The ER-bound RING finger protein 5 (RNF5/RMA1) causes degenerative myopathy in transgenic mice and is deregulated in inclusion body myositis.

Abstract

Growing evidence supports the importance of ubiquitin ligases in the pathogenesis of muscular disorders, although underlying mechanisms remain largely elusive. Here we show that the expression of RNF5 (aka RMA1), an ER-anchored RING finger E3 ligase implicated in muscle organization and in recognition and processing of malfolded proteins, is elevated and mislocalized to cytoplasmic aggregates in biopsies from patients suffering from sporadic-Inclusion Body Myositis (sIBM). Consistent with these findings, an animal model for hereditary IBM (hIBM), but not their control littermates, revealed deregulated expression of RNF5. Further studies for the role of RNF5 in the pathogenesis of s-IBM and more generally in muscle physiology were performed using RNF5 transgenic and KO animals. Transgenic mice carrying inducible expression of RNF5, under control of beta-actin or muscle specific promoter, exhibit an early onset of muscle wasting, muscle degeneration and extensive fiber regeneration. Prolonged expression of RNF5 in the muscle also results in the formation of fibers containing congophilic material, blue-rimmed vacuoles and inclusion bodies. These phenotypes were associated with altered expression and activity of ER chaperones, characteristic of myodegenerative diseases such as s-IBM. Conversely, muscle regeneration and induction of ER stress markers were delayed in RNF5 KO mice subjected to cardiotoxin treatment. While supporting a role for RNF5 Tg mice as model for s-IBM, our study also establishes the importance of RNF5 in muscle physiology and its deregulation in ER stress associated muscular disorders.

Full text

Page 1

The ER-Bound RING Finger Protein 5 (RNF5/RMA1)
Causes Degenerative Myopathy in Transgenic Mice and
Is Deregulated in Inclusion Body Myositis
Agne `s Delaunay1, Kenneth D. Bromberg2, Yukiko Hayashi3, Massimiliano Mirabella4, Denise Burch1,
Brian Kirkwood1, Carlo Serra1, May C. Malicdan3, Andrew P. Mizisin5, Roberta Morosetti4, Aldobrando
Broccolini4, Ling T. Guo5, Stephen N. Jones6, Sergio A. Lira7, Pier Lorenzo Puri1,8, G. Diane Shelton5,
Ze’ev Ronai1*
1Signal Transduction, The Burnham Institute for Medical Research, La Jolla, California, United States of America, 2Department of Pharmacology and Systems
Therapeutics, Mount Sinai School of Medicine, New York, New York, United States of America, 3National Institute of Neuroscience, Tokyo, Japan, 4Department of
Neuroscience, Catholic University, Rome, Italy, 5Department of Pathology, School of Medicine, University of California San Diego, La Jolla, California, United States of
America, 6Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts, United States of America, 7Immunobiology Center, Mount
Sinai School of Medicine, New York, New York, United States of America, 8Dulbecco Telethon Institute at Fondazione European Brain Research Institute (EBRI)/S.Lucia
00134, Rome, Italy
Abstract
Growing evidence supports the importance of ubiquitin ligases in the pathogenesis of muscular disorders, although
underlying mechanisms remain largely elusive. Here we show that the expression of RNF5 (aka RMA1), an ER-anchored RING
finger E3 ligase implicated in muscle organization and in recognition and processing of malfolded proteins, is elevated and
mislocalized to cytoplasmic aggregates in biopsies from patients suffering from sporadic-Inclusion Body Myositis (sIBM).
Consistent with these findings, an animal model for hereditary IBM (hIBM), but not their control littermates, revealed
deregulated expression of RNF5. Further studies for the role of RNF5 in the pathogenesis of s-IBM and more generally in
muscle physiology were performed using RNF5 transgenic and KO animals. Transgenic mice carrying inducible expression of
RNF5, under control of b-actin or muscle specific promoter, exhibit an early onset of muscle wasting, muscle degeneration
and extensive fiber regeneration. Prolonged expression of RNF5 in the muscle also results in the formation of fibers
containing congophilic material, blue-rimmed vacuoles and inclusion bodies. These phenotypes were associated with
altered expression and activity of ER chaperones, characteristic of myodegenerative diseases such as s-IBM. Conversely,
muscle regeneration and induction of ER stress markers were delayed in RNF5 KO mice subjected to cardiotoxin treatment.
While supporting a role for RNF5 Tg mice as model for s-IBM, our study also establishes the importance of RNF5 in muscle
physiology and its deregulation in ER stress associated muscular disorders.
Citation: Delaunay A, Bromberg KD, Hayashi Y, Mirabella M, Burch D, et al (2008) The ER-Bound RING Finger Protein 5 (RNF5/RMA1) Causes Degenerative
Myopathy in Transgenic Mice and Is Deregulated in Inclusion Body Myositis. PLoS ONE 3(2): e1609. doi:10.1371/journal.pone.0001609
Editor: Dong-Yan Jin, University of Hong Kong, China
Received December 17, 2007; Accepted January 3, 2008; Published February 13, 2008
Copyright: ? 2008 Delaunay et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Support by NCI (CA097105 to ZR) is gratefully acknowledged.
Competing Interests: The authors have declared that no competing interests exist.
*E-mail: ronai@burnham.org
Introduction
Skeletal muscles are continually subjected to remodeling as a
consequence of normal mechanical or metabolic stress, as an
adjustment of muscle mass to muscle load during normal activity,
or as a response to a muscle disease. While exercise leads to
increased protein synthesis and build-up of muscle mass
(hypertrophy), disuse is associated with degradation of muscle
components (atrophy) [1,2]. Atrophy can also occur during normal
aging and as a result of pathological conditions such as primary
muscle or peripheral nerve disease, cachexia and cancer [3].
During muscle remodeling, changes in protein turnover due to
controlled degradation are balanced by new protein synthesis.
The ubiquitin-proteasome system (UPS) is a key player in
muscle dynamics both in normal and in pathological conditions.
The UPS is able to selectively target for degradation structural and
regulatory components following their ubiquitination by different
E3 ligases. Increased general UPS components, and in particular
specific E3 ligases, have been implicated in muscle remodeling
[2,4,5]. The important role of UPS in muscle atrophy is
exemplified by MuRF1, a RING finger E3 ligase, and MAFbx,
an F-Box protein component of the Skp1-Cullin F-Box protein
(SCF) complex [6]. Increased expression of these ligases in mouse
models of muscle disuse results in degradation of structural
components of the muscle fibers such as the myofibrillar proteins
(myosin, titin, troponin, nebulin, myotilin; [7] [8]. Conversely,
induced muscle atrophy is prevented in MuRF1 and MAFbx
Knockout (KO) mice [6,7]. The E3 ligase MuRF3 has also been
shown to elicit a protective effect on myocardial function through
its action on two types of filamins involved in muscle mechan-
osensing and signaling [9].
Other E3 ubiquitin ligases, such as ZNF216, have been
implicated in general muscle physiology and muscle atrophy
[10]. Ozz-E3 was identified as an E3 ligase that targets
PLoS ONE | www.plosone.org1 February 2008 | Volume 3 | Issue 2 | e1609

