Identification of Nrf2-dependent airway epithelial adaptive response to proinflammatory oxidant-hypochlorous acid challenge by transcription profiling

Division of Translational Biology, The Hamner Institutes for Health Sciences, 6 Davis Dr., Research Triangle Park, NC 27709, USA.
AJP Lung Cellular and Molecular Physiology (Impact Factor: 4.08). 04/2008; 294(3):L469-77. DOI: 10.1152/ajplung.00310.2007
Source: PubMed


In inflammatory diseases of the airway, a high level (estimated to be as high as 8 mM) of HOCl can be generated through a reaction catalyzed by the leukocyte granule enzyme myeloperoxidase (MPO). HOCl, a potent oxidative agent, causes extensive tissue injury through its reaction with various cellular substances, including thiols, nucleotides, and amines. In addition to its physiological source, HOCl can also be generated by chlorine gas inhalation from an accident or a potential terrorist attack. Despite the important role of HOCl-induced airway epithelial injury, the underlying molecular mechanism is largely unknown. In the present study, we found that HOCl induced dose-dependent toxicity in airway epithelial cells. By transcription profiling using GeneChip, we identified a battery of HOCl-inducible antioxidant genes, all of which have been reported previously to be regulated by nuclear factor erythroid-related factor 2 (Nrf2), a transcription factor that is critical to the lung antioxidant response. Consistent with this finding, Nrf2 was found to be activated time and dose dependently by HOCl. Although the epidermal growth factor receptor-MAPK pathway was also highly activated by HOCl, it was not involved in Nrf2 activation and Nrf2-dependent gene expression. Instead, HOCl-induced cellular oxidative stress appeared to lead directly to Nrf2 activation. To further understand the functional significance of Nrf2 activation, small interference RNA was used to knock down Nrf2 level by targeting Nrf2 or enhance nuclear accumulation of Nrf2 by targeting its endogenous inhibitor Keap1. By both methods, we conclude that Nrf2 directly protects airway epithelial cells from HOCl-induced toxicity.

Download full-text


Available from: Jingbo Pi,
17 Reads
  • Source
    • "If Nrf2 is proposed as protective factor against cytokine release, the knockdown of Nrf2 should expect an exacerbation of both cytokines, however, it has reported, that IL-29 is modulated positively by Nrf2 (Zhang et al., 2005), and comparable effect was observed in this work, which is that Nrf2 positively modulated cytokines after 4 weeks of TiO 2 NPs exposure. It appears that traditional pathways of inflammation are not completely involved in inflammation in lung tissue , for example, EGFR and MAPK pathways are not involved in hypochlorous acid-activation of Nrf2 in airway epithelial cells (Zhu et al., 2008) and NF-kappaB DNA binding is not the expected transcription pathway that leads to TiO 2 -induced inflammation (Wilson et al., 2012). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Titanium dioxide nanoparticles (TiO2 NPs) have been classified as possibly carcinogenic to humans and they are an important nanomaterial widely used in pharmaceutical and paint industries. Inhalation is one of the most important routes of exposure in occupational settings. Several experimental models have shown that oxidative stress and inflammation are key mediators of cell damage. In this regard, Nrf2 modulates cytoprotection against oxidative stress and inflammation, however, its role in inflammation induced by TiO2 NPs exposure has been less investigated. The aim of this work was to investigate the role of Nrf2 in the cytokines produced after 4 weeks of TiO2 NPs exposure (5 mg/kg/2 days/week) using wild-type and Nrf2 knockout C57bl6 mice. Results showed that Nrf2 protects against inflammation and oxidative damage induced by TiO2 NPs exposure, however, Nrf2 is a positive mediator in the expression of IFN-γ, TNF-α, and TGF-β in bronchial epithelium and alveolar space after 4 weeks of exposure. These results suggest that Nrf2 has a central role in up-regulation of cytokines released during inflammation induced by TiO2 NPs and those cytokines are needed to cope with histological alterations in lung tissue. © 2014 Wiley Periodicals, Inc. Environ Toxicol, 2014.
    Environmental Toxicology 02/2014; 30(7). DOI:10.1002/tox.21957 · 3.20 Impact Factor
  • Source
    • "Two different siRNAs were used for the knockdown of each gene. siRNA targeting Nrf2 (#1: GTAAGAAGCCAGATGTTAA) [26], #2: AAGAGTATGAGCTGGAAAAAC [27]), Keap1 (#1: GGGCGTGGCTGTCCTCAAT) [26], #2: TGAACGGTGCTGTCATGTA [28]) NQO1 (#1: GGACATCACAGGTAAACTG, #2: GAACCTCAACTGACATATA [29]) and P62 (#1: GCATTGAAGTTGATATCGA) [30]) were synthesized by Ambion (Austin, TX). The second set of P62 was the pooled siRNA purchased from Santa Cruz Biotechnology (Santa Cruz, CA). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Cigarette smoke (CS) has been reported to induce autophagy in airway epithelial cells. The subsequent autophagic cell death has been proposed to play an important pathogenic role in chronic obstructive pulmonary disease (COPD); however, the underlying molecular mechanism is not entirely clear. Using CS extract (CSE) as a surrogate for CS, we found that it markedly increased the expressions of both LC3B-I and LC3B-II as well as autophagosomes in airway epithelial cells. This is in contrast to the common autophagy inducer (i.e., starvation) that increases LC3B-II but reduces LC3B-I. Further studies indicate that CSE regulated LC3B at transcriptional and post-translational levels. In addition, CSE, but not starvation, activated Nrf2-mediated adaptive response. Increase of cellular Nrf2 by either Nrf2 overexpression or the knockdown of Keap1 (an Nrf2 inhibitor) significantly repressed CSE-induced LC3B-I and II as well as autophagosomes. Supplement of NAC (a GSH precursor) or GSH recapitulated the effect of Nrf2, suggesting the increase of cellular GSH level is responsible for Nrf2 effect on LC3B and autophagosome. Interestingly, neither Nrf2 activation nor GSH supplement could restore the repressed activities of mTOR or its downstream effctor-S6K. Thus, the Nrf2-dependent autophagy-suppression was not due to the re-activation of mTOR-the master repressor of autophagy. To search for the downstream effector of Nrf2 on LC3B and autophagosome, we tested Nrf2-dependent genes (i.e., NQO1 and P62) that are also increased by CSE treatment. We found that P62, but not NQO1, could mimic the effect of Nrf2 activation by repressing LC3B expression. Thus, Nrf2->P62 appears to play an important role in the regulation of CSE-induced LC3B and autophagosome.
    PLoS ONE 04/2013; 8(4):e55695. DOI:10.1371/journal.pone.0055695 · 3.23 Impact Factor
  • Source
    • "In order to understand the precise mechanisms of the NRF2 induced anti-oxidant response, researchers have largely turned to expression profiling experiments to determine those genes that mediate NRF2 activity in the tissue or model of interest. Most of these studies have utilized Nrf2 deficient mice or pharmacological treatment of various NRF2 activating compounds to define the NRF2 responsive genes [36-41]. These studies have lead to a well established group of NRF2 regulated genes, however, many novel or differentially regulated genes have been identified suggesting that there are species, tissue and model dependent differences in NRF2 regulated gene expression [42-47]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.
    Respiratory research 10/2012; 13(1):92. DOI:10.1186/1465-9921-13-92 · 3.09 Impact Factor
Show more