15,401 (O1) and 17,480 (O2) po-
tential 12-cRSs and 15,401 (O1) and 17,478 (O2) potential
23-cRSs were identifi ed (Table S1). Among these, 259 (O1)
and 321 (O2) 12-cRSs had RIC 12 > ? 45, and 701 (O1) and
837 (O2) 23-cRSs had RIC 23 > ? 65 (Table S1). Potential
12-cRSs with RIC 12 > ? 45 were signifi cantly less frequent in
the AC084823 sequence than in V H gene segments (0.017 vs.
0.026 [O1]; P = 10 ? 6 and 0.018 vs. 0.033 [O2]; P = 10 ? 14 ;
Table S1). In contrast, the relative frequencies of potential 23-
cRSs with RIC 23 > ? 65 in the AC084823 sequence (0.05
[O1 and O2]) were signifi cantly higher than in V H gene seg-
ments (0.02 [O1] and 0.04 [O2]; P = 10 ? 31 and P = 10 ? 4 ,
respectively; Table S1).
Whereas V H gene segments and the control AC084823
sequence have similar relative frequencies of potential cRSs
with low RIC scores, as RIC scores increase toward threshold
values, these frequencies diverge. Potential 12-cRSs with
RIC 12 > ? 50 are more common in V H gene segments, and
potential 23-cRSs with RIC 23 > ? 70 are present at higher fre-
quencies in the AC084823 control ( Fig. 1, A and B ). Given
In this study, we use a rigorous statistical method to dem-
onstrate conserved cRSs in mouse V H gene segments and fi nd
that these cRSs exhibit an orientation and spacer length that
facilitates V H → V H rearrangements. We demonstrate RAG1-
dependent cleavage of mouse V H cRSs at multiple locations,
including conserved sites in FW1 and -2 during normal B cell
development. We speculate that these anterior cRSs may
create hybrid V H gene segments ( 14, 15 ). Although V H cRS
SEs have been detected in the BM and spleen of genetically
modifi ed mice ( 16 ), we show that V H cRS SEs are routinely
generated by normal mouse pro–B cells, but are undetectable
in pre and immature B cells. This observation is in contrast
to that reported for human B cell development ( 11 ), and
suggests a model of B cell development characterized by sto-
chastic rearrangements of RSs and cRSs, followed by selec-
tion for functional heavy chain. This random rearrangement
hypothesis implies that V H cRSs are conserved to increase V H
genetic diversity ( 2 ), rather than for receptor editing in re-
sponse to self-antigens.
Figure 1. The proportion of RS-length sequences with RIC scores
above a given threshold. The number of RS-length sequences with RIC
greater than the score indicated on the x axis was divided by the number
of all RS-length segments begining with CA. The resulting proportion is
indicated on the y axis. Results for 28-bp segments (top) and for 39-bp
segments are shown (bottom). Filled circles ( ? ) indicate the proportion
for segments in the orientation of physiological RS (O1), and open trian-
gles ( ? ) indicate the proportion in the opposite orientation (O2). Orienta-
tion was assigned arbitrarily for the chromosome 8 sequence. Solid lines
indicate proportions computed on V H gene segments; dashed lines indi-
cate segments from chromosome 8.

Page 3

JEM VOL. 204, December 24, 2007
ARTICLE
3197
( Fig. 2 ). Locations of the remaining 59 potential 12-cRSs were
less well conserved, but the majority (71%; 42/59) cluster into
three regions (sites II [nt 100 – 126], III [nt 148 – 184], and IV
[nt 190 – 205]) that mark the borders of complementarity-
determining region (CDR) 1 and 2 ( Fig. 2 ).
Previously, we identifi ed a 12-cRS with RIC 12 = ? 48.2
that was active in extrachromosomal rearrangement ( 18 ). The
numbers of O2 12-cRSs in V H gene segments with RIC 12 ≥
? 48.2 are double that for RIC 12 = ? 45 (631 vs. 299). None-
theless, 95% (599/631) remain clustered within sites I ? V
( Fig. 2 ). That the distributions of both stringent and relaxed
12-cRSs are highly similar suggests a common mechanism
for their conservation.
Our search revealed that potential 12-cRSs were broadly
distributed among V H gene families; at least one V H segment
from 12 of the 15 V H gene families contained 1 or more 12-
cRSs. 12-cRSs were, however, most abundant in the V H 1
and V H 5 gene families, with 151 and 56 cRSs, respectively.
The presence and conserved locations of multiple 12-cRSs
in many V H gene families suggests that natural selection main-
tains V H 12-cRSs, even in locations that cannot support
V H → VDJ replacements of the type mediated by site V cRSs
( Fig. 2 ).
Selection for V H cRSs is independent of
amino acid conservation
The presence in V H gene segments of near consensus hep-
tamers without obvious nonamers led Wu et al. to speculate that
that physiological V(D)J recombination does not occur within
the AC084823 region of chromosome 8, we interpret these
divergent frequencies to indicate evolutionary enrichment for
12-cRSs in V H gene segments, accompanied by the selective
removal of potential 23-cRSs.
V H 12-cRSs are conserved in O2
To determine if V H 12-cRSs with RIC 12 > ? 45 are con-
served in a preferred orientation, we compared the frequen-
cies of O1 and O2 putative 12-cRSs in V H gene segments and
in AC084823. Whereas the relative frequencies of O1 and O2
12-cRSs in the AC084823 sequence are virtually identical
(0.017 and 0.018, respectively; P = 0.288), the relative fre-
quency of O2 12-cRSs is signifi cantly higher (0.033) than O1
12-cRSs (0.026; P = 0.003) in V H gene segments (Table S1
and Fig. 1 A ). V H 12-cRSs with lower RIC 12 scores ( ≤ ? 55)
have similar relative frequencies in O1 and O2. As RIC 12
scores increase ( ≥ ? 55), however, O2 12-cRSs become more
common than those in O1 orientation (P = 0.052). This bias
for V H 12-cRSs in the O2 orientation suggests selection for
V H gene segments containing 12-cRSs oriented opposite up-
stream physiological V H 23-RSs.
Conservation of multiple cRSs in diverse V H gene segments
Of the 299 V H 12-cRSs with RIC 12 > ? 45 and O2 orientation,
? 80% were located at nucleotide 57 (51/299) or at nucleotide
313 (189/299; Fig. 2 ). We identify these most highly conserved
cRSs as sites I (nt 54 – 63) and V (nt 310 – 313), respectively
Figure 2. O2 cRSs are found at multiple locations within mouse V H gene segments. RIC 12 was computed for all 28-bp segments embedded
in mouse V H gene segments. RIC 12 scores of potential cRSs ( RIC 12 > ? 55) are plotted against the segment ’ s nucleotide position (IMGT numbering).
Open circles ( ? ) indicate potential 12-cRSs and filled circles ( ? ) indicate those segments with RIC 12 > ? 48.2, the lowest RIC 12 for which we have
detected extrachromosomal recombination ( 18 ). Locations of CDR1, -2, and -3 are shown by the shaded areas of the graphs. Roman numerals
indicate clusters of cRSs that are conserved across V H gene families. Site I spans amino acid residues 18 – 22 (nt 54 – 63); site II spans amino acid
residues 34 – 42 (nt 100 – 126); site III spans residues 50 – 62 (nt 148 – 184); site IV spans residues 64 – 69 (nt 190 – 205); and site V is amino acid
residue 105 (nt 313).