Page 2

sarcolemma-associated b-catenin for degradation and controls
growth and maintenance of myofibrils [11]. A similar role in
myofibrillogenesis has been proposed for the MuRF2 E3 ligase
[12]. These studies support the notion that E3 ligases are an
integral component of muscle dynamics during maintenance of
normal muscle function.
In muscle disease, recent evidence supports a role of the UPS in
the pathogenesis of select myopathies. Mutations in TRIM32
RING finger E3 ligase have been associated with Limb-Girdle
Muscular Dystrophy (LGMD) type 2H [13] and sarcotubular
myopathy [14]. Although the mechanism linking TRIM32 ligase
activity to LGMD type 2H is unknown, TRIM32 has been shown
to interact with myosin and to ubiquitinate actin [15], suggesting a
role in myofibrillar turnover during muscle adaptation. Accumu-
lation of ubiquitin-containing cytoplasmic aggregates has been
associated with both sporadic and hereditary forms of inclusion-
body myositis (sIBM and hIBM). These findings suggest an
important role of the UPS in accumulation, misfolding and
aggregation of muscle proteins [16]. This has been confirmed by
genetic and histopathological analysis that links IBM-like muscle
disorders with impairment of the endoplasmic reticulum associat-
ed degradation (ERAD) machinery, a degradation pathway
important in removal of misfolded proteins [17].
The sporadic form of IBM (sIBM) is the most common acquired
myopathy that occurs in the older human population. sIBM is a
slowly progressive myopathy that combines both a T-cell mediated
autoimmune inflammatory response and myodegenerative features
including vacuolar degeneration, protein aggregation and inclusion
formation [16]. Remarkably, sIBM patients are poorly responsive to
anti-inflammatoryorimmunosuppressivetreatments,suggestingthat
inflammation per se may not be a primary cause of the disease [16].
Amongcurrenthypotheses,accumulationofmalfoldedproteinssuch
as amyloid b Precursor Protein (abPP) and its processed forms, and
ER overload associated with proteasomal dysfunction are thought to
be key players in sIBM pathogenesis [16]. This hypothesis has been
further substantiated by the fact that different ER stress markers,
such as GRP78 and GRP94 are overexpressed and present in
amyloid containing aggregates in sIBM muscles [16,17], most likely
as a consequence of the activation of the Unfolded Protein Response
(UPR). Therefore, ER stress induction and impaired clearance of
malfolded proteins are thought to be part of the pathogenic process
occurring in s-IBM.
We have previously shown that the RING finger ubiquitin ligase
RNF5 (also known as RMA-1; [18,19]) plays an important role in
muscle physiology using the C. elegans model [20]. RNF5 is a
membrane-bound E3 ligase that is conserved from worm to human.
In C. elegans, RNF-5 localizes to the dense bodies and the M-line of
the body wall muscles, where it regulates the levels of the LIM
domain protein UNC-95. In C. elegans, UNC-95 has been genetically
associated with uncoordinated movement [21] and shown to be
important for formation of muscle attachment sites (M-lines and Z-
lines) associated with the downstream process of sarcomere
organization [20]. In a mammalian cell culture system, RNF5 has
been shown to ubiquitinate and regulate the localization of the
proteinpaxillin[22],acriticalcomponentoffocaladhesion,involved
in cell adhesion and motility. More recently, RNF5 has been
described as a new component of the ERAD machinery, where it
contributes to the ubiquitination-dependent degradation of mal-
folded proteins as part of cell protein quality control [23].
Here, we have established and characterized inducible trans-
genic mouse over-expressing RNF5 either ubiquitously or in a
muscle specific manner. We show that general as well as tissue
specific overexpression of RNF5 induces myofiber degeneration
associated with an alteration of endoplasmic reticulum (ER)
function. Conversely, RNF5 KO mice exhibit delayed repair of
muscle damage associated with attenuated ER stress response.
Screening for RNF5 expression in muscle biopsies from patients
suffering from muscular disorders including classical myopathies
suchas Duchenne and Becker myopathy as well as other myopathies
with unknown etiology identifiedupregulation and mislocalizationof
RNF5 to aggregates in muscles from sIBM patients, as well as in a
mouse model for hereditary IBM. Our findings establishes the
importance of RNF5 in muscle physiology and in ER stress
associated muscular disorders while pointing to the possible use of
RNF5 transgenic mouse as a unique model to study the role of ER
function in the pathogenesis of degenerative muscle diseases.
Results
Aberrant RNF5 expression in human myopathies
To assess whether RNF5 expression or localization would be
deregulated in certain human myopathies associated with ER
impairment, muscle biopsies from patients affected by different
forms of myopathies were screened for possible changes in pattern
or level of RNF5 expression using RNF5 antibodies with
confirmed specificity developed in our laboratory (Fig. S1). An
alteration of RNF5 expression in both vacuolated muscle fibers
and in apparently normal fibers (2–20% of total fibers) was
detected in biopsies from 10 patients with sIBM. Compared to
control muscle, RNF5 in biopsies from sIBM patients was
increased in amount and mislocalized, most frequently in
apparently non vacuolated muscle fibers and diffusely within the
cytoplasm (Fig. 1A). Strikingly, in 3 out of 10 biopsies from sIBM
patients, intensive staining for RNF5 was evident with formation
of giant aggregates inside some muscle fibers (Fig. 1B). Interest-
ingly, RNF5 inclusions partly co-localized with beta-amyloid
positive aggregates (Fig. 1C) but not with phospho-tau containing
structures (Fig. 1D). Given the limited expression of RNF5 in
skeletal muscle, endogenous RNF5 was not detectable by straight
western blots in extracts from human biopsies. Elevated RNF5
protein levels could be observed after RNF5 immunoprecipitation
in biopsies from sIBM patients (Fig. 1E). The specificity of the
immunoprecipitation reaction was confirmed using muscle
extracts from RNF5 KO and WT mice (Fig. 1E right panel).
Unlike in sIBM, common muscular dystrophies associated with
mutations in proteins of the dystrophin glycoprotein complex
(DGC) such as Duchenne or Becker forms of muscular dystrophy,
did not exhibit any alteration in the pattern or amount of RNF5
expression (Fig. S2). Since beta-amyloid accumulation and
impairment of ERAD and UPR functions are thought to be
upstream events in sIBM development [16], our data points to
RNF5 deregulation as an early event in the onset of the disease.
To determine whether changes in amount or localization of
RNF5 was a common occurrence in IBM type degenerative
myopathies, additional analysis was performed in a mouse model
of hereditary IBM, the distal myopathy with rimmed vacuoles
(DMRV) mutant mouse [24]. Transgenic animals, but not their
control littermates, exhibited a strong increase in RNF5 expression
in muscle fibers within areas of regeneration including rimmed
vacuoles and centrally located nuclei (Fig. 1F), characteristic of this
model[24].ThesefindingsrevealalteredRNF5expressioninspecific
degenerative myopathies associated with dysfunction of the ER or
the ERAD machinery such as sporadic and hereditary IBM.
Construction of RNF5 transgenic mouse
In order to address the function of RNF5 deregulation in
degenerative myopathies, we constructed a transgenic mouse
model which allowed conditional RNF5 overexpression. A
construct containing the RNF5 gene was cloned downstream of
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org2 February 2008 | Volume 3 | Issue 2 | e1609

Page 3

Figure 1. Alteration of RNF5 pattern is evident in muscle biopsies from both patients with sIBM and in a hIBM mouse model. A.
Immunohistological analysis of RNF5 protein in a normal muscle biopsy and in biopsies from 2 representative sIBM patients. RNF5 staining was also
positive in aggregates from 10 independent sIBM patients (not shown). B. Muscle cross-sections from 3 sIBM patients immunostained with RNF5
antibody exhibiting high levels of RNF5 protein in giant aggregates. C. Co-localization of RNF5 with beta-amyloid protein (6E10) inclusions in a
representative muscle cross-section from a sIBM patient. D. Co-staining of muscle sections from 2 sIBM patients with RNF5 and SMI31, a marker for
phospho-tau protein. Arrows point to phospho-tau containing aggregates and arrowheads to RNF5 staining. E. Elevated RNF5 protein levels in
biopsies from 3 IBM patients. RNF5 was immunoprecipitated from equal protein amounts prepared from biopsies of sIBM patients using RNF5
polyclonal antibody. The resulting immunoprecipitates were analyzed by western blot using RNF5 antibody. Equal volumes of supernatants from the
respective immunoprecipitations were analyzed for GAPDH expression, confirming that the immunoprecipitation reactions were performed using
comparable amounts of extracts. F. Immunohistological analysis of RNF5 protein in control (a) and DMRV mutant mice (b–d). c and d represent
higher magnification and highlight the presence of dense intrafiber staining for RNF5 in muscle fibers (arrows on panel c point to RNF5 staining
within rimmed vacuoles [24] whereas arrow on panel d points to RNF5 staining within centrally located nuclei).
doi:10.1371/journal.pone.0001609.g001
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org3February 2008 | Volume 3 | Issue 2 | e1609

