Multiple DNA-binding sites in Tetrahymena telomerase.

Abstract

Telomerase is a ribonucleoprotein enzyme that maintains chromosome ends through de novo addition of telomeric DNA. The ability of telomerase to interact with its DNA substrate at sites outside its catalytic centre ('anchor sites') is important for its unique ability to undergo repeat addition processivity. We have developed a direct and quantitative equilibrium primer-binding assay to measure DNA-binding affinities of regions of the catalytic protein subunit of recombinant Tetrahymena telomerase (TERT). There are specific telomeric DNA-binding sites in at least four regions of TERT (the TEN, RBD, RT and C-terminal domains). Together, these sites contribute to specific and high-affinity DNA binding, with a K(d) of approximately 8 nM. Both the K(m) and K(d) increased in a stepwise manner as the primer length was reduced; thus recombinant Tetrahymena telomerase, like the endogenous enzyme, contains multiple anchor sites. The N-terminal TEN domain, which has previously been implicated in DNA binding, shows only low affinity binding. However, there appears to be cooperativity between the TEN and RNA-binding domains. Our data suggest that different DNA-binding sites are used by the enzyme during different stages of the addition cycle.

Full text

Page 1

1260–1272
doi:10.1093/nar/gkm866
Nucleic Acids Research, 2008, Vol. 36, No. 4 Published online 3 January 2008
Multiple DNA-binding sites in Tetrahymena telomerase
Sharon N. Finger and Tracy M. Bryan*
Children’s Medical Research Institute, 214 Hawkesbury Road, Westmead NSW 2145 and University of Sydney,
NSW 2006, Australia
Received July 26, 2007; Revised September 13, 2007; Accepted September 24, 2007
ABSTRACT
Telomerase is a ribonucleoprotein enzyme that
maintains chromosome ends through de novo
addition of telomeric DNA. The ability of telomerase
to interact with its DNA substrate at sites outside its
catalytic centre (‘anchor sites’) is important for its
unique ability to undergo repeat addition processiv-
ity. We have developed a direct and quantitative
equilibrium primer-binding assay to measure DNA-
binding affinities of regions of the catalytic protein
subunit of recombinant Tetrahymena telomerase
(TERT). There are specific telomeric DNA-binding
sites in at least four regions of TERT (the TEN, RBD,
RT and C-terminal domains). Together, these sites
contribute to specific and high-affinity DNA binding,
with a Kdof ?8nM. Both the Kmand Kdincreased in
a stepwise manner as the primer length was
reduced; thus recombinant Tetrahymena telomer-
ase, like the endogenous enzyme, contains multiple
anchor sites. The N-terminal TEN domain, which has
previously been implicated in DNA binding, shows
only low affinity binding. However, there appears to
be cooperativity between the TEN and RNA-binding
domains. Our data suggest that different DNA-
binding sites are used by the enzyme during
different stages of the addition cycle.
INTRODUCTION
Telomeres form a protective cap on the ends of chromo-
somes and are composed of short G-rich DNA repeats
bound by sequence-specific proteins (reviewed in 1).
The telomeres of unicellular eukaryotes and of the germ
cells of multicellular organisms are maintained by the
ribonucleoprotein enzyme telomerase, which was first
identified in the ciliated protozoan Tetrahymena thermo-
phila (2). Telomerase activity has been detected in ?90%
of human cancers, providing a telomere maintenance
mechanism that is necessary for their unlimited growth
(3–5).
The protein catalytic subunit of telomerase, telomerase
reverse transcriptase (TERT, ref. 6), contains protein
motifs that are conserved with other reverse transcriptases
(‘RT motifs’) and motifs in its amino terminal region
that are conserved among TERTs from different species.
A defined region of the telomerase RNA subunit is used as
the template for addition of DNA repeats onto telomeres
(7). A complex consisting of TERT and telomerase RNA
is sufficient to reconstitute in vitro telomerase activity from
Tetrahymena and human enzymes, measured by proces-
sive extension of a DNA oligonucleotide with telomere
repeats (8,9). The repeated copying of a short segment of
RNA, followed by translocation to the beginning of this
sequence, leads to the unique property of telomerase
known as ‘repeat addition processivity’. While in vitro
activity of the recombinant enzyme is robust, recombinant
Tetrahymena telomerase is less processive than its
endogenous counterpart (9,10).