Page 4

3198
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
GTA or GTT ( Table I ). Other Val residues are conserved
in mouse V H gene segments, e.g., Val 2 (nt 6; 326/390), Val 13
(nt 39; 328/390), Val 42 (nt 126; 318/390), and Val 80 (nt 240;
141/390). Although a majority (54% [596/1,113]; range 0 – 89%)
of these conserved Val residues are encoded by GTG, codon
bias at Val 19 is signifi cantly (P = 10 ? 16 ) higher. Importantly,
none of the other conserved Val residues, including those
encoded by GTG, is associated with O2 12-cRS ( Fig. 2 ). We
conclude that conservation of the structural motifs implicit in
conserved Val residues is insuffi cient to specify cRSs.
V H 12-cRSs function in extrachromosomal recombination
assays
Replacement rearrangements at cRSs upstream of site V 12-
cRSs would result in signifi cantly longer V H domains and
might result in suboptimal or nonfunctional IgH polypeptides.
If this were the case, we would expect evolutionary selection
to suppress the recombinational capacity of the potential cRSs
in sites I – IV ( Fig. 2 ). Therefore, we compared the recombina-
tional capacities of 8 12-cRSs at sites I, III, IV, and V in an
extrachromosomal recombination assay (see Materials and
methods) ( 18 ). Additionally, we measured the recombination
potential of a single 12-cRS located in FW3 ( Table II ). As a
control, a known (site V) cRS present in the 3H9 H-chain
transgene ( 3 ) was included in our analysis ( Table II ). Recom-
binational activities of these cRSs were normalized to a phy-
siological standard, the J ? 2-2 12-RS ( 18 ).
Of the 8 12-cRSs tested, fi ve supported low, but detect-
able, levels of recombination ( Table II ). 12-cRSs from sites I,
III, IV, and V performed comparably, with one signal from
each cohort mediating recombination at effi ciencies of 1 – 2%
of that observed for the J ? 2-2 signal ( 18 ). One cRS (p290-
V H /60) not located in the conserved sites, but in FW3, also
exhibited detectable recombinational activity. In contrast, ac-
tivity by the 3H9 12-cRS control could not be detected,
even though this cRS is active in vivo ( 3 ). Failure to detect
recombination of the 3H9 cRS indicates that the extrachro-
mosomal recombination assay underestimates cRS activity.
Interestingly, the ability of cRSs to support detectable levels
of recombination could be determined by only a few nucleo-
tides, although the site I cRSs (p290-V H /199 and p290-V H /241)
diff er by only two nonamer nucleotides, only one (p290-V H /199)
supported detectable levels of recombination ( Table II ). Sim-
ilarly, the two cRSs from site V diff ered by only a single ex-
change in the heptamer, but this diff erence was suffi cient to
abrogate activity in p290-V H /09 ( Table II ).
V H cRS SEs are detectable only in pro–B cells
To determine whether the V H 12-cRSs identifi ed by our
screen are cleaved during normal B cell development, we used
a ligation-mediated PCR (LM-PCR) to amplify RS and
cRS SEs ( 11, 18 ) in pro–B (B220 lo IgM ? IgD ? CD43 + GFP + ),
pre–B (B220 lo IgM ? IgD ? CD43 ? GFP + ), and immature B cells
(B220 + IgM + IgD ? CD43 ? ) from RAG2:GFP +/+ mice ( Fig. 3 A )
( 21 ). RAG2:GFP mice express a RAG2:GFP fusion protein
that supports V(D)J recombination and exhibits the kinetics
embedded heptamers at sites I and V ( Fig. 2 ) might refl ect the
conservation of cysteine (Cys) residues critical for BCR struc-
ture rather than selection for recombinogenic potential ( 2 ).
Cysteine is encoded by TGT or TGC codons. Heptamer
motifs within the highly conserved site V 12-cRS result from
the combination of codons 104 and 105 (IMGT numbering;
Fig. 2 ). In the great majority (86%) of mouse V H gene segments,
cysteine (TGT) at residue 104 is followed by Ala (GCN;
225/283), Val (GTN; 15/283), Glu (GAA/G; 1/283), or Gly
(GGN; 1/283; IMGT database). These conserved associations
generate the GTG (or CAC) motif (...TGTGNN...) required
for cRS heptamers ( 18 ).
Substitution of TGC for TGT at position 104 would
maintain the cysteine residue, but abrogate any recombina-
tion activity at site V cRSs by destroying the heptamer motif
(...TGCGNN...). To determine if the TGT codon necessary
for site V 12-cRS is conserved independently of the Cys 104
residue, we compared codon usage at this and another highly
conserved cysteine residue in V H , Cys 23 ( Table I ). In contrast to
Cys 104 , Cys 23 does not overlap any potential 12-cRSs ( Fig. 2 ),
although both are necessary for IgV domain structure ( 20 ).
Whereas 98% (287/292) of Cys 104 residues are encoded by
TGT, only 38% (113/297) of Cys 23 codons are encoded by
TGT ( Table I ). The highly signifi cant (P < 10 ? 54 ) preference
for TGT codons at Cys 104 , but not Cys 23 , suggests selection
for site V recombinogenic sequence that is independent of the
amino acids necessary for BCR structure.
Similarly, the conserved site I 12-cRSs at nt 57 ( Fig. 2 ) are
associated with a Val residue (amino acid residue 19) pre-
sent in 56% (218/390) of V H gene segments screened in our
analyses. Of these 218 Val residues, 183 (84%) are encoded by
a GTG codon that initiates the cryptic heptamer; of the other
Val 19 residues, 24 (11%) are encoded by GTC and 11 (5%) by
Table I. Biased codon usage associated with V H 12-cRS at
sites I and V
V H cysteine codon usage
TGT TGC
253
Totals
382
292
Cys 23
Cys 104
V H valine codon usage
129 (34%)
287 (98%)5
GTGGTC
148
GTA
10
26
GTT
37
Totals
326
328
218
318
141
Val 2
Val 13
Val 19
Val 42
Val 80
131 (40%)
292 (89%)
183 (84%)
173 (54%)
0 (0%)
37
2 24
42
0
9
28 75
2 139
V H cRSs are frequently conserved within degenerate codons; site V cRSs are
associated with a conserved Cys 104 residue (TGY codon); and a common site I cRS
requires Val 19 (GTN). The frequency of T and C nucleotides in the third position of
cysteine codons (TGY) at V H gene segment codons 23 and 104 (top), and the
frequency of nucleotides in valine codons (GTN) at V H gene segment codons 2, 13,
19, 42, and 80 (bottom) were compared. Numbers of relevant cysteine (TGY) or
valine (GTN) codons in the mouse V H gene segments ( n = 390) analyzed are shown,
and frequencies of TGT (Cys) and GTG (Val) codons are in parentheses. Totals
represent the numbers of V H gene segments containing a conserved residue.

Page 5

JEM VOL. 204, December 24, 2007
ARTICLE
3199
that did or did not express RAG1. Pro–B (B220 lo CD43 + IgM ? )
and pre–B cells (B220 lo CD43 ? IgM ? ) were isolated from sib-
ling IgH transgenic (H50G) mice ( 24 ) that were RAG1 suf-
fi cient (H50G +/ ? Rag1 +/ ? ) or defi cient (H50G +/ ? Rag1 ? / ? ;
Fig. 4 A ). Flow cytometric resolution of pro- and pre–B cells
in H50G mice was less distinct than in RAG2:GFP animals,
presumably because the H50G transgene accelerates preBCR
expression and transition to the pre–B cell phenotype (com-
pare Figs. 3 and 4 ).
J H 2 SEs were readily demonstrated in both pro- and pre–
B cells from RAG1-suffi cient mice, but could not be ampli-
fi ed from the DNA of RAG-defi cient animals ( Fig. 4 B ).
Signifi cantly, even though strong allelic exclusion is observed
in H50G mice ( 24 ), the H50G IgH transgene does not abro-
gate RS cleavage in the endogenous loci ( Fig. 4 B ), a fi nding
similar to that of Chang et al. ( 25 ). We presume that the gen-
eration of J H 2 SEs results from RAG1/2 expression that is in-
completely suppressed by the H50G transgene. Similarly, J ? 2
SEs were recovered from H50G +/ ? Rag1 +/ ? pre–B cells, but
not from the analogous phenotypic compartment of H50G +/ ?
Rag1 ? / ? mice ( Fig. 4 B ).
The presence of J H and J ? SEs demonstrates that the
endogenous Igh and Ig ? loci of H50G +/ ? Rag1 +/ ? mice are
accessible to recombinase activity; and, accordingly, we were
able to recover V H 1 cRS SEs from pro–B and pre–B cells
from H50G +/ ? Rag1 +/ ? , but not H50G +/ ? Rag1 ? / ? , mice
( Fig. 4 B ). Thus, LM-PCR amplifi cation of both RS and
cRS SE product is equivalently dependent on V(D)J recom-
binase activity.
of authentic RAG2 ( 21 ). To enrich these developing popu-
lations for recombinase activity, we isolated GFP + pro- and
pre–B cells; GFP + immature B cells were suffi ciently rare
( < 1%) to require the pooling of GFP + and GFP ? immature
B cells. In addition, Tdt and RAG1 expression in the sorted
cell cohorts were determined by RT-PCR ( Fig. 3 B ).
As previously reported, signifi cant GFP fl uorescence
was detected in both pro- and pre–B cells ( 21 ), as was the
message for RAG1 and Tdt ( Fig. 3 ) ( 22, 23 ). In contrast,
immature B cells did not express detectable levels of Tdt or
RAG1 ( Fig. 3 ) ( 21 – 23 ). RAG2:GFP fl uorescence could be
ordered among the sorted B cell populations with GFP +
pro–B cells being brightest and immature B cells being dull-
est ( Fig. 3 ) ( 21 ).
Detection of RS and cRS SE was restricted by lineage-
and stage of development. SEs from the physiological RS of
V H 5 and J H 2 were detected only in pro–B cells; J ? SEs were
detected in pre–B cells, but not in pro–B or immature B
cells; and Tcr D ? SEs were not present in any B cell popula-
tion ( Fig. 3 C ). LM-PCR products of the size predicted for
V H 12-cRS SEs could be amplifi ed from the DNA of pro–B
cells and hybridized with 32 P-labeled V H -specifi c probes ( Fig. 3 ).
In support of our computational screen for V H cRSs, we de-
tected cRS SEs with primers specifi c for the V H 1, V H 2, and
V H 5 gene families ( Fig. 3 ).
V H cRS SEs require recombinase activity
To demonstrate that the cRS SEs were dependent on RAG1/2
activity, we amplifi ed V H 1 cRS SEs from IgH transgenic mice
Table II. Activity of V H 12-cRS in an extrachromosomal recombination assay
cRS SiteVectorPosition cRS sequence V H familyR
[ RIC 12 ]
Effi ciency
%
% J ? 2-2
2.2%I p290-VH/19957CACTGAA GCCCCAGGCTTC AC C AG T TCA1 0.02 ± 0.01
[ ? 42.5]
< 0.005
[ ? 38.8]
0.01 ± 0.01
[ ? 44.0]
< 0.005
[ ? 42.4]
0.02 ± 0.02
[ ? 43.8]
0.01 ± 0.01
[ ? 38.9]
< 0.005
[ ? 41.2]
0.02 ± 0.01
[ ? 43.0]
< 0.002
[ ? 45.3]
I p290-VH/24157CACTGAA GCCCCAGGCTTC AC A AG C TCA 1 < 0.6%
III p290-VH/87 181CACTATT AGGATCAATCCT TCAAATCCA 1 1.1%
IVp290-VH/69205 CAC T GTA CTTAATA T CA C T AT A AGG AT C 1 < 0.6%
IV p290-VH/118 198CAC A GTA TAACCAT T TC C A GG A TAA AT A 12.2%
V p290-VH/06313CACA G TA ATAGACCGCAGA GTCCTCAGA 10.9%
V p290-VH/09313CACA A TA ATAGACCGCAGA GTCCTCAGA 1 < 0.6%
FW3 p290-VH/60259CACTGCT TTTTGAATCATC TCTTGAAAT 132.2%
V CNTL p290-3H9 313CACAGAA GTAGACCGCAGA GTCCTCAGA 1 < 0.2%
The recombination effi ciencies of several V H cRSs were calculated by a standard extrachromosomal assay ( 18 ). All cRS sequences were embedded in V H 1 gene segments, except
for p290-VH/60, which comes from the V H 13 gene family. The nt position of each cRS is noted. R was calculated as the normalized ratio of amp’cam’ to amp’ bacterial
colonies (see Materials and methods). cRS spacer sequences (italicized) are fl anked by cryptic heptamers (left) and nonamers (right). Sequence differences between cRSs from
the same sites (I, IV, and V) are in bold. The p290-3H9 substrate was included because this cRS has been observed to be functional in vivo ( 3 ).