Page 4

the minimal Tet-ON operator (Tetracyclin Responsive Element
(TRE)-containing promotor). RNF5 transgenic (Tg) lines were then
established by pronuclear injection and implantation in C57/BL6
recipient mice (see Methods for details). The rtTA RNF5 double
transgenic animals (DTg) and their corresponding control
littermates (RNF5 STg) were generated by crossing RNF5 STg with
rtTA animals, expressing the tetracyclin responsive Transcriptional
Activator under the control of the ubiquitous CMV-b-actin
promotor (Fig. 2A; [25].
Overexpression of RNF5 protein was confirmed in different
organs of the rtTA RNF5 DTg animals provided with doxycyclin in
drinking water (Fig. 2B). Expression of RNF5 protein was evident
in double transgenic animals, but not in doxycyclin-treated single
transgenic animals (RNF5 STg) or untreated DTg animals. The
RNF5 transgene is expressed at different levels depending on the
organs analyzed. The higher level of RNF5 expression was seen in
skeletal muscle where RNF5 transgene could be detected by
straight western blot. RNF5 was expressed to a lesser extent in
heart and in kidney where immunoprecipitation was required to
detect the protein (Fig. 2B). Conversely, RNF5 levels were very
low in liver and undetectable in brain, lungs and spleen (data not
shown). This expression pattern is consistent with the low
transcriptional levels of the rtTA activator and the differential
expression pattern described for the rtTA transgene [25]. These
data suggest that RNF5 expression is tightly controlled in DTg
mice and that the system is not subjected to transcriptional leakage
in the absence of doxycyclin induction. Furthermore, the
expression of RNF5 in skeletal muscles makes it a suitable system
for studying its function in this organ, without restricting its
expression to mature muscle fibers.
Induction of RNF5 transgene leads to rapid weight loss
and early onset of muscle wasting and kyphosis
rtTA RNF5 DTg but not control animals subjected to doxycyclin
treatment exhibited a significant weight loss as early as 2 wk post-
induction (Figs. 2C, 2D). By 4 wk, clear phenotypic differences were
evident between the double transgenic animals and their control
littermates, including a significant decrease in body mass and visible
kyphosis (Fig. 2C, 2D). After 5–6 wk of RNF5 overexpression, the
phenotype was even more severe: the animals showed decreased
activity and pelvic limb weakness. Death eventually occurred
7 weeks following initiation of doxycyclin treatment.
Skeletal muscles were collected from double transgenic mice
and analyzed for histopathologic changes. Compared with
controls, double transgenic animals exhibit clear pathological
Figure 2. Conditional expression of RNF5 in a transgenic mouse system. A Schematics depicting transgenic constructs used to overexpress
RNF5 in mice. The rtTA transcriptional activator is expressed under the control of a CMV enhancer/chicken b-actin promoter. The RNF5 transgene is
expressed under the control of a tetracycline-responsive promoter and is activated only in the presence of both the rtTA activator and doxycyclin. B.
Tissue expression of RNF5 transgene in double transgenic animals. rtTA RNF5 DTg animals were treated with 2 mg/ml of doxycyclin in drinking water
for 10 days and RNF5 protein levels were monitored in different organs. RNF5 expression was assessed using RNF5 polyclonal antibody, either by
western blotting (skeletal muscle) or after immunoprecipitation (heart, kidney). a-tubulin was used as a loading control. In the case of heart and
kidney, equal volumes of supernatants obtained following the immunoprecipitation were loaded and probed with a-tubulin. C. Comparison of a
representative DTg animal overexpressing RNF5 after 4 wk of doxycyclin treatment with its control littermate. D. Weight curve comparison of RNF5-
overexpressing DTg animals and their matching controls during doxycyclin treatment. The body mass of individual animals was monitored on a
weekly basis for 6 wk. Graphs represent the change in body mass relative to the original weight of a single animal (n=5). Note: In the same gender
and age class, both experimental and control animals had the same external appearance and similar weight at the beginning of treatment.
doi:10.1371/journal.pone.0001609.g002
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org4 February 2008 | Volume 3 | Issue 2 | e1609

Page 5

changes in all skeletal muscles analyzed (Fig. 3A–C). In transverse
sections of fresh frozen specimens from the triceps brachii, tibialis
anterior and vastus lateralis muscles, there was a marked
variability in myofiber size in the treated double transgenic
animals, with numerous small caliber fibers having a round shape,
and multifocal clusters of mononuclear cells. As there was no
elevation of atrogin-1 in the muscle from the double transgenic
animals, the decrease in fiber size was not likely a result of muscle
atrophy (data not shown). Many muscle fibers of both small and
larger caliber contained internal nuclei. Measurement of the cross-
sectional area confirmed the presence of many small fibers, most
markedly within the vastus lateralis muscle (Fig. 3C). The small
size of the muscle fibers was reflected by a decrease in the weight
of each muscle (Fig. 3D). Loss of muscle mass may account for the
global decrease in body weight observed in the double transgenic
animals, as the weight of the other organs was not affected
(Fig. 3E). Of the different muscles analyzed, the vastus lateralis was
the most affected, demonstrated both by decreased cross-sectional
area measurement and more pronounced weight loss.
RNF5 overexpression is associated with increased muscle
degeneration and extensive regeneration
Although vacuolated fibers were not observed, rtTA RNF5 DTg
animals exhibit myodegeneration, supported by various stages of
myonecrosis and phagocytosis based on modified Gomori-trichrome
stain (Fig. 4A). Levels of serum creatine kinase (CK) activity were
consistently elevated after 6 wk of doxycyclin treatment in the rtTA
RNF5 DTg animals, but not in their control littermates (Fig. 4B),
supporting the presence of myofiber damage. To visualize the extent
and distribution of myodegeneration, Evans Blue dye (EBD) was
injected into the rtTA RNF5 DTg and their control littermates.
Contrary to the skeletal muscle of their matching controls, the rtTA
RNF5 DTg animals exhibited positive staining for EBD within a
number of muscle fibers (Fig. 4C), consistent with degeneration
(myonecrosis) and elevated serum CK activity. EBD-positive muscle
fibers were negativefor dystrophin staining (Fig. 4C)and surrounded
by immune cells that showed positive staining for the pan-leukocyte
marker CD45 and macrophage marker CD11b (data not shown),
corresponding to macrophages clearing up necrotic debris. Ultra-
structural analysis on DTg muscles further confirmed that the
sarcomeric structure was conserved in non-degenerative fibers
(Fig. 4D asterisk). In degenerating fibers, there was loss of the
normal myofibrillar pattern, mitochondrial swelling and dilated
tubular structures (Fig. 4D).
Myodegeneration in RNF5 overexpressing animals was associ-
ated with extensive fiber regeneration. Quantitative analysis
revealed that 50% of the muscle fibers of rtTA RNF5 DTg, but
not control animals, were centrally nucleated, and that 30% of the
small fibers stained positively for embryonic myosin heavy chain
(emb MHC), a known marker of early muscle regeneration
(Fig. 4E,F). Consistent with this observation, positive staining for
myogenin, a transcription factor expressed during differentiation
of activated satellite cells[26], was also observed in small myofibers
of rtTA RNF5 DTg animal muscle but not in their control
littermates (Fig. 4E). Interestingly, clusters of mononuclear cells,
staining positively with antibodies against CD45 (data nor shown)
and CD11b (Fig. 4G), were also observed at sites of muscle
regeneration, yet, neither lymphocytic infiltration nor fibrosis were
observed (Fig. 4G, and data not shown). These data indicate that
regeneration following overexpression of RNF5 is a result of
myofiber degeneration and not an inflammatory process.
Immunostaining using markers for DGC proteins including
dystrophin and alpha-sarcoglycan, as well as the extracellular
matrix protein laminin a2, did not show any major difference
between DTg and control muscles (Fig. S3), indicating that
disruption of the DGC or extracellular matrix proteins was not a
primary cause for myonecrosis. Consistently, in vitro differentiation
of primary myoblasts cultured from the double transgenic animals
treated with doxycyclin prior and during differentiation did not
reveal changes in the sarcomeric structure as depicted by staining
for alpha-sarcomeric actinin (Fig. S4). Taken together, these
findings demonstrate that myofiber degeneration and necrosis
account for the elevated serum CK activity associated with RNF5
overexpression, and that myodegeneration is not a primary
inflammatory process nor is it a consequence of the alteration of
common sarcolemmal structural proteins.
Myofiber degeneration-coupled regeneration in rtTA
RNF5 DTg mice is associated with altered expression of
ER chaperones without the formation of protein
aggregates
Given the link between ER stress and sIBM [16,17] we next
examined the status of ER stress markers in the muscles of RNF5
overexpressing animals. Consistent with the increase in ER stress
markers observed in s-IBM muscles, a clear and consistent, albeit
moderate, increase in expression of PDI, Grp78, Grp94 and
calnexin was seen in rtTA RNF5 DTg but not control mice (Fig. 5A),
suggesting that ER stress occurs in the muscles of RNF5
overexpressing animals. Grp94 upregulation was confirmed by
immunohistochemistry of the DTg muscle sections (Fig. 5B).
However, contrary to what has been observed in s-IBM patients,
this ER chaperone did not localize to aggregates (Fig. 5B) and
congophilic material was not detected in the muscle fibers of DTg
animals (data not shown). These data suggest that the myodegen-
eration observed following RNF5 overexpression is associated with
ER stress yet occurs at earlier stage in the development of this
disease, prior to aggregate formation.
ER stress is commonly considered a protective response.
However, high levels of ER stress or ER dysfunction may also
impair cell survival by triggering apoptotic pathways (review by
[27]. Therefore, the onset of ER stress could cause fiber death with
concomitant induction of muscle regeneration without directly
affecting the muscle structural components [28,29,30]. Analysis of
TUNEL and cleaved caspase 3 as markers of apoptosis did not
reveal any changes in programmed cell death (data not shown).
Similarly, no increase was observed in the levels of CHOP or in
cleavage of caspase 12 (data not shown). Rather CHOP levels were
decreased in DTg animals (Fig. 5A), implying that overexpression
of RNF5 may induce ER stress by limiting the activation of some
UPR components. These data also indicate that the degeneration
process observed in rtTA RNF5 DTg animals is not linked with ER-
associated programmed cell death.
Grp94 was previously reported to be important for myoblast
fusion [31], a critical step in regenerating muscle. Change in Grp94
levels and localization is expected to impact its contribution to
myoblast fusion and therefore affect the regeneration process [30].
Analysis of GRP94 expression revealed increased expression and
possible post translational modification in rtTA RNF5 DTg but not in
their matching controls (Fig. 5A). Further, RNF5 staining exhibited
dense perinuclear staining in the endoplasmic reticulum of mature
and regenerative fibers of the transgenic mice (Fig. 5C). Notably,
RNF5 staining was higher in regenerating fibers and localized along
the nascent sarcoplasmic reticulum network and sarcolemma
(Fig. 5C), suggesting that its function may prevail during the
regenerationprocess.ThesefindingssuggestthatRNF5mayexertits
effect on muscle physiology by modulating the function/localization
of specific components of the ER, including Grp94.
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org5February 2008 | Volume 3 | Issue 2 | e1609