The interactions of telomerase with its DNA substrate
have beenstudiedusing
Tetrahymena extracts. High concentrations of short
oligonucleotide primers (<10nt) were required to achieve
efficient extension (11,12). For longer oligonucleotides,
primer affinity, as measured by activity (Km), varied with
different sequences at the 50end of the primer (11).
Telomerase was able to extend a non-telomeric primer
bearing telomeric sequences at its 50end with nanomolar
affinity (13). Sequences at the 50end of the primer also
affected the processivity of endogenous human telomerase
(14). These observations led to the proposal that
telomerase contains a DNA-binding site outside the
template region, called the ‘anchor site’ (12,14). It was
proposed that the anchor site is necessary for repeat
addition processivity, by allowing the enzyme to remain
bound to the 50end of its DNA substrate during
translocation. Thus, in order to fully understand the
unique mechanism of telomerase, it is necessary to know
more about the nature of the anchor site.
There is evidence for telomerase from several species
that there are multiple sites of interaction with different
regions of the primer (11,15–17). For example, the affinity
ofendogenousTetrahymena
decreased in a stepwise manner as the primer was reduced
in length from 12 to 10nt then 6nt (11), and two 50regions
purifiedtelomerase from
telomeraseforDNA
*To whom correspondence should be addressed. Tel: +61 2 9687 2800; Fax: +61 2 9687 2120; Email: tbryan@cmri.usyd.edu.au
? 2008 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 2

of a 24nt primer influenced yeast telomerase activity (15).
These different sites have been dubbed the ‘template-
proximal’ and ‘template-distal’ anchor sites (17). For
Tetrahymena at least, it is possible that there are even
more distal sites of interaction between DNA and protein,
which may be important for binding to non-telomeric
sequences (18). While both the template-proximal and
template-distal anchor sites have an effect on repeat
addition processivity (14,17,19), the fact that both
recombinant and endogenous Tetrahymena telomerase
can extend even primers as short as 4nt with reasonable
processivity shows that neither is absolutely necessary for
this property (19, our unpublished data).
Although evidence for direct interactions with the
TERT protein have been obtained by DNA crosslinking
to telomerase from Tetrahymena, the ciliate Euplotes
aediculatus and yeast (20–24), it is unclear which anchor
sites reside in the TERT protein and which are provided
by other members of the enzyme complex. There is some
evidence from activity-based assays for interactions of
DNA with various regions of TERT. Deletion of the
TERT-specific C-terminal extension of yeast TERT led to
a modest (?2-fold) decrease in primer-binding affinity
(25); the fact that mutations in this region in human
TERT led to a moderate decrease in repeat addition
processivity suggests that this function may be conserved
among species (26). A mutation in a TERT-specific region
of the RT domain reduced repeat addition processivity
of yeast telomerase, suggesting that this region may
also interact with DNA (27).
Recently, evidence has been presented that a region
within the N-terminal 200 amino acids of TERT (known
as the GQ or TEN domain) may be involved in anchor site
interactions. This region of TERT has the ability to form a
soluble, protease-resistant, independently folded structure
(24,28,29). Complementation studies with fragments of
human TERT indicate that this region (together with an
adjacent linker domain) can interact in trans with the rest
of the TERT protein (30–32). There may, however, be
species differences in the function of this domain, since
its removal leads to a loss of processivity of human
telomerase (32,33) but a complete loss of activity of
Tetrahymena telomerase (29,34).
A mutation in the TEN domain of yeast TERT led to
altered utilization of primers with non-telomeric 50ends
(22). A mutation within this region in human TERT
caused a slight decrease in affinity for a 9nt primer but not
an 18nt primer, indicating that this part of TERT may
interact with the 9nt at the 30end of the primer (17).
Human TERT proteins containing mutations in this
region were also defective in elongation of telomeric
primers (35). Direct evidence for the involvement of this
region in DNA binding was provided by the demonstra-
tion that mutations in this region in Tetrahymena TERT
led to decreased crosslinking to a primer containing
5-iodo-deoxyuridine (5-iodo-dU) substitutions at its 50
end (24), and the site of crosslinking to a short primer was
mapped to a particular amino acid within TEN (W187)
(23). Finally, a fragment of human TERT encompassing
TEN bound to a biotinylated primer, though in a
non-sequence-specific manner (36).