Page 6

3200
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
(B220 + CD43 ? IgM + IgD ? ) B cells from C57BL/6 controls to
LM-PCR for V H cRS SEs ( Fig. 5 A ).
V H 1 cRS SEs were easily demonstrated in the pro–B cell
compartments of both ? MT and C57BL/6 mice ( Fig. 5 B ).
In contrast, V H 1 cRS SEs were undetectable in equivalent
samples of pre–B or immature B cells from C57BL/6 controls
( Fig. 5 B ). These fi ndings demonstrate that, at least in mice, V H
V H cRS SEs in ? MT pro–B cells
? MT mice cannot generate functional preBCR and are un-
able to support B cell development beyond the pro–B cell
stage ( 26 ).To determine whether the preBCR is required for the
generation of V H cRS SEs, we subjected genomic DNA from
pro–B cells (B220 + CD43 + IgM ? IgD ? ) from ? MT mice and
from pro–, pre– (B220 + CD43 ? IgM ? IgD ? ), and immature
Figure 3. V H cRS cleavage is detected only in pro–B cells from RAG2:GFP knock-in mice ( 21 ). (A) Sorted pro-, pre, and immature B cells were
analyzed by RT- and LM-PCR. Mature, recirculating B cells (+IgD) were removed by incubation with anti-IgD (-IgD). RAG2:GFP fl uorescence was detected
in pro- and pre–B cells, but not in immature B cells. (B) RT-PCR for Rag1, Tdt, and GAPDH transcripts revealed RAG1 message in both pro–B and pre–B
cells; Tdt expression was detected only in sorted pro–B cells. (C) LM-PCR for primary J H , V H , J ? , and D ? rearrangements demonstrate the lineage and
developmental restriction of V H cRS SEs, and confi rms the purity of the sorted cell populations. V H 1, V H 2, and V H 5 cRS SEs were detected only in pro–B cells.
CD14 PCR demonstrated the equivalence of genomic template.

Page 7

JEM VOL. 204, December 24, 2007
ARTICLE
3201
SEs and J H 2 RS SEs in pro–B cells (B220 lo CD43 + IgM ? IgD ? )
from C57BL/6 mice ( Fig. 6 ).
Using our standard LM-PCR, J H 2 RS SE and V H 1 cRS SE
products from 10 3 pro–B cells appeared linear between 20 and
30 amplifi cation cycles ( Fig. 6, A and B ). Accordingly, samples
of V H 1 cRS and J H 2 RS SE product generated by 25 rounds
of amplifi cation were titrated by serial threefold dilutions and
blotted for hybridization ( Fig. 6 C ). This semiquantitative ap-
proach indicates that in genomic DNA isolated from pro–B
cells, J H 2 RS SEs are greater than or equal to threefold more
abundant than V H 1 cRS SEs. The primer set for J H 2 is, how-
ever, specifi c for only one gene segment, whereas the V H 1
cRS SEs are generated in the absence of normal preBCR sig-
naling and without the possibility of retrograde diff erentiation
by pre– or immature B cells ( 3, 11 ).
In vivo, V H cRS SE formation is ? 5% the effi ciency of J H 2
RS SEs
In our hands, the LM-PCR for V H cRS SEs is capable of detect-
ing SE products in as few as 10 3 pro–B cells ( Fig. 4 ), even though
the effi ciencies of selected V H cRSs are low in extrachromo-
somal recombination assays ( Table II ). To estimate the recom-
bination effi ciencies of V H cRSs in the context of normal B cell
development, we compared the relative amounts of V H 1 cRS
Figure 4. V H cRS cleavage is dependent on Rag1. (A) BM B cells with a pro–B phenotype (B220 lo CD43 + IgM ? Lin ? ) and a pre–B phenotype
(B220 lo CD43 ? IgM ? Lin ? ) were sorted from sibling H50G +/ ? Rag1 +/ ? (middle) or H50G +/ ? Rag1 ? / ? (right) mice. Resolution of pro- and pre–B cells in
H50G transgenic mice was not as complete as in RAG2:GFP mice ( Fig. 3 A ). Mature and immature B cells (+IgM) were excluded when anti-IgM was
used as a negative marker (-IgM). (B) LM-PCR demonstrated SEs at both physiological RSs (J H 2, J ? 2) and cRSs (J558) were present only in RAG1/2-
suffi cient cells.

Page 8

3202
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
V H 5 ([2 ? 0.90 ÷ 7] × 100% = 7.6%) gene segments was 5 – 8% of
the J H 2 RS.
Recombinase cleavage at multiple V H cRSs
To identify specifi c V H cRS cleavage events and to compare
their frequencies, we cloned and sequenced V H cRS SE PCR
products recovered from pro–B cells of ? MT, RAG2:GFP,
and C57BL/6 mice. 33 unique and independent V H cRS SE
fragments representing 28 V H 1 and a single V H 5 gene seg-
ment were obtained; 94% (31/33) of these represented cleav-
age events at cRS sites I, II, III, or V ( Table III and Fig. 2 ).
Two SE products, one from RAG2:GFP and another from
? MT pro–B cells, represented cleavage at a conserved FW3
site; no cleavage products from the predicted cRSs at site IV
were recovered ( Table III ). Two V H gene segments were
shown to contain two functional cRSs; V H 1S2*01 produced
site I and III SE products and V H 1S130*01 supported cleav-
age at site III and in FW3 ( Table III ). Thus, in addition to the
site V cRSs that are thought to be conserved for receptor ed-
iting ( 3, 27 ), we have identifi ed other V H cRSs at nucleotide
positions 57 (site I), ? 122 (site II), ? 155 (site III), ? 181 (site III),
and ? 267 (FW3), that are cleaved during normal B cell
primer set amplifi es ? 34 distinct V H 1 gene segments listed
in the IMGT database (unpublished data). Therefore, we esti-
mate that the abundance of any single V H 1 cRS SE is 1 – 3%
([1.00 to 0.33 ÷ 34] × 100%) of J H 2 RS SE, an estimate that
is comparable to V H cRS effi ciencies determined in extrachro-
mosomal assays ( Table II ).
Estimates for the abundance of V H cRS SEs in pro–B cells
were also obtained by quantitative LM-PCR amplifi cations
using the J H 2-, V H 1-, and V H 5-specifi c primer sets ( Fig. 6 D ).
In three independent experiments, the averaged threshold
cycle numbers (C T ) for J H 2 ( n = 11), V H 1, and V H 5 ( n = 6 for
both) were 26.30 ( ± 0.59), 25.57 ( ± 0.98), and 27.20 ( ± 1.33),
respectively. Measured in this way, the abundance of cRS
SEs from individual V H 1 ([2 0.73 ÷ 34] × 100% = 4.9%) and
Figure 5. V H cRS SEs from C57BL/6 and ? MT pro–B cells. (A) BM
B cells were recovered from C57BL/6 and ? MT mice and pro-, pre, and imma-
ture B cells (from C57BL/6), or pro–B cells (from ? MT) mice were sorted as
in Fig. 3 . Genomic DNA was isolated and ligated to the BW linker. (B) LM-PCR
on genomic DNA of sorted B cell populations from C57BL/6 or ? MT mice
was performed to detect V H cRS SEs. cRS SEs were found only in cells with a
pro–B phenotype. CD14 PCR was used to normalize template DNA.
Figure 6. V H 1 cRSs are cleaved at 1 – 7% the effi ciency of the J H 2
RS. (A) Titration of nested LM-PCR cycle numbers (15 – 35) to optimize
comparison of J H 2 RS SE (top) and V H 1 cRS SE (bottom) products. LM-PCR
of J H 2 RS SEs and V H 1 cRS SEs were resolved by gel electrophoresis and
hybridized with gene-specifi c probes. (B) Densitometric analysis of the
hybridized LM-PCR products showed that 25 cycles constitute the linear
phase of amplifi cation. Circles ( ? ) and triangles ( ? ) indicate the densi-
tometry of J H 2 RS SEs and V H 1 cRS SEs, respectively. (C) Serial threefold
template dilution demonstrates that J H 2 RS SEs (top) are less than or
equal to threefold more abundant than V H 1 cRS SEs (bottom). (D) Relative
abundance of J H 2 RS SEs and V H cRS SEs determined by real-time quanti-
tative PCR. J H 2 RS SEs and V H 1 and V H 5 cRS SEs were amplifi ed from the
BM cells of C57BL/6 mice in a series of quantitative LM-PCR. cRS SE pro-
ducts were normalized to J H 2 RS SE product (the mean ± the SD) from the
same sample by the comparative threshold cycle method. Subsequently,
V H cRS cleavage effi ciencies were adjusted to template numbers (J H 2 = 1;
V H 1 = 34; V H 5 = 7). The mean effi ciency of V H 1 cRSs was determined to be
4.9 ± 0.2% of the J H 2 RS, whereas VH5 cRSs were 7.6 ± 0.3% as effi cient.