Page 6

Figure 3. RNF5-overexpression is associated with muscle fiber degeneration. A–C Cross-sections of fresh frozen specimens of triceps
brachii (A), tibialis anterior (B) and vastus lateralis (C) muscles from RNF5 STg or rtTA RNF5 DTg animals treated with doxycyclin for 6 wk (H&E stain).
Fiber cross-sectional area (CSA mm2) corresponding to each muscle type was calculated and plotted as a percentage of the total number of fibers
analyzed (n.200) (right panel). D. Average muscle mass of RNF5 STg and rtTA RNF5 DTg animals treated with doxycyclin for 6 wk. Each muscle was
extracted, trimmed under the microscope and weighed on a precision scale (n=5 for experimental and control groups). E. Average organ mass of
RNF5 STg and rtTA RNF5 DTg animals treated with doxycyclin for 6 wk.
doi:10.1371/journal.pone.0001609.g003
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org6 February 2008 | Volume 3 | Issue 2 | e1609

Page 7

Figure 4. RNF5 induced myodegeneration is associated with extensive myofiber regeneration. A. Modified Gomori-trichrome staining of
triceps brachii cross-sections from treated STg and DTg animals. DTg muscle sections show a number of degenerative fibers with cellular infiltration
(arrows). B. Serum creatine kinase (CK) levels were monitored in RNF5 STg and rtTA RNF5 DTg after 4 wk of doxycyclin treatment (n=3). DTg animals
had variably elevated CK levels. C. Dye-permeable fibers are surrounded or invaded by macrophagic inflammatory cells clearing necrotic debris.
Treated DTg and control mice were injected with Evans Blue Dye (EBD) 12 hr before sacrificed and fiber permeability to the dye was monitored
externally by the blue coloration of the muscles (right panel) and after cross-section (red fluorescence; left panel). The muscle cross-sections were
counterstained with an antibody against dystrophin to visualize fiber boundaries and to highlight degenerative myofibers where staining for
dystrophin was absent. D. Ultrastructural analysis of DTg muscle sections. In longitudinal sections, sarcomere structure was normal in non-
degenerating myofibers (left, asterisks). In an adjacent degenerating fiber, disruption of sarcomere structure, dilated tubular structures (arrows), and
enlarged mitochondria (arrowheads) are evident. A similar pattern was evident in cross-section (right panel). Magnification611,000. E. Muscle cross-
sections of doxycyclin-treated DTg and control animals stained with antibodies against embryonic myosin heavy chain (embMHC) and myogenin.
Arrowheads indicate some nuclei exhibiting a positive myogenin staining in sections from DTg animals. Muscle sections were counterstained with
anti-laminin a3 antibody (red) and DAPI (blue) to visualize respectively myofiber boundaries and nuclei. F. Quantification of the number of
regenerative myofibers, expressed as the average number of embMHC positive fibers (early regenerative fibers) and of centrally nucleated fibers. G.
Mice overexpressing RNF5 have extensive mononuclear cell infiltration in areas of myofiber degeneration. Cd11b immunostaining (arrowheads)
highlight macrophagic infiltration of triceps brachii muscle cross-sections from rtTA RNF5 DTg (b) but not RNF5 STg (a) animals treated with doxycyclin
for 6 wk. Nuclei are stained with DAPI (blue). Negative control (mouse IgG) performed on sections from rtTA RNF5 DTg is shown in panel (c). (d)
Muscle regeneration associated with RNF5 overexpression does not result in fibrosis. Triceps cross-sections from RNF5 STg and DTg animals were
stained with modified Gomori-Trichrome.
doi:10.1371/journal.pone.0001609.g004
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org7February 2008 | Volume 3 | Issue 2 | e1609

Page 8

Long-term muscle-specific overexpression of RNF5
results in muscle degeneration and regeneration and
vacuole formation
In order to analyze the effect of RNF5 overexpression in a tissue
specific manner and to confirm that the phenotype observed
originates from RNF5 expression in mature muscles, we crossed
RNF5 transgenic animals with mice expressing the tTA transgene
under the control of the muscle specific promoter MCK (Muscle
Creatine Kinase) (Fig. 6A). This mouse model was previously
generated to control conditional gene expression in skeletal
muscles in a tetracyclin repressible manner [32]. In this model,
double transgenic animals (MCK-tTA RNF5 DTg) and their
matching controls (RNF5 STg) were kept under doxycyclin
treatment until they reached 3 months of age to prevent the
induction of the RNF5 transgene. Specific overexpression of RNF5
in skeletal muscle was then induced following doxycylin with-
drawal. RNF5 level of expression was comparable to the one we
observed using b-actin promoter (Fig. 6B). When expressed from a
muscle-specific promoter, RNF5 overexpression led to a less
severe, albeit clear and reproducible clinical phenotype, with
animals surviving up to 5 month after initiating transgene
induction. MCK-tTA RNF5 DTg were found to exhibit a mild
weight loss over time, compared to STg (Fig. 6C). This milder
phenotype enabled us to monitor the effect of RNF5 overexpression
over a prolonged time period. While MCK-tTA RNF5 DTg animals
exhibited histopathological changes similar to those observed in the
b-actin expressing RNF5 mice, only few animals exhibited these
phenotype within the same time frame seen for rtTA RNF5 DTg mice
(6 wk). The majority of MCK-tTA RNF5 DTg mice exhibit a clear
muscle phenotype only 20 wk after doxycyclin withdrawal (Fig. 6D
panels a,b). Strikingly, in addition to the classical myodegeneration
and regeneration process previously observed in the rtTA RNF5 DTg
model, prolonged expression of RNF5 in the MCK-tTA RNF5 DTg
also caused the appearance of Congo Red positive fibers (Fig. 6D
Figure 5. RNF5 localizes to the ER and its overexpression correlates with altered ER function. A. Expression levels of select ER stress
markers in muscles of DTg animals are elevated compared to their control littermates. Western blot analysis of muscle extract (80 mg) from RNF5 STg
or rtTA RNF5 DTg animals treated for 6 weeks with doxycyclin was probed with Grp78, PDI, Grp94, calnexin and CHOP antibodies. RNF5 and GAPDH
antibodies were used for RNF5 expression and loading controls, respectively. B. Grp94 immunostaining of vastus lateralis cross-sections from treated
rtTA RNF5 DTg and STg animals. C. RNF5 localizes to the ER of muscle fibers. Vastus lateralis cross-sections from treated DTg animals were stained
with RNF5 antibody. Normal (top panels) or regenerative fibers (bottom panels) are shown for RNF5 staining alone (left panels) or combined with
DAPI (right panels).
doi:10.1371/journal.pone.0001609.g005
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org8 February 2008 | Volume 3 | Issue 2 | e1609