While these studies provide an informative start in
understanding telomerase–DNA interactions, they do not
address relative contributions from the different regions
of the TERT protein. To directly and quantitatively
measure binding affinities of defined regions of TERT,
we developed an activity-independent assay for primer
binding to recombinant Tetrahymena telomerase. We used
this direct equilibrium binding assay, in combination with
UV crosslinking, to assess primer affinities of domains
of the TERT protein. Since the assay is independent of
activity, we were also able to use it to assess the level
of RNA-independent binding of DNA to TERT, bearing
in mind that such binding may not be identical to that in
the intact enzyme. These quantitative studies provide new
insights into the complexity of the telomerase anchor site.
MATERIALS AND METHODS
Plasmids and oligonucleotides
The construction of a synthetic Tetrahymena thermophila
TERT gene and its insertion into a pET-28 plasmid
encoding an N-terminal FLAG tag and a T7 promoter
have been previously described (10,37). A version of
this plasmid containing a BamHI site between the FLAG
tag and TERT was constructed in order to simplify
subsequent cloning steps. This plasmid (FLAG-Bam-
TERT) was made with site-directed mutagenesis using
the Quick Change II kit (Stratagene) according to the
manufacturer’s instructions. To construct a plasmid
encoding FLAG-tagged amino acids 1–519 of TERT
(plasmid FLAG-N519), this fragment was amplified using
primers50-GTCGCAGGCGTCTGTTTGAATCAGTA
CTTTTC TGTC (forward) and 50-CAGGATCTCGAG
TCACAATTTTTCTTCCACTTTCTC (reverse), digested
with ScaI and XhoI and cloned into the ScaI and XhoI
sites of FLAG-TERT. To construct a plasmid encoding
FLAG-tagged amino acids 520-1117 of TERT (plasmid
FLAG-C598), this fragment was amplified using primers
50-GATATACCATGGCTGACTACAAGGACGACGA
TGACAAGCATATGGGGGGATCCATCCCAGAAG
ATTCATTTCAG (forward) and 50-CAGTGTCTTAAT
GTCCTGTATGAGGTTATTTAAATCTATGAATTC
AATAGCCTCCAGTTCTTTTTTGTTCAGCTG
(reverse), digested with NcoI and EcoRI and cloned into
the NcoI and EcoRI sites of FLAG-TERT. To construct a
plasmid encoding FLAG-tagged amino acids 192–519 of
TERT (plasmid FLAG-RBD), this fragment was ampli-
fied using primers 50-CATATGGGGGGATCCTTTAA
TATGAACGGGAAAGCT (forward) and 50-CAGGAT
CTCGAGTCACAATTTTTCTTCCACTTTCTC
(reverse), digested with BamHI and XhoI and cloned
into the BamHI and XhoI sites of FLAG-Bam-TERT.
To construct a plasmid encoding FLAG-tagged amino
acids 1–884 of TERT (plasmid FLAG-?C233), this frag-
ment was amplified using primers 50-GCACTGAATCTG
ATTGTACAACTCCAGAACTGTGCAAAC (forward)
and 50-CAGGATCTCGAGTCAGTTCATGTCGATGC
TTTTCCC (reverse), digested with BsrGI and XhoI and
cloned into the BsrGI and XhoI sites of FLAG-
Bam-TERT. pET-28 plasmids containing amino acids
Nucleic Acids Research, 2008, Vol. 36, No. 41261

Page 3

2–191 (TEN or GQ) and 192–1117 (?TEN or TERT-
?GQ) were a kind gift from Drs Thomas Cech and Steven
Jacobs at the University of Colorado, Boulder, CO, USA
(29). To construct a plasmid encoding FLAG-tagged
amino acids 2–191, the TEN/GQ plasmid was digested
with NdeI and BlpI and cloned into the NdeI and BlpI
sites of FLAG-TERT. For a FLAG-tagged version of
?TEN, the ?TEN plasmid was digested with BamHI and
XhoI and cloned into the BamHI and XhoI sites of
FLAG-Bam-TERT. A plasmid encoding FLAG-tagged
amino acids 1–1094 of TERT (plasmid FLAG-?C23) was
made by site-directed mutagenesis (Quick Change II kit,
Stratagene) of FLAG-Bam-TERT using the primers
50-CTGGAGGCTATTGAATTCATAGATTTAAATTA
ACTCATACAGGAC (forward) and 50-GTCCTGTAT
GAGTTAATTTAAATCTATGAATTCAATAGCCTC
CAG (reverse).