Page 9

JEM VOL. 204, December 24, 2007
ARTICLE
3203
IgH variable region lengthened by as many as 50 amino acids
and containing 4, not 3, hypervariable regions. We doubt that
such IgH polypeptides could generate functional preBCR or
BCR. Nonetheless, site III cRSs are conserved in mouse V H
gene segments ( Fig. 2 ) and are the most frequently cleaved
during normal B cell development ( Table III ). We conclude
that the conservation of V H cRSs is not solely driven by their
ability to mediate functional V → VDJ replacements.
DISCUSSION
V H replacement is the insertion of a V H gene segment into a
formed V H DJ H joint ( 28 ) by the RAG1/2 recombinase acting
on the physiological 23-RS of the invading V H segment and
a so-called cryptic heptamer present near the 3 ? border (posi-
tion 313) of many V H gene segments ( 2 ). Whereas this spe-
cifi c form of IgH editing has been observed in vivo ( 3, 10 ),
additional forms of V H replacement and/or secondary re-
arrangement have been observed in cell lines ( 14, 29, 30 ).
development ( Table III ). Unexpectedly, site III SE products
were most frequently recovered; site III cRS SE products
were threefold more common than site V SE products (18 vs.
6, respectively), the next largest group.
The cRS SE products were readily recovered from ? MT
mice, demonstrating that preBCR signaling is not required for
cRS cleavage ( Table III ). Indeed, the SE products from pre-
BCR-defi cient ? MT mice ( n = 15) and mice that express
preBCR (C57BL/6 and RAG:GFP; n = 18) mice were simi-
larly distributed, with site III SE products predominant in
both (11/15 and 11/18, respectively). Comparable numbers
of site I/II, FW3, and site V cleavage products were recovered
from preBCR-defi cient and -suffi cient pro–B cells as well,
suggesting that V H cRS cleavage may be active during the
V H → D H J H stage of B cell development ( Table III ). V → VDJ
replacements at the site V cRSs ( Fig. 2 ) retain only 1 – 3 amino
acids from the edited V H gene segment ( 3, 27 ). In contrast, a
V → VDJ replacement using a site III cRS would result in an
Table III. Conserved cRSs from multiple V H gene segments are cleaved in pro–B cells from RAG2:GFP, C57BL/6, and ? MT mice
Position
(nt) site
cRS V H gene V H cRS sequenceMouse strain
57
122
122
155
155
155
155
155
155
155
155
155
155
155
155
155
155
155
155
155
181
267
267
313
313
313
313
313
313
I
II
II
III
III
III
III
III
III
III
III
III
III
III
III
III
III
III
III
III
III
-
-
V
V
V
V
V
V
IGHV1S2*01
IGHV1-56*02
IGHV1S132*01
IGHV1-14*01
IGHV1-22*01
IGHV1-39*01
IGHV1-54*01
IGHV1-55*01
IGHV1-63*01
IGHV1-67*02
IGHV1S1*01
IGHV1S2*01
IGHV1S10*01
IGHV1S25*01
IGHV1S30*01
IGHV1S32*01
IGHV1S55*01
IGHV1S70*01
IGHV1S95*01
IGHV1S130*01
IGHV1-64*01
IGHV1S14*01
IGHV1S130*01
IGHV1-4*01
IGHV1-19*01
IGHV1-48*02
IGHV1-60*01
IGHV1S126*01
IGHV5-6-2*01
TCCAACTGCAGCAGCCTGGGGC TGAGCTTGT GAAGCCTGGGGC TTCAGTG
ATATCCTGCAAGGCTCCTGGCT ACACCTTCA CCAGCCACTGGA TGCAGTG
CTGTCCTGCAAGACTTCTGGCT ACACCTTCA CCAGCTACTGGA TTCAGTG
AGCTATGTTATGCACTGGGTGA AGCAGAAGC CTGGGCAGGGCC TTGAGTG
GACTACAACATGCACTGGGTGA AGCAGAGCC ATGGAAAGAGCC TTGAGTG
GGCTACACCATGAACTGGGTGA AGCAGAGCC ATGGAAAGAACC TTGAGTG
AATTACTTGATAGAGTGGGTAA AGCAGAGGC CTGGACAGGGCC TTGAGTG
AGCTACTGGATAAACTGGGTGA AGCTGAGGC CTGGACAAGGCC TTGAGTG
AACTACTGGATAGGTTGGGTAA AGCAGAGGT CTGGACATATAC ATGGGTG
GATTATGCTATGCACTGGGTGA AGCAGAGTC ATGCAAAGAGTC TAGAGTG
AGCTACTGGATGCACTGGGTGA AGCAGAGGC CTGGACGAGGCC TCGAGTG
AGCTACTGGATGCACTGGGTGA AGCAGAGGC CTGGACGAGGCC TTGAGTG
ACCTACTGGATGAACTGGGTGA AGTAGATGC CTGGACAGGGCC TTGAGTG
GAGTATATTATACACTGGGTAA AGCAGAGGT CTGGACAGGGTC TTGAGTG
AGCTACTACATGCACTGGGTGA AGCAGAGCC ATGGAAAGAGCC TTGAGTG
AGCTACTATATACACTGGGTGA AGCAGAGGC CTGGACAGGGAC TTGAGTG
AGCTCCTGGATGAACTGGGTGA AGCAGAGGC CTGGACAGGGAC TTGAGTG
AGCTACTGGATAAACTGGGTGA AGCAGAGGC CTGGACAAGGCC TTGAGTG
AGCTACTGGATGCACTGGGTGA AGCAGAGGC CTGGACAAGGCC TTGAGTG
AGCTCCTGGATGCACTGGGCGA AGCAGAGGC CTGGACAAGGCC TTGAGTG
GAGGCCTGGACAAGGCCTTGAG TGGATTGGA ATGATTCATCCT AATAGTG
AGGGCAAGGCCACAATGACTGT AGACACATC CTCCAGCACAGC CTACGTG
AGGGCAAGGCCACACTGACTGT AGACACATC CTCCAGCACAGC CTACGTG
CATGCAACTGAGCAGCCTGACA TCTGAGGAC TCTGCAGTCTAT TACTGTG
CATGGAGCTCAACAGCCTGACA TCTGAGGAC TCTGCGGTCTAT TACTGTG
CATGGAGCTCAGCAGCCTGACA TCTGAGGAC TCTGCAGTCTAT TACTGTG
CATGCAGCTCAGCAGCATGACA TCTGAAGCC TCTGATGACTAT TACTGTG
CATGCAGCTCAGCAGCCTGACA TCTGAGGAC TCTGCGGTCTAT TACTGTG
CCTGCAAATGAGCAGTCTGAAG TCTGAGGAC ACAGCCTTGTAT TACTGTG
RAG2:GFP
μ MT
μ MT
μ MT
C57BL/6
C57BL/6
μ MT, C57BL/6
RAG2:GFP
RAG2:GFP
μ MT
RAG2:GFP
RAG2:GFP
μ MT, C57BL/6
μ MT
μ MT
μ MT
C57BL/6
μ MT
μ MT, RAG2:GFP
μ MT
μ MT, C57BL/6
RAG2:GFP
μ MT
C57BL/6
μ MT
C57BL/6
C57BL/6
C57BL/6
RAG2:GFP
The positions and sequences of V H 12-cRS SEs recovered from pro–B cells sorted from the BM of ? MT, RAG2:GFP, or C57BL/6 mice are listed. Recovered V H 1 and V H 5 SE LM-PCR
products were cloned into the pCR2.1TOPO vector and sequenced. Ligation of the BW-LC linker directly to the cRS heptamer confi rmed RAG1/2-mediated cleavage. The
sequences were processed in Vector NTI and analyzed by the IMGT database (http://imgt.cines.fr) and Immunoglobulin BLAST (http://www.ncbi.nlm.nih.gov/igblast) for gene
identifi cation. A variety of V H gene segments contain functional cRSs, and most SE products represent site III cRSs. Heptamer and nonamer sequences of V H 12-cRS are in bold.