Page 9

Figure 6. Long term muscle specific expression of RNF5 results in the formation of vacuoles containing aggregates. A. Schematics
depicting transgenic constructs used to overexpress RNF5 in a muscle specific manner. The tTA transcriptional activator is expressed under the
control of the Muscle Creatine Kinase (MCK) promoter and is inactive in the presence of doxycyclin. Once doxycyclin is withdrawn, tTA activates the
expression of the RNF5 transgene. B. Muscle specific expression of RNF5 transgene in MCK-tTA RNF5 DTg transgenic animals. RNF5 protein levels in
vastus lateralis from rtTA and MCK-tTA RNF5 DTg and RNF5 STg mice were monitored by western blot, 20 wk after doxycyclin withdrawal. C. Weight
curve comparison of MCK-tTA RNF5-overexpressing DTg animals and their matching controls after doxycyclin withdrawal. The body mass of
individual animals was monitored for 20 wk. Graphs represent the change in body mass relative to the original weight of a single animal (n=5). D.
Cross-sections of fresh frozen specimens of vastus lateralis muscles from RNF5 STg (a, c, e, g) or MCK-tTA RNF5 DTg (b, d, f, h) animals 20 wk after
doxycyclin withdrawal. H&E (a, b, e, f) and congo red (c, d) stain have been performed on triceps cross-section. Panels f and g represent a higher
magnification to better visualize the presence of vacuole containing aggregates (arrows). E. Expression of GRP94 in muscles of MCK-tTA RNF5 DTg
animals compared to their control littermates, 6 wk and 20 wk after doxycyclin withdrawal. F. GRP94 immunostaining of vastus lateralis cross-
sections from MCK-tTA RNF5 DTg and STg animals 20 wk after doxycyclin withdrawal.
doi:10.1371/journal.pone.0001609.g006
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org9 February 2008 | Volume 3 | Issue 2 | e1609

Page 10

panels c,d) and the formation of blue-rimmed vacuoles containing
inclusions (Fig. 6D panels e–h). These findings establish that muscle-
specific overexpression of RNF5 is sufficient to cause muscle
degeneration with extensive muscle regeneration. Moreover,
prolonged RNF5 overexpression leads to the formation of vacuole
containing inclusions and accumulation of congophilic material, as
seen in sIBM patients, further substantiating a role for RNF5 in the
development of the disease.
Similar to what we have observed in rtTA RNF5 DTg mice, ER
stress markers such as GRP94 was up regulated (possibly a post-
translationally modified) in MCK-tTA RNF5 DTg animals (Fig. 6E)
and elevated expression was observed in small regenerating fibers
by immunohistochemistry (Fig. 6F). The two mouse models used
provide important confirmation for the role of RNF5 in ER stress-
associated muscle degeneration phenotype.
RNF5 KO mice exhibit a delay in regeneration from
cardiotoxin-induced muscle damage
To further assess the potential role of RNF5 in normal muscle
physiology we used an RNF5 KO model established in our
laboratory. In these mice, exons 1-3 of the RNF5 gene were
replaced by a Neo cassette (Fig. 7A). The chimeric mice gave a
germline transmission of the disrupted RNF5 gene (see Materials
and Methods for further details) and heterozygous mice were
interbred to produce litters that included homozygous offspring.
Southern blot analysis of mouse DNAs isolated from the tails of
these mice revealed the expected three genotypes (+/+, +/2, 2/
2), as judged by diagnostic probes for the correct 59 and 39
homologous recombination events (Fig. 7A).
RNF5 KO and WT animals were subjected to cardiotoxin
treatment, which induces muscle damage followed by its regener-
ation [33], thereby allowing us to monitor possible changes in the
ability of each genotype to promote muscle regeneration. The toxin,
or PBS control, was injected directly into the tibialis muscle and the
muscles were collected after 3, 4, 6, 12 and 28 days.
Significantly, the expression of RNF5 in WT muscle was
elevated after cardiotoxin treatment (Fig. 7B), thereby supporting a
role for RNF5 in muscle physiology/regeneration. To assess
whether increase of RNF5 levels in physiological conditions would
affect ER stress markers, we monitored the levels of GRP94 in
RNF5 KO and WT during the course of muscle regeneration.
Importantly, both induction of Grp94 expression and its post
translational modification, as defined by the disappearance of the
slower migrating form, were delayed in RNF5 KO mice,
compared with WT animals (Fig. 7B and Fig. S5). Of interest,
induction of calnexin was slightly delayed whereas expression of
PDI was elevated in RNF5 KO.
Consistent with the changes observed in induction of ER stress
markers, muscle regeneration in RNF5 KO mice was attenuated,
compared to control animals, as evident from (i) delayed
production of myosin heavy chain (Fig. 7B) and (ii) a high number
of centrally nucleated fibers observed 28 days after cardiotoxin
treatment in the KO but not WT animals (Fig. 7C). These data
substantiate the observations made with RNF5 Tg mice and
suggest that RNF5 is playing an important role in muscle
regeneration process associated with ER stress response.
Discussion
The present study establishes a link between RNF5 and specific
muscular disorders associated with ER stress. Prompted by our
observation that RNF5 is overexpressed and mislocalized to
aggregates in muscle biopsies from sIBM patients and deregulated
in an animal model for hereditary IBM, we have investigated the
role of RNF5 in muscle using 3 genetic mouse models: an
inducible transgenic mouse in which the E3 ligase RNF5 is
conditionally overexpressed (globally and selectively in skeletal
muscle) and an RNF5 KO mouse. RNF5 overexpression led to
myodegeneration and regeneration in skeletal muscle independent
of the classical dystrophic mechanism of sarcomeric disruption. In
addition, prolonged RNF5 overexpression leads to the formation
of blue-rimmed vacuoles containing inclusions and congo red
positive fibers, as seen in sIBM. Further, RNF5 KO mice subjected
to muscle damage exhibited a milder muscle phenotype which is
consistent with a slower regenerative process. Both RNF5
overexpression and KO models suggest that the muscle phenotypes
are associated with altered ER stress response, as shown by the
increaseintheERstressmarkersPDI,GRP78,GRP94andcalnexin
in the muscle of the RNF5-overexpressing animals and the delay in
GRP94 and calnexin induction in RNF5 KO. These observations
establish a link between RNF5, ER stress and muscle physiology.
The mouselinesestablishedandcharacterized inthisstudyoffer new
models to study ER-related myodegenerative process that occur in
myopathies such as sporadic or hereditary IBM.
Impairment of the ERAD and UPR pathways has been linked
with the onset of degenerative diseases such as sIBM, and is thought
to have a contributing role by allowing improper accumulation of
malfolded proteins. Consistent with this hypothesis, we found that
RNF5, an E3 ligase involved in ERAD, exhibit an altered pattern of
expression in biopsies from sIBM patients. Interestingly, RNF5 has
also been shown to be upregulated in brain (Substantia Nigra) from
Parkinson Disease patients [34], therefore pointing to a possible
broader role of this E3 ligase in degenerative disorders. The increase
in RNF5 expression seen in these degenerative diseases could be a
consequence of ER overload, ERAD dysfunction, or part of the
mechanism engaged inthe development ofthese disorders.Our data
supports the latter possibility since RNF5 overexpression is sufficient
to induce the myodegenerative process associated with both the
formation of blue-rimmed vacuole over time and an elevation of ER
stress markers, characteristic of sIBM. Our observation that RNF5
over-expression was not sufficient to promote the formation of
vacuoles containing inclusions at an early time point when ER stress
markers were already upregulated suggests that ER stress and RNF5
overexpression are among early events in the pathology of these
muscle disorders.
That RNF5 is deregulated in the DMRV mouse model, where a
sialation defect has previously been shown to promote the IBM-
like phenotype, implies that RNF5 deregulation may not be the
primary cause for the disease but rather be one of the early
components contributing to the pathological process.
Among mechanisms that may account for the ability of RNF5
to cause myodegeneration is the effect of RNF5 on ER stress
response and ERAD. RNF5 contributes to ubiquitination of
misfolded proteins, with a concomitant effect on their clearance of
the proteins by the proteasomes [23]. RNF5 also controls ERAD
through its effect on JAMP, an ER anchored 7 transmembrane
protein which is important for proteasome recruitment to the ER
(our unpublished observation). Thus, RNF5 overexpression is
expected to impair the ER stress response, consistent with the
modification of ER stress associated chaperones observed in our
mouse model. Of importance is that accumulating pathological
evidence now links mutations or dysregulation of ER-related
proteins with muscular disorders. For example, mutations in the
ER-associated ATPase p97/VCP have been associated with a
specific type of inclusion body myopathy associated with Paget
disease [35]. In addition, the p97/VCP and ERAD pathways were
recently implicated in the degradation of sarcomeric myosin and
its chaperone Unc-45 [36,37], thereby offering a link between
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org 10 February 2008 | Volume 3 | Issue 2 | e1609