All oligonucleotides were purchased from Sigma-
Genosys. PCR primers were desalted by the manufacturer,
while the oligonucleotides listed in Table 1 were gel
purified on 20% polyacrylamide/8M urea gels before use.
Invitro translation and purification of Tetrahymena
telomerase
Tetrahymena telomerase RNA was transcribed in vitro
from the plasmid pTET-telo (38) as described previously
(10). The RNA was gel-purified before inclusion in in vitro
translation reactions using the plasmids described above
totranslate TERTprotein
Translations were carried out using the TnT T7 Quick
for PCR rabbit reticulocyte lysate system (Promega) as per
the manufacturer’s instructions. Translations included
20ng/ml plasmid DNA, 0.8mCi/ml [35S]methionine and
20nM telomerase RNA.
In vitro reconstituted telomerase was purified by
immunoprecipitation with anti-FLAG M2 affinity agarose
beads (Sigma-Aldrich). Beads (100ml) were washed four
times in 1.3ml of wash buffer-100 (20mM Tris acetate, pH
7.5, 10% glycerol, 1mM EDTA, 5mM MgCl2, 0.1mM
dithiothreitol [DTT], 100mM potassium glutamate),
centrifuging at 1500?g for 2min at 48C between
washes. The beads were incubated twice with 1ml of
blocking buffer [wash buffer-100 plus 0.5mg/ml lysozyme,
0.5mg/ml bovine serum albumin (BSA), 0.05mg/ml
glycogen, 0.1mg/ml yeast RNA] for 15min at 48C with
agitation. Reticulocyte lysate translation reaction (400ml)
was added to 400ml of blocking buffer and centrifuged at
16000?g for 10min at 48C to remove any particulates.
The supernatant from that spin was added to the blocked
beads and agitated at 48C for 2h. The beads were washed
four times in 1.3ml of wash buffer-300 (the same as wash
buffer-100 except with 300mM potassium glutamate),
twice in TMG (10mM Tris acetate pH 8.0, 10% glycerol,
1mM MgCl2) and once in wash buffer-0 (the same as wash
buffer-100 except with no potassium glutamate). For all
experiments except those in Figure 1, telomerase was
eluted from the beads by competition with a 3? FLAG
peptide (Sigma-Aldridge). The beads were resuspended in
200ml of peptide (0.75mg/ml) in wash buffer-0 in a Protein
LoBind tube (Eppendorf). BSA (New England Biolabs)
or fragments thereof.
was added (0.5mg/ml) to prevent telomerase from sticking
to the tube after elution. The bead slurry was rotated at
48C for 1h, centrifuged at 1500?g for 2min at 48C and
the eluate removed to a fresh LoBind tube. Eluted
telomerase had ?3–4-fold greater affinity (Km) for its
DNA primer than did bead-bound telomerase (data not
shown), presumably reflecting a faster on-rate.
The yield of active enzyme was determined by dot
blotting an aliquot of the enzyme along with a dilution
series of Tetrahymena telomeric RNA onto a Hybond N+
membrane (Amersham Biosciences/GE Healthcare) and
detecting the RNA in the telomerase complex by hybridiz-
ing the membrane with a radioactive probe complementary
to Tetrahymena telomerase RNA (50-TATCAGCACTA
GATTTTTGGGGTTGAATG-30). The final concentra-
tion of eluted telomerase was 7–9nM.