Page 10

3204
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
mosomal recombination assays signifi cantly aff ect cRS cleav-
age in situ.
V H cRS SEs are RAG1 dependent ( Fig. 4 ), and they are
independent of preBCR signaling ( Fig. 5 ). The presence of V H
cRS SEs in the pro–B cells of ? MT mice demonstrates that
IgH replacement can occur well before the developing B cell
is capable of recognizing antigen in any form ( 3 ). Similarly, in
BL/6 and RAG2:GFP mice, V H cRS SEs could be detected
only in pro–B cells ( Fig. 3 ). In H50G transgenic mice, cRS SEs
were present in both pro–B and pre–B cells ( Fig. 4 ), but we
note that J H 2 SEs were also abundant in the pre–B cells of these
IgH transgenic animals ( 24 ). We conclude that the phenotypic
pre–B compartment of H50G mice includes cells that actively
rearrange the endogenous Igh loci. In no case were we able to
detect V H cRS SEs in immature B cells, the earliest B lineage
cell that expresses mature BCR ( Figs. 3 – 5 ).
These results are diff erent from those reported by Zhang
et al. ( 11 ), who did not detect V H cRS SEs in human pro–B
cells, but did fi nd them in immature B lymphocytes. Zhang
et al. suggested that recovery of V H cRS SEs from pro–B cells
might be hindered by rapid cell proliferation and effi cient
DNA repair. Although these factors may be important in the
analysis of human B cell populations, we readily detected V H
cRS SEs in mouse pro–B cells ( Fig. 4 ). It is possible that the
populations of B cells we analyzed diff er somewhat from those
sorted by Zhang et al.; however, the cytometric parameters
used by both groups were similarly based on IgM expression
and an early B cell marker (CD34 for human [ 11 ] and CD43
for mouse [ Fig. 3 ]). In addition, we characterized our B cell
populations by developmentally regulated gene expression and
Igh and Ig ? rearrangement ( Fig. 3 ). We are, therefore, confi dent
that the pro–B cells analyzed in our study, B220 lo CD43 + cells
expressing RAG1, RAG2:GFP, Tdt, and Igh rearrangements,
contain V H cRS SEs. In our hands, these V H cRS SEs do not
persist and/or reform at detectable levels in immature B cells
( Figs. 3 and 5 ). The diff erences between our results and those
reported by Zhang et al. ( 11 ) presumably refl ect the distinct
physiologies of mice and humans.
The presence of V H cRS SEs, which are the molecular
intermediates of Igh replacements, in pro–B cells from ? MT
mice unable to assemble a BCR ( 26 ) is inconsistent with any
IgH editing process driven by the recognition of self-antigen.
It is signifi cant that V H cRS SEs were also abundant in the
pro–B cells of H50G +/ ? Rag1 +/ ? mice ( Fig. 4 ), even though
this IgH transgenic line exhibits stringent ( ≥ 98%) allelic ex-
clusion ( 24 ). Similarly, Rajewsky et al. have observed frequent
IgH editing events in the presence of a productive and func-
tional V H DJ H SDT ( 33 ). Given the presence of V H cRS SEs
in normal pro–B cells and effi cient IgH editing in genetically
modifi ed pro–B cells ( 10 ), earlier conclusions that IgH editing
is driven by self-antigen ( 11 ) merit reconsideration. Instead,
we propose that V H → V H DJ H replacement occurs spontane-
ously, albeit at low frequency, in pro–B cells. In mice bearing
autoreactive V H DJ H SDT, replacement by endogenous V H
gene segments would relieve the autoreactive phenotype and
permit the “ edited ” B cells to mature beyond the small pre–B
To determine whether the complex editing events observed
in cell lines might also take place in vivo, we screened 390
mouse V H gene segment sequences with the RIC algorithm
to identify potentially functional 12- or 23-cRSs ( 18, 19 ). RIC
is capable of identifying RSs and cRSs in DNA sequences ( 18 );
whereas RIC scores for RSs are highly correlated with re-
combination effi ciencies, RIC scores for cRSs are less so, in
part because of the narrow range of RIC scores and measured
recombination effi ciencies that are often below the detection
threshold ( 17, 18 ). Nevertheless, the measured extrachromo-
somal recombination effi ciencies (R = 0.01 – 0.02%; Table II )
of a small subset of site I, III, and IV V H 12-cRSs fell at the
lower range of recombinational activities (R = 0.03 – 0.6%) of
4 site V V H cRSs that were previously determined ( 18 ).
In vivo generation of (site III) V H cRS SEs was more effi -
cient, with quantities of V H cRS SEs ranging from 1 (V H 1) to
8% (V H 5) of that observed for J H 2 SEs ( Fig. 6 ). These higher
values are consistent with our ability to detect cRS SEs in as
few as 10 3 pro–B cells, and they imply that rearrangements of
V H cRSs may occur as often as rearrangements of the recom-
bining sequence cRS that fl ank C ? in mice ( 31 ). Frequencies
of V H cRS cleavage vary between diff erent V H gene seg-
ments/families; quantitative LM-PCR indicated that V H 5
cRS SEs were almost twice as abundant as V H 1 cRS SEs after
correcting for template number ( Fig. 6 ). Although we cannot
rule out the possibility that the covalent sealing or degrada-
tion of cRS SEs is not uniform, increased abundance of cer-
tain cRS SEs suggests that cRSs in some V H may be preferred
recipients for upstream V H RSs ( 3, 32 ).
Almost half (108/299) of O2 12-cRSs in V H gene seg-
ments are not located at the 3 ? end of V H gene segments ( Fig. 2 );
e.g., a cluster of 51 V H cRSs is located at nt 57 ( Fig. 2 ). These
and other 5 ? cRSs are functional at low effi ciency, both in vitro
( Table II ) and in vivo ( Table III ). Sequence analysis of V H cRS
SEs from pro–B cells of RAG2:GFP, ? MT, and C57BL/6
mice revealed cleavage at 33 unique 12-cRSs, one in a V H 5 gene
segment and 32 in V H 1 genes ( Table III ). These V H 12-cRSs
comprised 29 unique cRS sites from 27 germline V H genes
( Table III ). The utility of RIC analyses is supported by the
location of these functional 12-cRSs; > 90% (31/33) corre-
spond to the predicted V H 12-cRSs ( Fig. 2 ).
To our surprise, we recovered only 6 V H cRS SEs at
the well-known site V cRS (313 bp; Table III ) commonly
observed in IgH replacements ( 3, 11 ). Instead, the most com-
mon (22/33) V H cRS SEs we recovered represented site III
(nt 155) 12-cRSs located near the middle of the V H gene
segments ( Table III and Fig. 2 ). V H cRS SEs from sites I – IV
comprised ? 80% (27/33) of our sample, indicating that RAG-
mediated cleavage at site V cRSs is not favored. At least 2 V H
gene segments, V H 1S2*01 and V H 1S130*01, contain 2 func-
tional 12-cRSs at sites I and III and at an unpredicted posi-
tion at 267 bp, respectively ( Table III ). Thus, RIC scores
eff ectively predicted the location of V H cRSs active in vivo
and their recombination potential in extrachromosomal as-
says, but not the frequency of V H cRS SEs recovered from
pro–B cells. We conclude that factors absent from extrachro-

Page 11

JEM VOL. 204, December 24, 2007
ARTICLE
3205
23-RS would produce V H genes shortened by deletion of the
intervening DNA and terminated by a signal joint ( Fig. 7 ).
Reopening of this terminal signal joint would allow the 23-
RS to form a new signal joint with downstream 12-cRSs,
thereby fusing the shortened V H fragment to a truncated V H
acceptor ( Fig. 7 ). This double reaction intra-V H rearrange-
ment followed by insertion into a downstream V H /V H DJ H
would undoubtedly be rare, but could result in hybrid V H
genes of nearly normal length. For example, intra-V H re-
arrangements at site III cRS ( Table III ), followed by insertion
at another site III cRS in a downstream V H gene segment,
would produce a novel V H sequence of normal length carry-
ing the CDR1 of the upstream donor and the CDR2 of the
downstream acceptor. Hybrid V H gene segments created by
this process would contain a signal-to-coding joint at the fu-
sion site ( Fig. 7 ).
The hypothesis that cRSs are conserved in V H gene seg-
ments to promote genetic diversity implies that cRSs should
be conserved in other V gene families as well. We have tested
this prediction by scanning all mouse V ? gene segments with
the RIC algorithms. Our search revealed a highly signifi cant
conservation of 23-cRSs oriented to interact with upstream
V ? 12-RSs (unpublished data). We do not wish to overem-
phasize this fi nding; the presence of conserved cRSs in V ?
gene segments is consistent with, but does not prove, a role
for V H cRSs in amplifying V region diversity. Nonetheless,
these V ? cRSs demonstrate that cRSs can arise in Ig loci ca-
pable of repeated physiological rearrangements.
Although the reports are controversial ( 43, 44 ), several groups
have recovered hybrid V H genes of normal length from hu-
man B cells ( 14, 15 ) and B cell tumors ( 45 – 47 ) that could be
generated by recombination at site I – IV cRSs. These reports
propose that hybrid V H genes arise as products of secondary
rearrangements between 23- and 12-cRSs centrally embed-
ded in V H gene segments or by recombination between like
cell stage. In this scenario, self-antigen does not drive recep-
tor editing, but rather selects for mutant cells that are no lon-
ger autoreactive.
V H replacements from mice and humans are frequently
characterized by N-nucleotide additions ( 3, 10, 11 ). Although
N-sequence additions imply V H replacement in Tdt + pro–B
cells ( 13 ), Chen et al. ( 3 ) have proposed that Tdt may be re-
expressed in immature, autoreactive B cells after encounter
with self-antigen. This seems unlikely, given that little or no
Tdt expression has been detected in the pre–B and immature
B cell compartments ( Fig. 3 and [ 13 ]), even though a substan-
tial fraction ( ≥ 20%) of late small pre–B- and immature B cells are
thought to be autoreactive and edit their L-chains ( 34, 35 ).
But what of IgH replacements that lack N-nucleotides? Are
they evidence for IgH editing in more mature Tdt ? develop-
mental compartments?
Recently, Koralov et al. generated genetically modifi ed
mice to study V H replacement ( 10, 36 ). In these animals, anti-
body and B cell production depends on the replacement of a
nonproductive V H DJ H rearrangement that takes place in pro–
B cells via two mechanisms: V H → V H DJ H replacement; and,
less frequently, direct V H -to-J H joining ( 10 ). These mice ex-
hibit diverse and substantial B cell populations, and the ma-
jority of V H → V H DJ H replacement events analyzed did not
contain N-nucleotide additions, presumably because secondary
cRS rearrangements were facilitated by local sequence homo-
logies. Koralov et al. conclude that Igh replacements in pro–B
cells is relatively effi cient and that its impact on the antibody
repertoire may be greater than is currently thought, as it often
leaves no molecular footprint ( 10 ).
Given that the conserved site I – IV cRSs in V H gene seg-
ments could not mediate V H → V H DJ H replacements ( 3, 11 ),
what other purpose might these signals serve? Taki et al. ( 8 ),
have reported an inactivating rearrangement involving a 5 ?
cRS in an Igh SDT. This replacement, a D H → VDJ H invasion
( 8 ), followed by a physiological rearrangement to an upstream
V H (V H → DVDJ H ) ( 8 ) was nonfunctional, as it was isolated
only from B cells expressing BCR encoded by an endog-
enous Igh rearrangements ( 8 ). These results suggest that 5 ?
cRS might function to end V(D)J rearrangements on one al-
lele, as well as an analogy to abrogation of Ig ? rearrangements
by C ? -deleting signals ( 37 – 41 ). Indeed, even open-and-shut
reactions ( 42 ) at FW cRSs would likely produce inactivating
frame-shift mutations.
Alternatively, conserved V H cRSs at sites I – IV might in-
teract to create novel, hybrid V H gene segments. We demon-
strated frequent cRS cleavage sites between CDR1 and CDR2
( Fig. 2 and Table III ), and showed that V H 12-cRSs are
strongly conserved in the O2 orientation, i.e., opposite of the
physiological 23-RS ( Fig. 7 and Table S1). This arrangement
facilitates V H → V H DJ H fusions at site V 12-cRS, but also
allows other recombination events including V H → V H and
intra-V H rearrangements ( Fig. 7 ). Both V H → V H DJ H and
V H → V H fusions lengthen the acceptor V H genes in propor-
tion to cRS location (site I > site V; Fig. 7 ). In contrast, intra-
V H rearrangements between V H 12-cRS and downstream
Figure 7. Rearrangement of site I – V V H cRSs in pro–B cells could
increase the IgH repertoire by V H replacement or hybrid rearrange-
ment. The primary VDJ germline confi guration and the outcomes of
secondary cRS rearrangements are depicted. V H replacement (V → V or
V → VDJ) is mediated by a cRS (gray triangle in V H gene segment) to an
upstream V H RS (white triangle). (Intra-V) → VDJ rearrangement via a
5? cRS to a 5? cRSs in another V H gene segment forms a hybrid rearrange-
ment and creates a hybrid joint (between a CE and a SE) between two V H
gene segments. Note that hybrid rearrangements and V H replacements
depicted can increase the diversity of V H gene segments by novel
CDR combinations.

Page 12

3206
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
(excluding leader sequences) in the Immunogenetics Information System
(IMGT) reference set (http://imgt.cines.fr). As controls for the identifi cation
of V H cRSs, we computed RIC for all 28- and 39-bp sequences in a 212-kb
region of mouse chromosome 8 (GenBank accession no. AC084823 ).
Mice. All mice were housed in specifi c pathogen – free conditions at the
Duke University Medical Center Vivarium. RAG2:GFP mice ( 21 ) were
obtained from F.W. Alt (Harvard University, Boston, MA); ? MT ( 26 ) and
C57BL/6 mice were purchased from The Jackson Laboratory. H50G +/ ?
(IgH) transgenic mice ( 24 ) were bred with Rag1 ? / ? mice (The Jackson
Laboratory) to produce sibling H50G +/ ? Rag1 +/ ? and H50G +/ ? Rag1 ? / ?
mice. All experiments using animals were reviewed and approved by the
Institutional Animal Use and Care Committee of Duke University.
Flow cytometry. BM was isolated from femurs and tibias of mice. Red
blood cells were lysed in ACK buff er, and BM cells were washed and
resuspended in HBSS (Invitrogen) supplemented with 2% FCS (Sigma-
Aldrich). BM B cells from RAG2:GFP, H50G +/ ? Rag1 +/ ? , and H50G +/ ?
Rag1 ? / ? mice were stained with lineage (Lin) markers (IgD, Gr-1, Mac-1,
TER-119, CD4, and CD8) conjugated with biotin, washed twice with HBSS
(2% FCS), incubated with streptavidin conjugated to magnetic MicroBeads
(Miltenyi Biotech), washed with HBSS (2% FCS), and depleted by auto-
MACS (Miltenyi Biotech). After depletion, cell samples were labeled with
anti-B220 (APC), anti-CD43 (PE or FITC), anti-IgM (Texas red), 7-amino
actinomycin D (Invitrogen), and streptavidin (Cychrome). To obtain B cells
from μ MT and C57BL/6 mice, single-cell suspensions were stained with
anti-IgD (FITC), anti-CD43 (PE), anti-B220 (PE-Cy7), anti-IgM (Texas
red), and PE-Cy5-conjugated Lin markers (Gr-1, CD11b, CD4, CD8, and
TER-119). After staining and washing, BM samples were sorted on a FAC-
SVantage cell sorter (BD Biosciences). All antibodies and markers are from
BD Biosciences or eBioscience, except for 7-amino actinomycin D and anti-
IgM (SouthernBiotech).
Cell culture. 103/BCL2 cells ( 50 ) were cultured for use in extrachromo-
somal recombination assays, as previously described ( 18 ).
Extrachromosomal recombination assay. 12-cRSs were cloned into
pJH290 and electroporated into 103/BCL2 cells ( 18 ). Cells were subse-
quently incubated at 34 ° C for 2 d and incubated at 39.5 ° C for 2 d to induce
V(D)J rearrangement ( 18 ). Recombination plasmids were extracted, digested
with DpnI, and used to transform Escherichia coli . Transformed bacteria
were incubated on LB-agar plates supplemented with 50 ? g/ml ampicillin,
11 ? g/ml chloramphenicol, or both. The bacterial colonies on each plate
were quantifi ed and normalized to equivalent incubation volumes. The R of
various 12-cRSs was estimated as the ratio of amp r cam r to amp r bacterial
colonies, as previously described ( 18 ). R was calculated as the mean of ≥ 3
independent electroporations. The sensitivity limit of extrachromosomal
assay was established with a pJH290 plasmid modifi ed by deletion of the
12-RS, leaving the 23-RS as the only physiological RS. Extrachromosomal
recombination assays with this plasmid did not produce a single amp r cam r
bacterial colony out of 98,730 A r bacterial colonies that harbored a bona fi de
rearrangement. Thus, the sensitivity limit for the detection of 12- and 23-RS
rearrangement was ? 0.001% (1/98,730).
PCR. Amplifi cation of CD14 was performed to quantify genomic DNA
template ( 51 ). LM-PCR was used to amplify SEs ligated to a BW-LC
linker, as previously described ( 18 ). V H cRS SEs from cells isolated from
RAG2:GFP, sibling H50G, ? MT, and C57BL/6 mice were amplifi ed by a
seminested LM-PCR. Primary amplifi cation of V H cRS SEs included a V H
family-specifi c outside primer (V H out) and BW-LCH primer (5 ? -ACGTG-
GAATCGCCAGACCAC-3 ? ), using ThermalAce DNA Polymerase (Invit-
rogen). Primary amplifi cation was mediated by 12 cycles of melting at 98 ° C
for 30 s, annealing at 65 ° C for 30 s, and extending at 72 ° C for 30 s, and was
fi nally terminated after a 10-min incubation at 72 ° C. 10% of the primary
reaction was amplifi ed with a V H family – specifi c inside primer (V H in) and
cRSs in violation of the 12/23 rule. The LM-PCR used in
our studies does not detect cRS SEs in the O1 orientation,
and we have no direct evidence regarding interaction of V H
23- and 12-cRSs. Our RIC scans, however, did not detect
conserved, bidirectional 12-/23-cRS in mouse V H gene seg-
ments (unpublished data). Intra-V H → V H DJ H rearrangements
( Fig. 7 ) allow, at least in theory, for the gen eration of V H
hybrids at sites of conserved O2 12-cRSs. Generation of V H
hybrids by this mechanism predicts specifi c genomic inter-
mediates (intra-V; Fig. 7 ); their demonstration and frequency
would provide a signifi cant test for the signifi cance of site
I – IV cRS.
If they do not represent PCR artifacts, hybrid V H gene
segments might result from AID- rather than RAG1/2 activ-
ity, given the germinal center/post – germinal center origins
of many hybrid V H genes ( 44, 48 ). AID activity can result in
both single- and double-stranded breaks in DNA, and subse-
quent repair by homologous recombination could produce
hybrid V H genes ( 48 ). On the other hand, RAG1/2 also in-
troduces single-strand nicks at RSs that could be subject to
homologous recombination ( 49 ).
In their seminal work, Chen et al. ( 3 ) considered, and then
dismissed, the possibility that IgH replacements might not
represent receptor editing, but rather the continuing activity
of RAG1/2 on functional V H DJ H templates. This conclusion
was supported by the fi ndings of Zhang et al. ( 11 ) who ob-
served cRS SEs only in human immature B cells, the earliest
developmental compartment capable of antigen recognition.
In contrast, we demonstrate abundant V H cRS SEs in the
pro–B cell compartment of normal mice; pro–B cells do not
express L-chain and are incapable of binding self- or exogenous
antigens. Recovery of cRS SEs from the pro–B cells of ? MT
mice rules out any possibility that these RAG1-dependent
SEs refl ect antigen-induced editing. Nonetheless, functional
V H cRSs are evolutionarily conserved independently of the
amino acids necessary for IgH structure. Are these conserved
cRSs accidents of evolution, or do they have physiological
signifi cance? Combinatorial diversity in IgH rearrangements
is determined by the evolutionary concatenation of CDR1
and 2 in distinct V H gene segments and the random, somatic
generation of CDR3 during the fusion of V H , D, and J H gene
segments. This process generates a set of primary antigen re-
ceptors of remarkable breadth, but also one that is focused on
the assembly of the CDR3. We suggest that site I – V V H cRSs
are conserved, as their rearrangements off er the possibility of
(a) greater diversity in CDR3 (V H → V H DJ H ) and (b) the so-
matic reassortment of CDR1 and CDR2 associations (intra-
V H → V H DJ H ) otherwise fi xed by evolution.
MATERIALS AND METHODS
RS models. The computational models of RSs assign a RIC value to 28- or
39-bp sequences. We demonstrated that sequences with nucleotide combina-
tions strongly conserved in physiological RSs are effi cient at recombination
and have high RIC values ( 18, 19 ). We used RIC 12 or RIC 23 to determine the
location and the number of 12- or 23-cRSs in V H gene segments. RIC was
computed for all 28- and 39-bp sequences in the 390 mouse V H gene segments

Page 13

JEM VOL. 204, December 24, 2007
ARTICLE
3207
5 . Sakano , H. , Y. Kurosawa , M. Weigert , and S. Tonegawa . 1981 . Identi-
fi cation and nucleotide sequence of a diversity DNA segment (D) of
immunoglobulin heavy-chain genes. Nature . 290 : 562 – 565 .
6 . Alt , F.W. , G.D. Yancopoulos , T.K. Blackwell , C. Wood , E. Thomas ,
M. Boss , R. Coff man , N. Rosenberg , S. Tonegawa , and D. Baltimore .
1984 . Ordered rearrangement of immunoglobulin heavy chain variable
region segments. EMBO J. 3 : 1209 – 1219 .
7 . Chen , C. , E.L. Prak , and M. Weigert . 1997 . Editing disease-associated
autoantibodies. Immunity . 6 : 97 – 105 .
8 . Taki , S. , F. Schwenk , and K. Rajewsky . 1995 . Rearrangement of up-
stream DH and VH genes to a rearranged immunoglobulin variable
region gene inserted into the DQ52-JH region of the immunoglobulin
heavy chain locus. Eur. J. Immunol. 25 : 1888 – 1896 .
9 . Cascalho , M. , A. Ma , S. Lee , L. Masat , and M. Wabl . 1996 . A quasi-
monoclonal mouse. Science . 272 : 1649 – 1652 .
10 . Koralov , S.B. , T.I. Novobrantseva , J. Konigsmann , A. Ehlich , and K.
Rajewsky . 2006 . Antibody repertoires generated by VH replacement
and direct VH to JH joining. Immunity . 25 : 43 – 53 .
11 . Zhang , Z. , M. Zemlin , Y.H. Wang , D. Munfus , L.E. Huye , H.W.
Findley , S.L. Bridges , D.B. Roth , P.D. Burrows , and M.D. Cooper .
2003 . Contribution of v(h) gene replacement to the primary B cell
repertoire. Immunity . 19 : 21 – 31 .
12 . Cascalho , M. , J. Wong , and M. Wabl . 1997 . VH gene replacement in
hyperselected B cells of the quasimonoclonal mouse. J. Immunol. 159 :
5795 – 5801 .
13 . Li , Y.S. , K. Hayakawa , and R.R. Hardy . 1993 . The regulated ex-
pression of B lineage associated genes during B cell diff erentiation in
bone marrow and fetal liver. J. Exp. Med. 178 : 951 – 960 .
14 . Itoh , K. , E. Meff re , E. Albesiano , A. Farber , D. Dines , P. Stein , S.E.
Asnis , R.A. Furie , R.I. Jain , and N. Chiorazzi . 2000 . Immunoglobulin
heavy chain variable region gene replacement as a mechanism for re-
ceptor revision in rheumatoid arthritis synovial tissue B lymphocytes.
J. Exp. Med. 192 : 1151 – 1164 .
15 . Wilson , P.C. , K. Wilson , Y.J. Liu , J. Banchereau , V. Pascual , and J.D. Capra .
2000 . Receptor revision of immunoglobulin heavy chain variable region
genes in normal human B lymphocytes. J. Exp. Med. 191 : 1881 – 1894 .
16 . Bertrand , F.E. , R. Golub , and G.E. Wu . 1998 . V(H) gene replacement
occurs in the spleen and bone marrow of non-autoimmune quasi-mono-
clonal mice. Eur. J. Immunol. 28 : 3362 – 3370 .
17 . Lee , A.I. , S.D. Fugmann , L.G. Cowell , L.M. Ptaszek , G. Kelsoe , and
D.G. Schatz . 2003 . A functional analysis of the spacer of V(D)J recom-
bination signal sequences. PLoS Biol. 1 : E1 .
18 . Cowell , L.G. , M. Davila , K. Yang , T.B. Kepler , and G. Kelsoe . 2003 .
Prospective estimation of recombination signal effi ciency and identifi ca-
tion of functional cryptic signals in the genome by statistical modeling.
J. Exp. Med. 197 : 207 – 220 .
19 . Cowell , L.G. , M. Davila , T.B. Kepler , and G. Kelsoe . 2002 . Identifi cation
and utilization of arbitrary correlations in models of recombination signal
sequences. Genome Biol. 3.
20 . Goldsby , R.A. , T.J. Kindt , B.A. Osborne , and J. Kuby . 2003 .
Immunology . W. H. Freeman and Company, New York .
21 . Monroe , R.J. , K.J. Seidl , F. Gaertner , S. Han , F. Chen , J. Sekiguchi , J.
Wang , R. Ferrini , L. Davidson , G. Kelsoe , and F.W. Alt . 1999 . RAG2:
GFP knockin mice reveal novel aspects of RAG2 expression in primary
and peripheral lymphoid tissues. Immunity . 11 : 201 – 212 .
22 . Osmond , D.G. , A. Rolink , and F. Melchers . 1998 . Murine B lympho-
poiesis: towards a unifi ed model. Immunol. Today . 19 : 65 – 68 .
23 . Yu , W. , H. Nagaoka , M. Jankovic , Z. Misulovin , H. Suh , A. Rolink ,
F. Melchers , E. Meff re , and M.C. Nussenzweig . 1999 . Continued RAG
expression in late stages of B cell development and no apparent re-
induction after immunization. Nature . 400 : 682 – 687 .
24 . Dal Porto , J.M. , A.M. Haberman , G. Kelsoe , and M.J. Shlomchik .
2002 . Very low affi nity B cells form germinal centers, become memory
B cells, and participate in secondary immune responses when higher
affi nity competition is reduced. J. Exp. Med. 195 : 1215 – 1221 .
25 . Chang , Y. , M.J. Bosma , and G.C. Bosma . 1999 . Extended duration
of DH – JH rearrangement in immunoglobulin heavy chain transgenic
mice: implications for regulation of allelic exclusion. J. Exp. Med. 189 :
1295 – 1305 .
BW-LCH primer. Nested amplifi cation used the same program with 26
cycles. Amplifi ed SEs were detected by hybridization to ? -P 32 – labeled probes
with a Storm PhosphorImager (GE Healthcare). LM-PCR products were
cloned and sequenced ( 18 ). LM-PCR of D ? SEs and J ? SEs were performed
as previously described ( 51, 52 ). PCR primers for CD14 followed ( 51 ).
The relative abundance of J H 2 RS SEs and V H cRS SEs in DNA recov-
ered from nucleated BM cells of C57BL/6 mice was estimated by real-time
quantitative PCR on an ABI PRISM 7700 Sequence Detector using SYBR
green PCR core reagents (Applied Biosystems) according to the manufac-
turer ’ s instructions. The relative abundance of RS/cRS SEs was calculated
by the comparative C T (threshold cycle) method recommended by the man-
ufacturer (Applied Biosystems) normalized to J H 2 SE product from the same
sample. In brief, ? C T values were determined by subtracting C T (cRS SE) from
C T (RS SE) . Expression levels relative to J H 2 RS SEs were defi ned as 2 ? CT .
Sequences for LM-PCR primers and probes are: (a) J H 2out, 5 ? -T A C-
T TC GATGTCTGGGGCACAG-3 ? , J H 2in, 5 ? -AAAGA G G C A GTC A GA-
GGCTAGCT G-3 ? , J H 2probe, and 5 ? -AAATAG GC A TTTACATTGTTA-
GGC-3 ? for J H RS SE; (b) V H 1(J558)out.1, 5 ? -AGGTCCAACTGCAGCA-
GCCTG-3 ? , V H 1(J558)in.1, 5 ? -CCT GC AAGGCTTCTGGCTACA-3 ? ,
V H 1(J558)out.2, 5 ? -CAGGTTCAGCTSCAGCAGTCTG-3 ? , V H 1(J558)in.2,
5 ? -T RTCCTGCAAGGCTTCTGGCTACAC-3 ? ; V H 1(J558)out.3, 5 ? -AGG-
TCCAGCTGCAGCAGTCTG-3 ? , V H 1(J558)in.3, 5 ? -TCAGTGAAGAT-
GTCCTGCAA-3 ? (where S = C/G, R = A/G), V H 1(J558)cRSprobe, and
5 ? -TG C C T TTCTCTCCAC AGGTGTCCA-3 ? for V H 1 (J558) cRS SE; (c)
V H 2(Q52)out, 5 ? -TGTCCATCACCTGCAC A G TCTCTG-3 ? , V H 2(Q52)in,
5 ? -TCTGGAGTGGCTGGGAGTGATATG-3 ? , V H 2(Q52)cRSprobe,
5 ? -CCAGAC TGAGCATCAGCAAGGACAA-3 ? for V H 2 (Q52) cRS SE;
V H 5(7183)out, 5 ? - GAGGGTCCCTGAAACTCTC CTG-3 ? , (d) V H 5(7183)in,
5 ? -GGAGTTGGTC GCAGCCATTAATAG-3 ? , V H 5(7183)cRSprobe,
5 ? -CTCCAGAGACAATA CCAAGAAGACC-3 ? for V H 5 (7183) cRS SE.
Amplifi cation of the physiological RS SEs of the V H 7183 gene segment made
use of this additional primer ([7183RS], 5 ? -ATGTGTGCCAGGAGCCT-
CTGACCAG-3 ? ). The V H primer sets (V H 1[J558].1, V H 2[Q52], and V H 5[7183])
used in this study amplify ? 34 V H 1 gene segments, 4 V H 2 gene segments, and
7 V H 5 gene segments from the C57BL/6 genome.
Online supplemental material. Table S1 provides the numbers of RS-
length segments with a fi nite RIC score and the numbers of cRSs ( RIC >
? 45 or ? 65 for 12- and 23-cRSs, respectively) in V H gene segments and
a 212-kb region of mouse chromosome 8 (GenBank accession no. AC084823 ).
Relative frequencies of 12- and 23-cRSs are shown in parentheses. V H
cRSs are conserved with 12-bp spacers and in the O2 orientation. The online
version of this article is available at http://www.jem.org/cgi/content/full/
jem.20071244/DC1.
We are grateful for the comments and suggestions of Drs. T.F. Tedder (Duke
University) and M.D. Cooper (University of Alabama). This work was supported in
part by grants from the National Institutes of Health (AI 24335, AI 56363, and
AI 67854), the Bill and Melinda Gates Foundation (to G. Kelsoe.) and the Burroughs-
Wellcome Fund (to L.G. Cowell).
The authors have no confl icting fi nancial interests.
Submitted: 18 June 2007
Accepted: 2 November 2007
REFERENCES
1 . Nemazee , D. , and M. Weigert . 2000 . Revising B cell receptors. J. Exp.
Med. 191 : 1813 – 1817 .
2 . Fanning , L. , F.E. Bertrand , C. Steinberg , and G.E. Wu . 1998 . Molecular
mechanisms involved in receptor editing at the Ig heavy chain locus.
Int. Immunol. 10 : 241 – 246 .
3 . Chen , C. , Z. Nagy , E.L. Prak , and M. Weigert . 1995 . Immunoglobulin
heavy chain gene replacement: a mechanism of receptor editing. Immunity .
3 : 747 – 755 .
4 . Kleinfi eld , R.W. , and M.G. Weigert . 1989 . Analysis of VH gene replace-
ment events in a B cell lymphoma. J. Immunol. 142 : 4475 – 4482 .