Page 11

physiologic ER function and the organization of essential
structural muscle components. Further, activation of ER stress
was implicated in an animal model of autoimmune myositis with
increased expression of MHC class I in muscle fibers and in
human myositis patients [38]. ER overload may be sufficient to
trigger muscle regeneration prior to, and independently of, the
onset of inflammation, supporting ER dysfunction as a primary
cause of fiber damage [38,39]. Thus, RNF5 overexpression may
impair the ER function, ultimately leading to a defect in the
process of muscle maintenance.
Independent evidence also supports the fact that ER-associated
processes are physiologically relevant during muscle regeneration.
The chaperone protein GRP94 and the ER-stress-responsive
transcription factor ATF6 were upregulated and required for
proper myoblast differentiation in vitro [29,31]. UPR has recently
been proposed to be part of a quality control mechanism that
determines proper muscle differentiation. In this model, the
induction of certain UPR components, such as the transcription
factor Xbp1, is used as a threshold to determine the progression of
the myoblast into the differentiation program and the survival of
Figure 7. Delayed Muscle regeneration in RNF5 KO mouse subjected to muscle damage by cardiotoxin treatment. A. Generation of
RNF5 KO mouse. Schematic of RNF5 genomic structure (upper) and targeting vector (lower) are shown. Restriction enzyme sites (K: KpnI, Xh: XhoI, S:
SalI) are marked. Location of the primers for PCR and the probe for Southern blotting are indicated. Exons 1, 2 and 3 including the translational start
site (ATG) and RING finger domain are substituted with neo cassette. Southern blot for analysis of RNF5 gene is shown on the right panel. DNA
isolated from the tails of +/+, +/2, and 2/2 mice was digested with EcoRI and resolved by electrophoresis through 0.8% agarose gels. After
transferring to nitrocellulose paper, blots were hybridized with radiolabeled cDNA probes corresponding to the fragment indicated in diagram. B.
Protein extracts from cardiotoxin and PBS treated tibialis muscles from WT and RNF5 KO animals were analyzed by western blots with the indicated
antibodies to monitor changes in endogenous RNF5 as well as ER stress and muscle markers. Ponceau staining is used as a loading control. C. Cross
section of tibialis anterior from WT and RNF5 KO mice performed 28 days after cardiotoxin treatment.
doi:10.1371/journal.pone.0001609.g007
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org11February 2008 | Volume 3 | Issue 2 | e1609

Page 12

the differentiated fiber [40,41,42]. Deregulation of RNF5 in this
context is expected to interfere with the balance of these
components most probably as a downstream component of this
system, therefore altering the differentiation and the muscle
maintenance programs. Of interest, RNF5 E3 ligase activity does
not appear to be required for the muscular phenotype, as Tg mice
that expresses RING mutant form of RNF5 exhibits similar
phenotypes (data not shown). Consistent with this observation, a
close homolog of RNF5, RNF185, was shown to control paxillin
turn-over during Xenopus development independently of its E3
ligase activity [43]. Among possibilities to explain ubiquitin ligase
independent effect of RNF5 is that RNF5 may impair muscle
function by squelching or recruiting components of the ER
machinery, by outcompeting its associated ligases (i.e. CHIP or
gp78), or by acting as an E4 ligase on specific substrates after their
ubiquitination by another E3 for which ligase activity may not
always be required (i.e. p300 [44]).
In conclusion, the characterization of the RNF5 transgenic and
KO mouse models establishes an undisclosed link between impaired
ERstressresponse and the early changesindegenerative myopathies,
shown here for sIBM, while offering a novel model for studying the
complex function of the ER in global muscle physiology.
Methods
Generation of RNF5 transgenic mice
Mouse studies were performed under IACUC approvals from
MSSM and BIMR. The mouse isoform of the RNF5 gene was
clonedbyPCR inframe withthe HAtaginto thepTRE2-HA vector
using MluI and NheI restriction sites and sequenced. The linear
fragment resulting from a HpaI-SapI digestion was then used for
pronuclear injection. After microinjection into B6C3 (C57BL/
66C3H) F2 hybrid eggs, the fertilized eggs were transferred into
C57/BL6 female recipients and crossed with C57/BL6 males.
Conditional RNF5 overexpression was achieved by crossing RNF5
STg animals with rtTA Tg mice, expressing the tetracycline-
responsive Transcriptional Activator under control of the ubiquitous
CMV-b-actin promoter, and the genotypes were verified by PCR
reaction using the following primers (RNF5-forward:
GTACCCATACGATGTTCCAGATTACGC;
RNF5-reverse: CTGAGCAGCCAGAAAAAGAAAAAGATG;
rtTA-forward: CGGGTCTACCATCGAGGGCCTGCT;
rtTA-reverse: CCCGGGGAATCCCCGTCCCCCAAC);
Both RNF5 and rtTA transgenic lines were kept as heterozygous
and maintained as separate lines by crossing with WT C57/BL6
animals.
MCK-tTA transgenic animals were obtained from Taconic
Farms, as a repository for NIH deposited mouse strains and
genotypes using the same primers as for rtTA animals.
Immunoblot and immunohistochemistry analysis
For expression analysis, frozen tissues were collected, flash frozen
and pulverized using a mortar and pestle in liquid nitrogen. Proteins
were extracted by resuspension in cold RIPA buffer containing anti-
proteases and the extracts homogenized and clarified by high speed
centrifugation. The protein concentration in the supernatant was
determined byBradfordassay.RNF5expressionwasanalyzedeither
by straight immunoblot or after immunoprecipation using an
affinity-purified RNF5 polyclonal antibody (1:2000 dilution).
Expression for ER stress markers was assessed using rabbit GRP78
(Santa Cruz), rabbit GRP94 (Abcam) and mouse PDI (StressGene)
antibodies and using GAPDH (Ambion) as a control.
For immunohistochemistry analysis, skeletal muscle tissues
embedded in O.C.T. Compound (Sakura Tissue-Tek, product
#4583) were pinned on cork pieces and snap-frozen in isopentane
cooled in liquid nitrogen. Frozen tissues were stored at 280uC
until cross-sections (8 mm thick) were prepared using a Leica
CM3050S cryostat and stained.
H&E stainings and Gomori-Trichrome were performed as
previously described [45]. For immunostaining, sections were fixed
in cold acetone for 5 min, permeabilized with 0.1% Triton X for
10 min and blocked with 1% glycine for 30 min. Immunostainings
were performed using dystrophin antibody (Vector clone Dy8/
6C5, diluted 1:20), CD45 (BD Pharmingen, clone 30-F11, diluted
1:200), Cd11b (BD Pharmingen, clone M170, diluted 1:100),
embMHC (hybridoma bank F1.652, diluted 1:3), myogenin
(hybridoma bank F5D, diluted 1:100), laminin a2 antibody
(abcam 4H8-2,). RNF5 polyclonal antibody generated using full
length bacterially produced RNF5. Rabbit’s serum was purified on
RNF5 affinity column and used (dilution 1:100). For mouse
monoclonal antibodies, the sections were incubated in biotinylated
anti-mouse and avidin-conjugated fluorescein. (Mouse on Mouse
Kit, Vector #FMK2201) For rat and rabbit antibodies, the
sections were incubated with alexa fluor conjugated secondary
antibodies and diluted 1:600 in Dako antibody diluent (#S3022)
for 1 h at RT. Images were captured using an Olympus IX71
fluorescence microscope and the Slidebook version 4.0 software.
SamplesfromhumanmusculardisorderswereobtainedunderIRB
approval at the corresponding collaborating institutes in Italy and
Japan. For the human sampleprocessing, immunohistochemistry was
performed on unfixed cryostat sections of diagnostic muscle biopsies
from patients with the following diagnosis: s-IBM (10), DMD (2),
BMD (2), normal muscle (3). After blocking, sections were incubated
overnight at 4u with RNF5 antibody (1:100) and either monoclonal
anti-phosphorylated tau SMI31 (1:5000, (Sternberger Monoclonals,
Baltimore, MD, USA) or anti-beta amyloid protein (1:100, Biosource
International, Camarillo, CA, USA, clone 6E10). Sections were
incubated for1 hrat RT with the appropriate Alexa fluor-conjugated
secondary antibodies and Hoechst 33258 (Molecular Probes Inc.)
staining was used to visualize cell nuclei. Slides were analyzed under a
laser scanning confocal microscope SP5 (Leica, Germany)
Phenotypic analysis of double transgenic and control
animals
A 2 mg/ml solution of doxycyclin supplemented with 5% sucrose
was given to littermates animals between 12 wk and 24 wk of age in
drinking water for 6 wk. Phenotypic alteration (body mass, weakness,
blood withdrawal) were observed bi-weekly and the animals were
sacrificed after 6 wk of treatment. Organs were individually weighed
on a precision sale after trimming of the extra-tissues. Organs were
then flash frozen in liquid nitrogen for expression analysis and frozen
in OTC for immunohistochemical analysis.
Electron Microscopy
Glutaraldehyde-fixed muscle specimens were post-fixed in
osmium tetroxide, and dehydrated in serial alcohol solutions and
propylene oxide prior to embedding in araldite resin. Thick
sections (1 mm) were stained with toluidine blue for light
microscopy and ultrathin (60 nm) sections stained with uranyl
acetate and lead citrate for electron microscopy.
Morphometric analysis of skeletal muscle cross-sections
Cross-sections of the triceps brachii, tibialis anterior, and vastus
lateralis muscles from the double transgenic animals and their
matching controls were immunostained with dystrophin and H&E
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org12February 2008 | Volume 3 | Issue 2 | e1609

Page 13

to delineate the fibers, and the cross-section area of each fiber was
quantified using Scion software (version 4.0.3.2; NIH).
Evans Blue Dye Injection
EvansBlueDye(SIGMA)wasdilutedinPBS(10mg/ml)andfilter-
sterilized and the dye was injected through the tail vein at a
concentration of 100ml per gram of body weight. Sixteen hours after
injection, the mice were sacrificed and dissected muscles inspected for
presence of blue dye in the muscle. Skeletal muscles were then fresh-
frozen and cross-sections were further analyzed for presence of dye
and counter-stained with dystrophin antibody as described above.
Serum Creatine Kinase Assay
150 ml of blood was collected in heparin-treated tubes from
periorbital bleeding and the serum fraction extracted by double
centrifugation for 5 min at 5000 rpm. Creatine kinase levels were
monitored using CPK-NAC kit (JAS Diagnostics #CPK1-15) and
analyzed on a Roche Cobas Mira classic apparatus.
Isolation of primary myoblast from muscle fibers
One month old animals (RNF5 STg and rtTA RNF5 DTg) were
sacrificed and tibialis anterior, gastrocnemius and soleus muscles
were collected and rinsed in sterile PBS. Muscles were then
digested in sterile filtered type 1 collagenase (0.2%) in DMEM
using a shaking water bath for 2 hours at 37 degrees. Muscle fibers
were then extracted by trituration after dilution of the digestion
medium in one volume of DMEM. Single muscle fibers were then
separated from debris by gently aspirating the fibers under a
dissecting microscope and transferring them in a new dish
containing DMEM plus 10% horse serum. This step was repeated
3 or 4 times in a row to separate intact fibers from the debris. 20 to
30 fibers were then plated in 60 mm dishes coated with 10%
Matrigel and were incubated for 12–24 hours in DMEM plus
10% horse serum. Satellite cells were then allowed to proliferate
for 3 days by changing the medium to DMEM plus 20% FBS,
10% horse serum, 0,5% chick embryo extract. Differentiation of
myoblasts was subsequently achieved by changing the medium to
2% horse serum plus 0.5% chick embryo extract in DMEM.
Doxycyclin (2 mg/ml) was added to the proliferation medium and
the differentiation media to promote and maintain the expression
of RNF5 transgene before and during the differentiation process.
Immunocytochemistry
Cells were washed in PBS and fixed using freshly prepared 3%
paraformaldehyde in PBS (10 min at room temperature). The cells
were then washed in PBS, followed by permeabilization in 0.1%
Triton X-100 in PBS (pH 7.4) for 5min on ice and an additional
three washes in PBS. Cells were then incubated in PBS
supplemented with 3% bovine serum albumin for 30 min. The
cells were incubated with antibodies (1 h at room temperature) in
a humidity chamber. The cells were washed in PBS (36, 5 min
each) before incubation with 100-ml of Alexa-488- and Alexa-568-
conjugated anti-rabbit or anti-mouse immunoglobulin G (Molec-
ular Probes) diluted (2 mg/ml) in PBS containing 3% BSA (60 min
at room temperature in a light protected humidity chamber). The
cells were rinsed three times in PBS and mounted on glass slides
using Vectashield (Vector Laboratories). Primary antibodies were
used as follows: RNF5 (1:200), sarcomeric alpha-actinin (Sigma,
1:5000), Pax7 (Hybridoma Bank, 1:10).
Generation of RNF5 KO animals
RNF5 targeting vector consisted of a 9kb 59 homologous region
and 1.5 kb 39 homologous region of RNF5 genomic sequence which
was inserted into 59 of Neo gene cassette using PspOMI site. The
Neo gene cassette was inserted to replace exon 1, 2 and 3 including
the first ATG. Linearized targeting vector (10 mg) was transfected by
electroporation into 129SvEv ES cells and screened for G418-
resistantclones. Surviving colonies were expanded and PCR analysis
was performed to identify clones that had undergone homologous
recombination. Homologous recombination was confirmed by PCR
using primer pairs, ZESA6 59-GCCAGCTGAAGGTGAGGGAC-
TGGAC-39 and Neo1 59-TGCGAGGCCAGAGGCCACTTGT-
GTAGC-39 The correctly targeted ES cell lines were microinjected
into C57BL/6J blastocytes. The chimeric mice were generated and
selected for a germline transmission of the disrupted RNF5 gene.
Heterozygous mice were interbred to produce litters that included
homozygous offspring. Additional analysis was carried out using
DNA prepared from the MEFs that were obtained from these mice,
further confirming the deletion of RNF5 gene. Chimeric mice with
germline transmission were mated with C57BL/6J. The targeting
vector and KO mice were generated by ITL, (Long Island NY).
Backcross to C57BL/6J allowed to generate .90% strain.
Genotyping were carried out by Southern blotting or PCR. Primers
used for PCR were ZESA2 59-CCCTATGTCCTACAGGC-
TCTG-39 and ZESA20 59-ACACGATGCTGAGGGGAGCTG-
CAG-39 for the wild type allele, and ZESA6 and Neo1 for the
targeted allele.
Cardiotoxin treatment
Four-month-old wild-type and RNF5 null animals were
anaesthetized with isoflurane, and 100 ml of 10 mM cardiotoxin
(CalBiochem) in 1xPBS was injected into the right tibialis muscle.
The animals were sacrificed at 3, 4, 6, 12 and 28 days after
cardiotoxin injection. Tibialis muscles were harvested tendon-to-
tendon and mounted in OCT or flash frozen in liquid nitrogen for
histological or protein analysis.
RNF5 silencing by siRNA
The pCMS3-cherry vector was used to transfect short
interfering RNA (siRNA) targeting RNF5 and its corresponding
scramble control into Hela cells. Two 64-base complementary
oligonucleotides (59GATCCCCAGCTGGGATCAGCAGAGA-
GttcaagagaCTCTCTGCTGATCCCAGCT TTTTTGGAAA39
and 59AGCTTTTCCAAAAAAGCTGGGATCAGCAG AGA-
GTCTCTTGAACTCTCTGCTGATCCCAGCTGGG-39) were
synthesized to contain a RNF5 19-nucleotide sequence or its
scramble counterpart ( 59-GATCCCC AGCTGGCATCAGCA-
GGGAG ttcaagaga CTCCCTGCTGATGCCAGCT TTTTTG-
GAAA 39 and 59AGCTTTTCCAAAAAAGCTGGCATCAG-
CAGGGA GTCTCTTGAACTCCCTGCTGATGCCAGCTG-
GG 39). The annealed product containing 59 and 39 overhangs
compatible with BglII and HindIII restriction sites, respectively
was then ligated into pCMS3-cherry digested with BglII and
HindIII [46].
Supporting Information
Figure S1
staining in cells where RNF5 expression has been downregulated
by specific shRNA. HeLa cells were transfected with a plasmid
expressing both the Cherry fluorescent marker and RNF5-specific
shRNA or its scrambled version and analyzed for RNF5
expression by immunocytochemistry after 36 hours. B. Specificity
of RNF5 antibody on muscle cross-sections. Triceps brachii cross-
sections from RNF5 DTg or STg were stained with RNF5
antibody or a similar concentration of rabbit IgG. Arrowheads
point areas of RNF5 staining.
Specificity of RNF5 antibody. A. Specificity of RNF5
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org 13 February 2008 | Volume 3 | Issue 2 | e1609

Page 14

Found at: doi:10.1371/journal.pone.0001609.s001 (2.89 MB TIF)
Figure S2
immunostaining of muscle sections from Duchenne Muscular
Dystrophy (DMD) and Becker Muscular Dystrophy (BMD)
patients compared to a normal muscle cross-section. Arrowheads
point to RNF5 staining.
Found at: doi:10.1371/journal.pone.0001609.s002 (4.86 MB TIF)
RNF5 expression in human myopathies. RNF5
Figure S3
ations in the dystrophin-glycoprotein complex. Cross-sections of
vastus lateralis from treated DTg or control mice were subjected to
immunostaining using dystrophin (A) laminin a3 (B) and alpha-
dystroglycan (C), revealing a normal pattern of sarcolemmal and
extracellular matrix staining.
Found at: doi:10.1371/journal.pone.0001609.s003 (4.51 MB TIF)
RNF5 overexpression is not associated with alter-
Figure S4
differentiation and sarcomeric organization of primary myoblasts.
Primary myoblasts were isolated from 1 month old animals (RNF5
STg and rtTA RNF5 DTg) and grown in the presence of
doxycyclin (2 mg/ml). Differentiation was achieved by switching
cells to differentiation medium supplemented with ITS (Insulin
Transferrin Selenium supplement). Induction of RNF5 in primary
myoblasts prior to differentiation was confirmed by co-immuno-
staining with Pax7 (A) and the efficiency of myoblast differenti-
ation was monitored by analysis of phase contrast images (bottom
RNF5 overexpression does not prevent proper
panels) and immunostaining the sarcomeres with sarcomeric
alpha-actinin (upper panels) (B).
Found at: doi:10.1371/journal.pone.0001609.s004 (9.47 MB TIF)
Figure S5
RNF5 KO and WT animals. Proteins prepared from muscle of
RNF5 KO or WT animals were quantified and analyzed by
western blot analysis using antibodies to GRP94. Upper band
correspond to a post translationally modified form of GRP94.
Found at: doi:10.1371/journal.pone.0001609.s005 (0.45 MB TIF)
GRP94 expression in muscles of cardiotoxin-treated
Acknowledgments
The authors thank Norma Huff for great technical support on muscle
preparation, Chiara Mozzetta and Sonia Forcales for help on muscle fiber
isolation and valuable advice and Daniel Billadeau for providing us with
shRNA expression vectors and Dr Nina Raben for providing us with
MCK-tTA mouse strain. We also thank Dr Valerie Askanas and members
of the Ronai lab for helpful discussion.
Author Contributions
Conceived and designed the experiments: ZR AD KB YH MM GS.
Performed the experiments: AD KB YH MM SJ AM BK DB MCM RM
AB LG. Analyzed the data: ZR AD KB YH MM PP GS MCM.
Contributed reagents/materials/analysis tools: SL ZR AD KB YH MM PP
SJ CS GS MCM. Wrote the paper: ZR AD GS.
References
1. Boonyarom O, Inui K (2006) Atrophy and hypertrophy of skeletal muscles:
structural and functional aspects. Acta Physiol (Oxf) 188: 77–89.
2. Glass DJ (2003) Signalling pathways that mediate skeletal muscle hypertrophy
and atrophy. Nat Cell Biol 5: 87–90.
3. Tisdale MJ (1997) Biology of cachexia. J Natl Cancer Inst 89: 1763–1773.
4. Jackman RW, Kandarian SC (2004) The molecular basis of skeletal muscle
atrophy. Am J Physiol Cell Physiol 287: C834–843.
5. Reid MB (2005) Response of the ubiquitin-proteasome pathway to changes in
muscle activity. Am J Physiol Regul Integr Comp Physiol 288: R1423–1431.
6. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, et al. (2001)
Identification of ubiquitin ligases required for skeletal muscle atrophy. Science
294: 1704–1708.
7. Witt SH, Granzier H, Witt CC, Labeit S (2005) MURF-1 and MURF-2 target a
specific subset of myofibrillar proteins redundantly: towards understanding
MURF-dependent muscle ubiquitination. J Mol Biol 350: 713–722.
8. Clarke BA, Drujan D, Willis MS, Murphy LO, Corpina RA, et al. (2007) The
E3 Ligase MuRF1 Degrades Myosin Heavy Chain Protein in Dexamethasone-
Treated Skeletal Muscle. Cell Metab 6: 376–385.
9. Fielitz J, van Rooij E, Spencer JA, Shelton JM, Latif S, et al. (2007) Loss of
muscle-specific RING-finger 3 predisposes the heart to cardiac rupture after
myocardial infarction. Proc Natl Acad Sci U S A 104: 4377–4382.
10. Hishiya A, Iemura S, Natsume T, Takayama S, Ikeda K, et al. (2006) A novel
ubiquitin-binding protein ZNF216 functioning in muscle atrophy. Embo J 25:
554–564.
11. Nastasi T, Bongiovanni A, Campos Y, Mann L, Toy JN, et al. (2004) Ozz-E3, a
muscle-specific ubiquitin ligase, regulates beta-catenin degradation during
myogenesis. Dev Cell 6: 269–282.
12. McElhinny AS, Perry CN, Witt CC, Labeit S, Gregorio CC (2004) Muscle-
specific RING finger-2 (MURF-2) is important for microtubule, intermediate
filament and sarcomeric M-line maintenance in striated muscle development.
J Cell Sci 117: 3175–3188.
13. Frosk P, Weiler T, Nylen E, Sudha T, Greenberg CR, et al. (2002) Limb-girdle
muscular dystrophy type 2H associated with mutation in TRIM32, a putative
E3-ubiquitin-ligase gene. Am J Hum Genet 70: 663–672.
14. Schoser BG, Frosk P, Engel AG, Klutzny U, Lochmuller H, et al. (2005)
Commonality of TRIM32 mutation in causing sarcotubular myopathy and
LGMD2H. Ann Neurol 57: 591–595.
15. Kudryashova E, Kudryashov D, Kramerova I, Spencer MJ (2005) Trim32 is a
ubiquitin ligase mutated in limb girdle muscular dystrophy type 2H that binds to
skeletal muscle myosin and ubiquitinates actin. J Mol Biol 354: 413–424.
16. Askanas V, Engel WK (2006) Inclusion-body myositis: a myodegenerative
conformational disorder associated with Abeta, protein misfolding, and
proteasome inhibition. Neurology 66: S39–48.
17. Vattemi G, Engel WK, McFerrin J, Askanas V (2004) Endoplasmic reticulum
stress and unfolded protein response in inclusion body myositis muscle.
Am J Pathol 164: 1–7.
18. Kyushiki H, Kuga Y, Suzuki M, Takahashi E, Horie M (1997) Cloning,
expression and mapping of a novel RING-finger gene (RNF5), a human
homologue of a putative zinc-finger gene from Caenorhabditis elegans.
Cytogenet Cell Genet 79: 114–117.
19. Matsuda N, Suzuki T, Tanaka K, Nakano A (2001) Rma1, a novel type of
RING finger protein conserved from Arabidopsis to human, is a membrane-
bound ubiquitin ligase. J Cell Sci 114: 1949–1957.
20. Broday L, Kolotuev I, Didier C, Bhoumik A, Podbilewicz B, et al. (2004) The
LIM domain protein UNC-95 is required for the assembly of muscle attachment
structures and is regulated by the RING finger protein RNF-5 in C. elegans.
J Cell Biol 165: 857–867.
21. Zengel JM, Epstein HF (1980) Mutants altering coordinate synthesis of specific
myosins during nematode muscle development. Proc Natl Acad Sci U S A 77:
852–856.
22. Didier C, Broday L, Bhoumik A, Israeli S, Takahashi S, et al. (2003) RNF5, a
RING finger protein that regulates cell motility by targeting paxillin
ubiquitination and altered localization. Mol Cell Biol 23: 5331–5345.
23. Younger JM, Chen L, Ren HY, Rosser MF, Turnbull EL, et al. (2006)
Sequential quality-control checkpoints triage misfolded cystic fibrosis trans-
membrane conductance regulator. Cell 126: 571–582.
24. Malicdan MC, Noguchi S, Nonaka I, Hayashi YK, Nishino I (2007) A Gne
knockout mouse expressing human GNE D176V mutation develops features
similar to distal myopathy with rimmed vacuoles or hereditary inclusion body
myopathy. Hum Mol Genet 16: 2669–2682.
25. Wiekowski MT, Chen SC, Zalamea P, Wilburn BP, Kinsley DJ, et al. (2001)
Disruption of neutrophil migration in a conditional transgenic model: evidence
for CXCR2 desensitization in vivo. J Immunol 167: 7102–7110.
26. Charge SB, Rudnicki MA (2004) Cellular and molecular regulation of muscle
regeneration. Physiol Rev 84: 209–238.
27. Xu C, Bailly-Maitre B, Reed JC (2005) Endoplasmic reticulum stress: cell life
and death decisions. J Clin Invest 115: 2656–2664.
28. Kaufman RJ (2002) Orchestrating the unfolded protein response in health and
disease. J Clin Invest 110: 1389–1398.
29. Nakanishi K, Sudo T, Morishima N (2005) Endoplasmic reticulum stress
signaling transmitted by ATF6 mediates apoptosis during muscle development.
J Cell Biol 169: 555–560.
30. Tarricone E, Ghirardello A, Zampieri S, Elisa RM, Doria A, et al. (2006)
Cell stress response in skeletal muscle myofibers. Ann N Y Acad Sci 1069:
472–476.
31. Gorza L, Vitadello M (2000) Reduced amount of the glucose-regulated protein
GRP94 in skeletal myoblasts results in loss of fusion competence. Faseb J 14:
461–475.
32. Ghersa P, