MRI detection of thrombin with aptamer functionalized superparamagnetic iron oxide nanoparticles.

Abstract

Design of smart MRI contrast agent based on superparamagnetic iron oxide nanoparticles and aptamers has been described for the detection of human alpha-thrombin protein. The contrast agent is based on the assembly of the aptamer functionalized nanoparticles in the presence of thrombin. A detectable change in MRI signal is observed with 25 nM thrombin in human serum. Changes were neither observed with control analytes, streptavidin, or bovine serum albumin, nor with inactive aptamer functionalized nanoparticles.

Full text

Page 1

MRI Detection of Thrombin with Aptamer Functionalized
Superparamagnetic Iron Oxide Nanoparticles
Mehmet Veysel Yigit,†,‡Debapriya Mazumdar,‡,§and Yi Lu*,†,‡,§,4
Center for Biophysics and Computational Biology, Beckman Institute for Advanced Science and Technology, Department of
Chemistry and Department of Biochemistry, University of Illinois at Urbana–Champaign, 600 S. Mathews Avenue, Urbana, IL
61801. Received October 22, 2007; Revised Manuscript Received November 27, 2007
Design of smart MRI contrast agent based on superparamagnetic iron oxide nanoparticles and aptamers has been
described for the detection of human R-thrombin protein. The contrast agent is based on the assembly of the
aptamer functionalized nanoparticles in the presence of thrombin. A detectable change in MRI signal is observed
with 25 nM thrombin in human serum. Changes were neither observed with control analytes, streptavidin, or
bovine serum albumin, nor with inactive aptamer functionalized nanoparticles.
Magnetic resonance imaging (MRI) is advancing rapidly, as
it provides noninvasive, three-dimensional examination of
biological events in living organisms. A particularly active area
of research in the MRI field is the development of MRI contrast
agents for image enhancement (1–9). Superparamagnetic iron
oxide nanoparticles (SPIOs) are attractive, since they are shown
to be effective in enhancing magnetic resonance image contrast
(4). The applications of SPIOs in MRI have ranged from
nontargeted detection of diseases by accumulating at certain
tissues to targeted detection of biomolecular markers in
cells (10–16). Target-specific MRI detection using SPIOs is
particularly interesting, as it helps monitor several cellular or
molecular processes (16–18). For example, cross-linked dextran-
coated superparamagnetic iron oxide (CLIO) nanoparticles have
been functionalized with different biomolecules and used for
detection of different targets including oligonucleotides (19, 20)
proteins (17, 20, 21), enzymatic activities (22), viruses (23),
and enantiomeric impurities (24). It has been shown that CLIO
nanoparticle assemblies create a distinctive magnetic phenom-
enon called magnetic relaxation switching (MRS), where the
core of a single nanoparticle in the assemblies becomes more
effective in enhancing T2 relaxation time of adjacent water
protons, when compared to dispersed nanoparticles (4, 19). This
mechanism has been widely used in many magnetic detection
schemes either going from a disperse state to an assembled state
of nanoparticles or visa versa (19, 20, 22, 24). For instance, it
has been shown that oligonucleotide functionalized dispersed
CLIO nanoparticles can be used for the sequence-specific
detection of complementary oligonucleotides simply by hybrid-
izing oligonucleotides and assembling CLIO nanoparticles into
clusters (19). This process enhances the T2 relaxation of the
nearby water protons and can be detected by MRI. While this
approach is effective in oligonucleotide detection, it would be
very interesting if this nucleic acid-based approach could be
expanded beyond nucleic acid detection to MRI of even broader
classes of targets.
Aptamers are single-stranded functional nucleic acid mol-
ecules which can bind a variety of chemical and biological
molecules with high affinity and selectivity (25–28). They are
obtained through a combinatorial biology technique called
systematic evolution of ligands by exponential enrichment
(SELEX), by isolating the active species from a large random
pool of DNA or RNA molecules (25, 26). They are often
analogous to antibodies due to their selectivity and sensitivity
in binding to a broad range of molecules (29–32). When
compared to antibodies, aptamers serve several advantages such
as the relative ease with which they can be selected for any
target analyte and their stability against biodegradation and
denaturation. Due to these properties, aptamers are good
candidates for building chemical and biological sensors in many
fields such as medical diagnostics and environmental monitoring.
Therefore, these aptamers have been transformed into fluorescent
(33–47), colorimetric (48–57), and electrochemical sensors
(58–60). Although these aptamer sensors have been widely
investigated in Vitro, their applications in ViVo remain a
significant challenge because light penetration through skin is
difficult and signal interference from cellular components is
common. Recently, we reported a method for combining
adenosine aptamer and CLIO nanoparticles into a system to
detect adenosine in the micromolar range via MRI. The contrast
in MR image of the nanoparticle solution increases as the
adenosine concentration increases in the environment (61).
Herein, we describe a new method for combining magnetic
relaxation switching properties of CLIO nanoparticles with
aptamer technology in order to create MRI contrast agents with
nanomolar detection limit. The advantage of this technique over
other sensing methods is that MRI signal is much less vulnerable
to changes in background colors or fluorescence from biological
media, such as serum and cell suspensions. In contrast to our
previously reported system with adenosine, which depends on
analyte-induced disassembly of particles to produce an increase
in brightness, this method is based on assembly of particles
leading to a decrease in brightness of MR image. This change
in signal from bright to dark is a significant advantage, as this
is preferred in T2-weighted MR imaging. Furthermore, instead
of a metabolite, we demonstrate the detection of a protein in
the current system, as proteins constitute most enzymes and
biomolecular markers in living systems.
To demonstrate the use of aptamer functionalized CLIO
nanoparticles for protein detection we chose to detect thrombin
* Fax: (+1) 217-333-2685. Tel: (+1) 217-333-2619. E-mail yi-lu@
uiuc.edu.
†Center for Biophysics and Computational Biology.
‡Beckman Institute for Advanced Science and Technology.
§Department of Chemistry.
4Department of Biochemistry.
Bioconjugate Chem. 2008, 19, 412–417
412
10.1021/bc7003928 CCC: $40.75
 2008 American Chemical Society
Published on Web 01/04/2008

Page 2

via MRI . We combined the CLIO nanoparticles with thrombin
aptamers, Thrm-A, which binds to the fibrinogen-recognition
exosite of thrombin, and Thrm-B, which binds to the heparin-
binding exosite of thrombin, as shown in Scheme 1 (62, 63).
The contrast agent designed for thrombin detection is composed
of a 1:1 mixture of Thrm-A and Thrm-B functionalized CLIO
nanoparticles (CLIO-Thrm-A and CLIO-Thrm-B, respectively)
in aqueous solution. In the presence of thrombin, aptamer
sequences fold into a G-quadruplex arrangement in order to bind
to thrombin (64, 65). After attachment of the CLIO nanoparticles
to thrombin, the disperse nanoparticles assemble into aggregates,
changing the magnetic relaxation properties of nearby water
protons, thereby reducing the T2 relaxation time. This event
can be monitored as a decrease in brightness of T2-weighted
MR image of the solution via MRI (24).
To confirm that the aptamer functionalized nanoparticles bind
to thrombin, 1 µM thrombin was added into the 1:1 homoge-
Materials: All DNA samples were purchased from Integrated DNA
Technologies Inc. (Coralville, IA). The thiol-modified DNA molecules
were purified by the standard desalting method. Human alpha thrombin
was purchased from Haematologic Technologies Inc. (Essex Junction,
VT). BSA was purchased from Aldrich (St. Louis, MO). Streptavidin
was purchased from SouthernBiotech (Birmingham, AL). N-Succin-
imidyl-3-(2-pyridylthio)-propionate (SPDP) was purchased from Mo-
lecular Biosciences (Boulder, CO). Cross-linked dextran coated super-
paramagnetic iron oxide nanoparticles (CLIO, 500 µg Fe mL-1) were
synthesized and coupled to SPDP according to literature procedure and
purified with PD-10 column (17). The thiol modified oligos, Thrm-A
(5′ SH-T15-GGTTGGTGTGGTTGG 3′), Thrm-B (5′ SH-TTTTTAGTC-
CGTGGTAGGGCAGGTTGGGGTGACT 3′), CNT-Thrm-A (5′ TCA-
CAGATGAGT-A12-SH 3′), and CNT-Thrm-B (5′ SH-CCCAGGT-
TCTCT 3′) were activated by incubating with eight equivalent of tris
(2-carboxyethyl) phosphine hydrochloride (TCEP). Excess TCEP was
removed by desalting using a SepPak C-18 catridge. TCEP-activated
thiol modified DNA (50 µM final concentration) was mixed with CLIO-
SPDP (400 µg Fe mL-1) in 100 mM phosphate buffer at pH 8.0
overnight. Excess DNA was removed by magnetic separation column
(Miltenyi Biotec, Auburn, CA) from CLIO-DNA conjugates. Sample
preparation and MRI detection: CLIO-Thrm-A and CLIO-Thrm-B were
mixed in 1:1 ratio and diluted in 100 mM NaCl, 25 mM KCl, and 25
mM tris-HCl buffer at pH 7.4. 250 µL of sample (12 µg Fe mL-1)
was aliquoted into the wells of a microplate and varying amounts of
analyte was added in each well. T2-weighted MR images were obtained
on a 4.7 T NMR instrument using a spin–echo pulse sequence with
variable echo time (TE ) 25–100 ms) and repetition time (TR) of 3000
ms. Light-scattering experiments: DLS measurements were performed
using Nicomp 380 ZLS Particle Sizer (Particle Sizing Systems, Santa
Barbara, CA). An intensity-weighted value was used to report the
average particle diameter.
Scheme 1. Schematic Illustration for Thrombin Detection Using MRIa
aThe CLIO nanoparticles (shown as red spheres) have been modified with either Thrm-A, a DNA aptamer (shown as blue lines) that binds to
fibrinogen-recognition exosite of thrombin, or Thrm-B, a DNA aptamer (shown as green lines) that binds to the heparin-binding exosite of thrombin.
Addition of thrombin consisting of both fibrinogen (as blue donuts) and heparin (as green donuts) exosites resulted in aggregation of CLIO nanoparticle
assembly, reducing the T2 relaxation time. The DNA sequences are shown at the bottom. The drawing is not to scale.
Figure 1. Particle size distribution of 1:1 CLIO-Thrm-A and CLIO-
Thrm-B mixture before (light gray bars) and after (dark gray bars)
addition of 50 nM thrombin.
CommunicationsBioconjugate Chem., Vol. 19, No. 2, 2008 413

Page 3

neous mixture of CLIO-Thrm-A and CLIO-Thrm-B (150 µg
Fe mL-1), which resulted in rapid precipitation in seconds (data
not shown). Similar behavior was not observed when bovine
serum albumin (BSA) or streptavidin was used as an analyte.
This result indicates that the precipitation of nanoparticles is
due to the binding event of analyte and its aptamer. Particle
size analysis also showed that, upon addition of 50 nM thrombin
into a mixture of CLIO-Thrm-A and CLIO-Thrm-B (12 µg Fe
mL-1), the average diameter of CLIO nanoparticles immediately
increased from 58.9 ( 4.4 nm to 259.5 ( 22.5 nm. Figure 1
shows the intensity-weighted particle size distribution of CLIO
nanoparticles obtained with dynamic light scattering (DLS),
which indicates that the nanoparticles are cross-linked by
thrombin molecules, therefore increasing the average diameter.
At this CLIO nanoparticle concentration, precipitation of
nanoparticles was not observed (19). These results strongly
suggest that thrombin binding to aptamers on CLIO nanopar-
ticles induces the assembly of nanoparticles.
After confirming thrombin-induced assembly of nanoparticles
via DLS, we proceeded to check its utility as an MRI contrast
agent. The binding of CLIO-Thrm-A and CLIO-Thrm-B to
thrombin, assembled the nanoparticles into clusters, resulting
in a decrease of the T2 relaxation time of the neighboring water
protons in the medium. We have tested the system at different
thrombin concentrations from 0 to 50 nM. A decrease in
brightness of the MR image of the samples was observed as
the concentration of thrombin was increased (Figure 2A), which
was attributed to a decrease in T2 relaxation time (24). A
Figure 2. (A) Contrast change in T2-weighted MR image in 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture with 0, 10, 25, and 50 nM thrombin
(first column), BSA (second column), and streptavidin (third column). (B) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM
thrombin in CLIO-Thrm-A and CLIO-Thrm-B mixture (first column), and in CNT-CLIO-Thrm-A and CNT-CLIO-Thrm-B mixture (second column).
Figure 3. (A) Contrast change in T2-weighted MR image with 0, 10, 25, and 50 nM thrombin in CLIO-Thrm-A (first column), CLIO-Thrm-A and
CLIO-Thrm-B mixture. (Note: The image is completely dark at 50 nM thrombin) (second column) and in CLIO-Thrm-B (third column). (B)
Particle diameter change with CLIO-Thrm-A, 1:1 CLIO-Thrm-A and CLIO-Thrm-B mixture, or CLIO-Thrm-B with addition of thrombin.
Figure 4. T2-weighted MR image of 1:1 CLIO-Thrm-A and CLIO-
Thrm-B mixture in human serum.
414 Bioconjugate Chem., Vol. 19, No. 2, 2008Communications

Page 4

noticeable change in contrast was observed even as low as 10
nM thrombin, and a significant change was observed at 50 nM
thrombin.
To ensure that the contrast is solely due to the binding event
and not any other artifact, the system was tested with BSA and
streptavadin. The MR images obtained with these two analytes
did not show a difference in contrast when their concentration
was increased from 0 to 50 nM. This result suggests that the
change in contrast is due to thrombin and not any other effect.
In order to check if the change in contrast is due to aptamer
and analyte binding and not thrombin molecule itself, we have
tested random DNA sequences of different lengths that do not
bind to thrombin. To do so, we prepared a 1:1 mixture of random
DNA sequence (CNT-Thrm-A and CNT-Thrm-B) functionalized
CLIO nanoparticles (CNT-CLIO-Thrm-A and CNT-CLIO-
Thrm-B). The control samples were subjected to the same
procedure as was used in preparing CLIO-Thrm-A and CLIO-
Thrm-B, and then placed into the wells of a microplate.
Thrombin was added to both systems with an increasing
concentration from 0 to 50 nM. The obtained MR images
showed a change in brightness for samples with CLIO-Thrm-A
and CLIO-Thrm-B, but no change with CNT-CLIO-Thrm-A and
CNT-CLIO-Thrm-B (see Figure 2B). This result suggests that
the change in the MR signal is due to active thrombin binding
aptamers and not any other nonspecific interaction of DNA with
thrombin. The two control experiments taken together strongly
indicate that the change in MR signal is solely due to the binding
event of thrombin to the aptamers, which results in assembly
of CLIO nanoparticles into clusters, decreasing the T2 relaxation
time of the environment.
In order to demonstrate that thrombin molecule requires a
mixture of CLIO-Thrm-A and CLIO-Thrm-B to generate a MR
signal, we tried to use only CLIO-Thrm-A or CLIO-Thrm-B to
detect thrombin. As seen in Figure 3A, the MR signal did not
change with neither of these nanoparticle suspensions, but a
clear change in MR signal was observed with the 1:1 mixture
of nanoparticles. The particle size analysis confirms this result,
as an increase in particle diameter was observed when thrombin
was added into the 1:1 mixture of nanoparticles, but such an
increase was not observed with CLIO-Thrm-A or CLIO-Thrm-B
alone (see Figure 3B). MR data and particle size analysis
together suggest that both CLIO-Thrm-A and CLIO-Thrm-B
are necessary for detection of thrombin with magnetic relaxation
switching.