In vitro telomerase activity assay
Activity of recombinant telomerase was measured by
incubating 5ml of eluted telomerase in a 10ml reaction
including 1? Telomerase buffer (50mM Tris–Cl, pH 8.3,
1.25mM MgCl2, 5mM DTT), 100mM dTTP and 10mM
[a-32P]dGTP at 80Ci/mmol (0.2ml of non-radioactive
dGTP at 487mM and 0.8ml of [a-32P]dGTP at 10mCi/ml,
3000Ci/mmol; PerkinElmer Life Sciences). Dilutions of
the indicated primers were added to the reactions at
concentrations of 1nM to 5mM (with the concentration
rangedependingonthe lengthoftheprimer).The reactions
were incubated at 308C for 15min (which is within
the linear phase of the reaction) and then terminated
by adding 90ml of TES (50mM Tris–HCl pH 8.3,
20mM EDTAand0.2%
32P-labelled 100-mer oligonucleotide was added as a
recovery and loading control. The reaction products
were phenol/chloroform extracted and ethanol precipi-
tated. The pellet was resuspended in 5ml of formamide
loading dye (90% deionized formamide, 0.1% bromophe-
nol blue, 0.1% xylene cyanol in 1? TBE buffer) and half
SDS).5000cpmofa
Table 1. Oligonucleotides used in this study
NameSequence
18GGGG
18GGT
18GTT
18TTG
18TGG
18TGGG
20GTT
12GTT
6GTT
37TTG
TTGGGGTTGGGGTTGGGG
TGGGGTTGGGGTTGGGGT
GGGGTTGGGGTTGGGGTT
GGGTTGGGGTTGGGGTTG
GGTTGGGGTTGGGGTTGG
GTTGGGGTTGGGGTTGGG
TTGGGGTTGGGGTTGGGGTT
GGGGTTGGGGTT
GGGGTT
GGGGTTGGGGTTGGGGTTGGGGTTG
GGGTTGGGGTTG
AGCCACTATCGACTACGCGATCAT
AGCCACTATCGACTACGCGATCATAGC
CACTATCGACTACGCGATCAT
TTAGGGTTAGGGTTAGGG
PBR
PBR48
(TTAGGG)3
All sequences are listed 50
modified by addition of a biotin, on either the 50(e.g. Bio-18GTT)
or the 30(e.g. PBR48-Bio) end. 20GTT was modified by incorporation
of 5-iodo-deoxyuridine (Figure 5).
to 30. Some oligonucleotides were
1262
Nucleic Acids Research, 2008, Vol. 36, No. 4

Page 4

of each reaction was electrophoresed on a denaturing 10%
polyacrylamide/8M urea sequencing-type gel for 1.25h at
80W. The gel was dried for 30min at 808C, exposed to a
phosphorimager screen and analysed using ImageQuant
5.2 software (Amersham Biosciences/GE Healthcare).
Total intensity of extension products at each substrate
concentration was normalized against the intensity of the
32P-labelled 100-mer loading control. This value was
expressed as percentage of maximum intensity at the
highest primer concentration and plotted against substrate
concentration. This was fitted to a Michaelis–Menten
kinetics equation to yield Km.
Bind-and-chase activity assaytomeasure primer off-rates
A modified telomerase assay was used to measure the rate
of dissociation of primer from recombinant Tetrahymena
telomerase, as previously described (10). Telomeric
oligonucleotides of 18–20nt (Table 1) were preincubated
at a concentration of 200nM with 5ml of immunopurified
telomerase (1:1 bead slurry) in 1? Telomerase buffer at
308C for 15min. A 37-mer competitor primer (37GTT)
was added (final concentration 15mM) and incubated with
the enzyme/primer mixture at 308C for varying lengths of
time (Figure 1). Telomerase activity was initiated by the
addition of nucleotides (either [a-32P]dGTP at 10mM and
ddTTP at 100mM or [a-32P]dTTP at 3.3mM and ddGTP
at 10mM, depending on the permutation of the primer)
and allowed to extend the primers at 308C for 5min.
The reactions were terminated and electrophoresed as
earlier. To determine koff, the intensity of the 18–20-mer
products was quantified, normalized to the combined
intensities of all major extension products (18- and
37-mer) and plotted against time. The data were fit to
the equation y=ae?kt+b, where k=koffand b repre-
sents a background in the experiment of about 5%.
The half life was calculated by using the equation
t½=?{ln[(0.5 – b)/a]}/k.
DNA-binding assayto measureprimer binding toTERT
Oligonucleotides with a 50biotin and PBR48 with a biotin
at the 30end (Table 1) were synthesized and gel-purified
by Sigma-Genosys. UltraLink Immobilized NeutrAvidin
Protein Plus (Pierce) beads (200ml) were washed four
times in 1ml of Protein Pulldown (PP) buffer (50mM Tris
chloride, pH 8.3, 10% glycerol, 1.25mM MgCl2, 5mM
DTT), centrifuging at 1500?g for 2min at 48C between
washes. The beads were incubated twice with 0.5ml
of blocking buffer (PP buffer plus 0.75mg/ml BSA,
0.15mg/ml glycogen, 0.15mg/ml yeast RNA) for 15min
at 48C with agitation and resuspended in 100ml of
blocking buffer. Primer binding of recombinant telomer-
ase was measured by incubating 2.5ml of eluted protein in
a Protein LoBind tube (Eppendorf) in a 20ml reaction
including 1? Telomerase buffer (see earlier), 2500cpm of
33P-labelled PBR48-Bio and the indicated primers at
concentrations of 1nM to 10mM (with the concentration
range depending on the length of the primer and
the fragment of protein). The reactions were incubated
at 308C for 10min, followed by the addition of 20ml
of blocked NeutrAvidin beads and agitation at 48C
Fraction bound
AB
C
18-mer
products
37-mer
products
LC
37TTG alone
18GTT alone
Chase control
00.5 1 1.5 2 3.55 10 15
Chase time (min)
Primer
18GGGG
18GGT
18GTT
18TTG
18TGG
18TGGG
20GTT
koff (min−1) 30°C
1.3 ± 0.4
1.2 ± 0.2
1.16 ± 0.04
0.46 ± 0.08
0.39 ± 0.01
0.52 ± 0.09
0.89 ± 0.08
t1/2 (min)
0.7 ± 0.2
0.7 ± 0.1
0.65 ± 0.02
1.6 ± 0.2
1.91 ± 0.04
1.7 ± 0.4
0.8 ± 0.1
Time (min)
Figure 1. Rate of dissociation from recombinant Tetrahymena telomerase of DNA primers of different permutations. (A) A bind-and-chase
telomerase activity assay (described in the text) was used to measure the dissociation of primer 18GTT (Table 1). The pattern of extension of 18GTT
and the chase primer 37TTG alone, when incubated with ddTTP and [a-32P]dGTP, are shown in the first two lanes. As a control to ensure that the
excess of 37TTG did not allow the enzyme to rebind the 18GTT, both primers were preincubated with enzyme simultaneously prior to telomerase
extension (‘chase control’). LC:32P-labelled 100-mer DNA oligonucleotide used as a recovery and loading control. (B) The amount of signal from
products of 18GTT was normalized to the total telomerase product signal and plotted versus time of chase. Two experiments utilizing the same
primer (18GTT) are shown. (C) The curves shown in B were fit with a single exponential equation (see ‘Experimental Procedures’) to give the off-rate
(koff) and half-life (t1/2) of a set of 18 or 20nt oligonucleotides of different permutations (Table 1). The mean?SD of two to four experiments is
shown.
Nucleic Acids Research, 2008, Vol. 36, No. 41263

Page 5

for 15min. The beads in each reaction tube were washed
four times (1500?g for 2min at 48C) in 100ml of PP-300
buffer (PP buffer plus 300mM lithium acetate; lithium was
used to minimize formation of intermolecular G-quad-
ruplexes) and finally resuspended in 20ml of PP-300 buffer
and 10ml of NuPage 4? Lithium dodecyl sulfate (LDS)
Sample Buffer (Invitrogen) and heated at 958C?3min.
Half of each reaction was electrophoresed on 4–12%
NuPage gels in MES [2-(N-morpholino) ethane sulfonic
acid] buffer (Invitrogen) for 35min at 200V. The gels were
fixed for 15min in 25% isopropanol/10% acetic acid,
dried at 808C for 1h and exposed to a phosphorimager
screen.Totalintensity of protein captured ateach substrate
concentration was normalized against the intensity of the
33P-labelled PBR48-Bio loading control. The signal from
the sample with no oligonucleotide, representing back-
ground binding to the beads, was subtracted from all
others. The resulting value was expressed as percentage of
maximumintensityatthehighestprimerconcentrationand
plotted against substrate concentration [S]. This was fitted
to the following equation: y=(Bmax?[S])U(Kd+[S]),
where Bmaxis the maximal level of binding, to yield Kd.
Crosslinking of5-iodo-dU substituted primers to TERT
20GTT oligonucleotides with 5-iodo-deoxyuridine in
one of four positions (Figure 5A) were synthesized and
gel-purified by Sigma-Genosys. The oligonucleotides were
50-end-labelled with T4 polynucleotide kinase (New
England Biolabs) and unincorporated nucleotides were
removed by purification on a Mini Quick Spin Oligo
column (Roche Applied Science). Labelled oligonucleo-
tides (15–100nM) were incubated with unlabelled in vitro
translated, immunopurified and eluted TERT or fragment
of TERT (?3–4nM) in 1? Telomerase buffer (see earlier)
for 10min at 308C. Reactions contained either no
competitor or 5mM unlabelled specific (20GTT) or non-
specific (PBR) competitor oligonucleotide, as indicated.
Reactions were dispensed onto a parafilm-covered alumi-
nium block sitting on ice, covered with a 4-mm thick
313?3nm bandpass optical filter (Andover Corporation)
and crosslinked in a Stratalinker (Stratagene) with 312nm
bulbs (UviTec) for 45min. After crosslinking, reactions
were electrophoresed on 4–12% NuPage gels in MES
buffer (Invitrogen) for 35min at 200V. The gels were fixed
for 15min in 25% isopropanol/10% acetic acid, dried at
808C for 1h and exposed to a phosphorimager screen.
For the experiment in Figure 5F,
were used. A piece of X-ray film was placed between
the gel and phosphorimager screen to shield signal from
35S-labelledprotein and
32P-labelled DNA (upper panel). A second exposure was
obtained with no X-ray film to ensure equal loading of
protein (bottom panel).
For the experiment in Figure 6B, in vitro translated
TERT was replaced with the TEN domain of TERT that
had been bacterially expressed and purified as described
(29) and which was a gift from Drs Steven Jacobs and
Thomas Cech. These crosslinking reactions were carried
out in the presence of 5mM non-specific competitor
(PBR).
35S-labelled proteins
leaveonlysignalfrom
Immunoprecipitation to measureRNA bindingto TERT
FLAG-tagged fragments of TERT were tested for their
abilityto immunoprecipitate
described (39) with the exceptions that anti-FLAG M2
affinity agarose beads (Sigma-Aldrich) were used, and the
reactions were electrophoresed on 4–12% NuPage gels
(Invitrogen).
telomeraseRNAas
RESULTS
Recombinant Tetrahymena telomerase dissociates equally
from primers withdifferent 3’ ends
It has been shown that DNA primers dissociate from
endogenous human telomerase at different rates, depend-
ing on the permutation of the 30end of the primer (40).
Primers ending in GGG displayed half-lives of greater
than 20h at room temperature. In order to determine the
best primer to use for binding experiments, we sought to
determine whether the same is true for recombinant
Tetrahymena telomerase. We used an activity-based bind-
and-chase assay for primer dissociation that we previously
developed (10). In this assay, telomerase was allowed to
form a complex with a short (18–20nt) DNA primer of
telomeric sequence. A 75-fold excess of a longer primer
(37nt) was added and incubated with the enzyme/primer
mixture at 308C for varying lengths of time. Telomerase
activity was then initiated by addition of nucleotides
(either ddTTP and [a-32P]dGTP, or [a-32P]dTTP and
ddGTP, depending on the permutation of the primer) and
allowed to proceed at 308C for 5min. The inclusion of
ddTTP or ddGTP resulted in termination of extension
after incorporation of the first T or G respectively,
generating 2 to 5 product bands, depending on the
permutation of the primer (Figure 1A and B, illustrated
for primer 18GTT). To establish that the excess of longer
primer did not allow the enzyme to rebind 18-mer, both
primers were preincubated simultaneously with enzyme,
which eliminated extension of the 18-mer (Figure 1A,
chase control lane). Thus, the amount of addition to
18GTT after varying lengths of chase time is a reflection of
the amount of the original primer still bound to enzyme at
that time. We observed similar dissociation rates for all six
primer permutations; koffranged from 0.39 to 1.3min?1,
corresponding to half lives of 0.7 to 1.9min at 308C
(Figure 1C). Thus recombinant Tetrahymena telomerase,
like endogenous Euplotes aediculatus telomerase (41), does
not show the large (?100-fold) differences in primer
affinities that were observed for endogenous human
telomerase. Since 18GTT has been the standard primer
in our telomerase assays (10,39), we chose to use this
primer for the primer binding assay described later.
Development ofadirect equilibrium bindingassay for
measuring TERT–primer interactions
Previous studies examining the interaction of telomerase
with DNA have relied on measurement of telomerase
activity (10,17,35) or crosslinking of modified oligonucleo-
tides (20–22,24). We sought to develop a quantitative
activity-independentequilibriumbindingassayfor
1264
Nucleic Acids Research, 2008, Vol. 36, No. 4