Page 14

3208
CLEAVAGE OF V H CRYPTIC RECOMBINATION SIGNALS | Davila et al.
26 . Kitamura , D. , J. Roes , R. Kuhn , and K. Rajewsky . 1991 . A B cell-
defi cient mouse by targeted disruption of the membrane exon of the
immunoglobulin mu chain gene. Nature . 350 : 423 – 426 .
27 . Kleinfi eld , R. , R.R. Hardy , D. Tarlinton , J. Dangl , L.A. Herzenberg ,
and M. Weigert . 1986 . Recombination between an expressed immuno-
globulin heavy-chain gene and a germline variable gene segment in a
Ly 1+ B-cell lymphoma. Nature . 322 : 843 – 846 .
28 . Jung , D. , C. Giallourakis , R. Mostoslavsky , and F.W. Alt . 2006 . Mecha-
nism and control of V(D)J recombination at the immunoglobulin heavy
chain locus. Annu. Rev. Immunol. 24 : 541 – 570 .
29 . Lewis , S.M. , E. Agard , S. Suh , and L. Czyzyk . 1997 . Cryptic signals and
the fi delity of V(D)J joining. Mol. Cell. Biol. 17 : 3125 – 3136 .
30 . Usuda , S. , T. Takemori , M. Matsuoka , T. Shirasawa , K. Yoshida , A. Mori ,
K. Ishizaka , and H. Sakano . 1992 . Immunoglobulin V gene replacement
is caused by the intramolecular DNA deletion mechanism. EMBO J.
11 : 611 – 618 .
31 . Siminovitch , K.A. , M.W. Moore , J. Durdik , and E. Selsing . 1987 . The
human kappa deleting element and the mouse recombining segment
share DNA sequence homology. Nucleic Acids Res. 15 : 2699 – 2705 .
32 . Connor , A.M. , L.J. Fanning , J.W. Celler , L.K. Hicks , D.A. Ramsden ,
and G.E. Wu . 1995 . Mouse VH7183 recombination signal sequences
mediate recombination more frequently than those of VHJ558. J. Immunol.
155 : 5268 – 5272 .
33 . Taki , S. , M. Meiering , and K. Rajewsky . 1993 . Targeted insertion of
a variable region gene into the immunoglobulin heavy chain locus .
Science . 262 : 1268 – 1271 .
34 . Casellas , R. , T.A. Shih , M. Kleinewietfeld , J. Rakonjac , D. Nemazee ,
K. Rajewsky , and M.C. Nussenzweig . 2001 . Contribution of receptor
editing to the antibody repertoire. Science . 291 : 1541 – 1544 .
35 . Wardemann , H. , S. Yurasov , A. Schaefer , J.W. Young , E. Meff re , and
M.C. Nussenzweig . 2003 . Predominant autoantibody production by
early human B cell precursors. Science . 301 : 1374 – 1377 .
36 . Koralov , S.B. , T.I. Novobrantseva , K. Hochedlinger , R. Jaenisch , and
K. Rajewsky . 2005 . Direct in vivo VH to JH rearrangement violating
the 12/23 rule. J. Exp. Med. 201 : 341 – 348 .
37 . Moore , M.W. , J. Durdik , D.M. Persiani , and E. Selsing . 1985 . Deletions
of kappa chain constant region genes in mouse lambda chain-producing
B cells involve intrachromosomal DNA recombinations similar to V-J
joining. Proc. Natl. Acad. Sci. USA . 82 : 6211 – 6215 .
38 . Shimizu , T. , T. Iwasato , and H. Yamagishi . 1991 . Deletions of immuno-
globulin C ? region characterized by the circular excision products in
mouse splenocytes. J. Exp. Med. 173 : 1065 – 1072 .
39 . Durdik , J. , M.W. Moore , and E. Selsing . 1984 . Novel kappa light-chain
gene rearrangements in mouse lambda light chain-producing B lympho-
cytes. Nature . 307 : 749 – 752 .
40 . Siminovitch , K.A. , A. Bakhshi , P. Goldman , and S.J. Korsmeyer . 1985 .
A uniform deleting element mediates the loss of kappa genes in human
B cells. Nature . 316 : 260 – 262 .
41 . Graninger , W.B. , P.L. Goldman , C.C. Morton , S.J. O ’ Brien , and S.J.
Korsmeyer . 1988 . The ? -deleting element. Germline and rearranged,
duplicated, and dispersed forms. J. Exp. Med. 167 : 488 – 501 .
42 . Lewis , S.M. , and J.E. Hesse . 1991 . Cutting and closing without recom-
bination in V(D)J joining. EMBO J. 10 : 3631 – 3639 .
43 . Goossens , T. , U. Klein , and R. Kuppers . 1998 . Frequent occurrence of
deletions and duplications during somatic hypermutation: implications
for oncogene translocations and heavy chain disease. Proc. Natl. Acad.
Sci. USA . 95 : 2463 – 2468 .
44 . Darlow , J.M. , and D.I. Stott . 2005 . V(H) replacement in rearranged
immunoglobulin genes. Immunology . 114 : 155 – 165 .
45 . Deane , M. , and J.D. Norton . 1990 . Immunoglobulin heavy chain gene
rearrangement involving V-V region recombination. Nucleic Acids Res.
18 : 1652 .
46 . Brokaw , J.L. , S.M. Wetzel , and B.A. Pollok . 1992 . Conserved patterns
of somatic mutation and secondary VH gene rearrangement create aber-
rant Ig-encoding genes in Epstein-Barr virus-transformed and normal
human B lymphocytes. Int. Immunol. 4 : 197 – 206 .
47 . Lenze , D. , A. Greiner , C. Knorr , I. Anagnostopoulos , H. Stein , and
M. Hummel . 2003 . Receptor revision of immunoglobulin heavy chain
genes in human MALT lymphomas. Mol. Pathol. 56 : 249 – 255 .
48 . Darlow , J.M. , and D.I. Stott . 2006 . Gene conversion in human rear-
ranged immunoglobulin genes. Immunogenetics . 58 : 511 – 522 .
49 . Lee , G.S. , M.B. Neiditch , S.S. Salus , and D.B. Roth . 2004 . RAG pro-
teins shepherd double-strand breaks to a specifi c pathway, suppressing
error-prone repair, but RAG nicking initiates homologous recombination.
Cell . 117 : 171 – 184 .
50 . Chen , Y.Y. , L.C. Wang , M.S. Huang , and N. Rosenberg . 1994 . An
active v-abl protein tyrosine kinase blocks immunoglobulin light-chain
gene rearrangement. Genes Dev. 8 : 688 – 697 .
51 . Han , S. , S.R. Dillon , B. Zheng , M. Shimoda , M.S. Schlissel , and G.
Kelsoe . 1997 . V(D)J recombinase activity in a subset of germinal center
B lymphocytes. Science . 278 : 301 – 305 .
52 . McMahan , C.J. , and P.J. Fink . 1998 . RAG reexpression and DNA
recombination at T cell receptor loci in peripheral CD4+ T cells.
Immunity . 9 : 637 – 647 .