To check the utility of this system in biological fluids, we
tested our sample in 50% human serum. A clear change in the
MR signal was observed with 25 nM, and a significant change
was seen with 75 nM thrombin (Figure 4). This result
demonstrates that the system works in human serum without
interference of biological components in serum.
In conclusion, we demonstrated aptamer functionalized su-
perparamagnetic iron oxide nanoparticles for detection of an
analyte, which is dependent upon the binding event of aptamer
conjugated CLIO nanoparticles and the target molecule. The
system demonstrated here is specific to thrombin and the
sensitivity is as low as 10 nM. Similar approaches can be applied
to other aptamer and CLIO nanoparticle systems.
ACKNOWLEDGMENT
The authors thank Natasha Yeung for helpful discussions and
for comments on the manuscript and Dr. Boris Odintsov for
his help in operating the MRI equipment. This material is based
upon work supported by the National Science Foundation
(DMR-0117792, DMI-0328162, and CTS-0120978), the U.S.
Army Research Office (DAAD19-03-1-0227), and Biomedical
Imaging Center of the Beckman Institute for Advanced Science
and Technology and University of Illinois at Urbana–Cham-
paign.
LITERATURE CITED
(1) Carr, D. H., Brown, J., Bydder, G. M., Steiner, R. E.,
Weinmann, H. J., Speck, U., Hall, A. S., and Young, I. R. (1984)
Gadolinium-DTPA as a contrast agent in MRI: initial clinical
experience in 20 patients. Am. J. Roentgenol. 143, 215–224.
(2) Kabalka, G., Buonocore, E., Hubner, K., Moss, T., Norley, N.,
and Huang, L. (1987) Gadolinium-labeled liposomes: targeted
MR contrast agents for the liver and spleen. Radiology 163, 255–
258.
(3) Weissleder, R., Hahn, P. F., Stark, D. D., Rummeny, E., Saini,
S., Wittenberg, J., and Ferrucci, J. T. (1987) MR imaging of
splenic metastases: ferrite-enhanced detection in rats. Am. J.
Roentgenol. 149, 723–726.
(4) Josephson, L., Lewis, J., Jacobs, P., Hahn, P. F., and Stark,
D. D. (1988) The effects of iron oxides on proton relaxivity.
Magn. Reson. Imaging 6, 647–653.
(5) Saeed, M., Wagner, S., Wendland, M. F., Derugin, N.,
Finkbeiner, W. E., and Higgins, C. B. (1989) Occlusive and
reperfused myocardial infarcts: differentiation with Mn-DPDP–
enhanced MR imaging. Radiology 172, 59–64.
(6) Li, W.-h., Fraser, S. E., and Meade, T. J. (1999) A calcium-
sensitive magnetic resonance imaging contrast agent. J. Am.
Chem. Soc. 121, 1413–1414.
(7) Harisinghani, M. G., Barentsz, J., Hahn, P. F., Deserno, W. M.,
Tabatabaei, S., van de Kaa, C. H., de la, R. J., and Weissleder,
R. (2003) Noninvasive detection of clinically occult lymph-node
metastases in prostate cancer. N. Engl. J. Med. 348, 2491–2499.
(8) Lee, J., Zylka, M. J., Anderson, D. J., Burdette, J. E., Woodruff,
T. K., and Meade, T. J. (2005) A steroid-conjugated contrast
agent for magnetic resonance imaging of cell signaling. J. Am.
Chem. Soc. 127, 13164–13166.
(9) Frullano, L., Tejerina, B., and Meade, T. J. (2006) Synthesis
and characterization of a doxorubicin-Gd(III) contrast agent
conjugate: A new approach toward prodrug-procontrast com-
plexes. Inorg. Chem. 45, 8489–8491.
(10) Kresse, M., Wagner, S., Pfefferer, D., Lawaczeck, R., Elste,
V., and Semmler, W. (1998) Targeting of ultrasmall superpara-
magnetic iron oxide (USPIO) particles to tumor cells in vivo by
using transferrin receptor pathways. Magn. Reson. Med. 40, 236–
242.
(11) Enochs, W. S., Harsh, G., Hochberg, F., and Weissleder, R.
(1999) Improved delineation of human brain tumors on MR
images using a long-circulating, superparamagnetic iron oxide
agent. J. Magn. Reson. Imaging 9, 228–232.
(12) Dodd, C. H., Hsu, H.-C., Chu, W.-J., Yang, P., Zhang, H.-
G., Mountz, J. D., Zinn, K., Forder, J., Josephson, L., Weissleder,
R., Mountz, J. M., and Mountz, J. D. (2001) Normal T-cell
response and in vivo magnetic resonance imaging of T cells
loaded with HIV transactivator-peptide-derived superparamag-
netic nanoparticles. J. Immunol. Methods 256, 89–105.
(13) Kooi, M. E., Cappendijk, V. C., Cleutjens, K. B. J. M.,
Kessels, A. G. H., Kitslaar, P. J. E. H. M., Borgers, M., Frederik,
P. M., Daemen, M. J. A. P., and van Engelshoven, J. M. A.
(2003) Accumulation of ultrasmall superparamagnetic particles
of iron oxide in human atherosclerotic plaques can be detected
by in vivo magnetic resonance imaging. Circulation 107, 2453–
2458.
(14) Artemov, D., Mori, N., Okollie, B., and Bhujwalla, Z. M.
(2003) MR molecular imaging of the Her-2/neu receptor in breast
cancer cells using targeted iron oxide nanoparticles. Magn. Reson.
Med. 49, 403–408.
(15) Corot, C., Petry, K. G., Trivedi, R., Saleh, A., Jonkmanns,
C., Le, B. J.-F., Blezer, E., Rausch, M., Brochet, B., Foster-
Gareau, P., Baleriaux, D., Gaillard, S., and Dousset, V. (2004)
Macrophage imaging in central nervous system and in carotid
atherosclerotic plaque using ultrasmall superparamagnetic iron
CommunicationsBioconjugate Chem., Vol. 19, No. 2, 2008 415

Page 5

oxide in magnetic resonance imaging. InVest. Radiol. 39, 619–
625.
(16) Nitin, N., LaConte, L. E. W., Zurkiya, O., Hu, X., and Bao,
G. (2004) Functionalization and peptide-based delivery of
magnetic nanoparticles as an intracellular MRI contrast agent.
J. Biol. Inorg. Chem. 9, 706–712.
(17) Josephson, L., Tung, C.-H., Moore, A., and Weissleder, R.
(1999) High-efficiency intracellular magnetic labeling with novel
superparamagnetic-Tat peptide conjugates. Bioconjugate Chem.
10, 186–191.
(18) Lewin, M., Carlesso, N., Tung, C.-H., Tang, X.-W., Cory,
D., Scadden, D. T., and Weissleder, R. (2000) Tat peptide-
derivatized magnetic nanoparticles allow in vivo tracking and
recovery of progenitor cells. Nat. Biotechnol. 18, 410–414.
(19) Josephson, L., Perez, J. M., and Weissleder, R. (2001)
Magnetic nanosensors for the detection of oligonucleotide
sequences. Angew. Chem., Int. Ed. 40, 3204–3206.
(20) Perez, J. M., Josephson, L., and Weissleder, R. (2004) Use
of magnetic nanoparticles as nanosensors to probe for molecular
interactions. ChemBioChem 5, 261–264.
(21) Zhao, M., Kircher, M. F., Josephson, L., and Weissleder, R.
(2002) Differential conjugation of Tat peptide to superparamag-
netic nanoparticles and its effect on cellular uptake. Bioconjugate
Chem. 13, 840–844.
(22) Zhao, M., Josephson, L., Tang, Y., and Weissleder, R. (2003)
Magnetic sensors for protease assays. Angew. Chem., Int. Ed.
42, 1375–1378.
(23) Perez, J. M., Simeone, F. J., Saeki, Y., Josephson, L., and
Weissleder, R. (2003) Viral-induced self-assembly of magnetic
nanoparticles allows the detection of viral particles in biological
media. J. Am. Chem. Soc. 125, 10192–10193.
(24) Tsourkas, A., Hofstetter, O., Hofstetter, H., Weissleder, R.,
and Josephson, L. (2004) Magnetic relaxation switch immun-
osensors detect enantiomeric impurities. Angew. Chem., Int. Ed.
43, 2395–2399.
(25) Ellington, A. D., and Szostak, J. W. (1990) In vitro selection
of RNA molecules that bind specific ligands. Nature (London)
346, 818–822.
(26) Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands
by exponential enrichment: RNA ligands to bacteriophage T4
DNA polymerase. Science 249, 505–510.
(27) Wilson, D. S., and Szostak, J. W. (1999) In vitro selection of
functional nucleic acids. Annu. ReV. Biochem. 68, 611–647.
(28) Famulok, M., Mayer, G., and Blind, M. (2000) Nucleic acid
aptamers-from selection in vitro to applications in vivo. Acc.
Chem. Res. 33, 591–599.
(29) Drolet, D. W., Moon-McDermott, L., and Romig, T. S. (1996)
An enzyme-linked oligonucleotide assay. Nat. Biotechnol. 14,
1021–1025.
(30) Wang, Y., Killian, J., Hamasaki, K., and Rando, R. R. (1996)
RNA molecules that specifically and stoichiometrically bind
aminoglycoside antibiotics with high affinities. Biochemistry 35,
12338–12346.
(31) Jayasena, S. D. (1999) Aptamers: an emerging class of
molecules that rival antibodies in diagnostics. Clin. Chem. 45,
1628–1650.
(32) Liss, M., Petersen, B., Wolf, H., and Prohaska, E. (2002) An
aptamer-based quartz crystal protein biosensor. Anal. Chem. 74,
4488–4495.
(33) Yamamoto, R., Baba, T., and Kumar, P. K. (2000) Molecular
beacon aptamer fluoresces in the presence of Tat protein of HIV-
1. Genes Cells 5, 389–96.
(34) Jhaveri, S. D., Kirby, R., Conrad, R., Maglott, E. J., Bowser,
M., Kennedy, R. T., Glick, G., and Ellington, A. D. (2000)
Designed signaling aptamers that transduce molecular recognition
to changes in fluorescence intensity. J. Am. Chem. Soc. 122,
2469–2473.
(35) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2000)
Fluorescent sensors based on aptamer self-assembly. J. Am.
Chem. Soc. 122, 11547–11548.
(36) Li, J., and Lu, Y. (2000) A highly sensitive and selective
catalytic DNA biosensor for lead ions. J. Am. Chem. Soc. 122,
10466–10467. .
(37) Hamaguchi, N., Ellington, A., and Stanton, M. (2001) Aptamer
beacons for the direct detection of proteins. Anal. Biochem. 294,
126–131.
(38) Fang, X., Cao, Z., Beck, T., and Tan, W. (2001) Molecular
aptamer for real-time oncoprotein platelet-derived growth factor
monitoring by fluorescence anisotropy. Anal. Chem. 73, 5752–
5757.
(39) Stojanovic, M. N., de Prada, P., and Landry, D. W. (2001)
Aptamer-based folding fluorescent sensor for cocaine. J. Am.
Chem. Soc. 123, 4928–4931.
(40) Li, J. J., Fang, X., and Tan, W. (2002) Molecular aptamer
beacons for real-time protein recognition. Biochem. Biophys. Res.
Commun. 292, 31–40.
(41) Nutiu, R., and Li, Y. (2003) Structure-switching signaling
aptamers. J. Am. Chem. Soc. 125, 4771–4778.
(42) Nutiu, R., and Li, Y. (2004) Structure-switching signaling
aptamers: Transducing molecular recognition into fluorescence
signaling. Chem.sEur. J. 10, 1868–1876.
(43) Chen, Y., Wang, M., and Mao, C. (2004) An autonomous
DNA nanomotor powered by a DNA enzyme. Angew. Chem.,
Int. Ed. 43, 3554–3557.
(44) Nutiu, R., Mei, S., Liu, Z., and Li, Y. (2004) Engineering
DNA aptamers and DNA enzymes with fluorescence-signaling
properties. Pure Appl. Chem. 76, 1547–1561.
(45) Liu, Y., Lin, C., Li, H., and Yan, H. (2005) Aptamer-directed
self-assembly of protein arrays on a DNA nanostructure. Angew.
Chem., Int. Ed. 44, 4333–4338.
(46) Tian, Y., and Mao, C. (2005) DNAzyme amplification of
molecular beacon signal. Talanta 67, 532–537.
(47) Navani, N. K., and Li, Y. (2006) Nucleic acid aptamers and
enzymes as sensors. Curr. Opin. Chem. Biol. 10, 272–281.
(48) Stojanovic, M. N., and Landry, D. W. (2002) Aptamer-based
colorimetric probe for cocaine. J. Am. Chem. Soc. 124, 9678–
9679.
(49) Liu, J., and Lu, Y. (2003) A colorimetric lead biosensor using
DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem.
Soc. 125, 6642–6643.
(50) Pavlov, V., Xiao, Y., Shlyahovsky, B., and Willner, I. (2004)
Aptamer-functionalized Au nanoparticles for the amplified optical
detection of thrombin. J. Am. Chem. Soc. 126, 11768–11769.
(51) Liu, J., and Lu, Y. (2004) Adenosine-dependent assembly of
aptazyme-functionalized gold nanoparticles and its application
as a colorimetric biosensor. Anal. Chem. 76, 1627–1632.
(52) Ho, H.-A., and Leclerc, M. (2004) Optical sensors based on
hybrid aptamer/conjugated polymer complexes. J. Am. Chem.
Soc. 126, 1384–1387.
(53) Huang, C.-C., Huang, Y.-F., Cao, Z., Tan, W., and Chang,
H.-T. (2005) Aptamer-modified gold nanoparticles for colori-
metric determination of platelet-derived growth factors and their
receptors. Anal. Chem. 77, 5735–5741.
(54) Liu, J., and Lu, Y. (2006) Fast colorimetric sensing of
adenosine and cocaine based on a general sensor design involving
aptamers and nanoparticles. Angew. Chem., Int. Ed. 45, 90–94.
(55) Liu, J., and Lu, Y. (2007) Non-base pairing DNA provides a
new dimension for controlling aptamer-linked nanoparticles and
sensors. J. Am. Chem. Soc. 129, 8634–8643.
(56) Lu, Y., and Liu, J. (2006) Functional DNA nanotechnology:
emerging applications of DNAzymes and aptamers. Curr. Opin.
Biotechnol. 17, 580–588.
(57) Lu, Y., and Liu, J. (2007) Smart nanomaterials inspired by
biology: dynamic assembly of error-free nanomaterials in
response to multiple chemical and biological stimuli. Acc. Chem.
Res. 40, 315–323.
(58) Xu, D., Xu, D., Yu, X., Liu, Z., He, W., and Ma, Z. (2005)
Label-free electrochemical detection for aptamer-based array
electrodes. Anal. Chem. 77, 5107–5113.
416 Bioconjugate Chem., Vol. 19, No. 2, 2008Communications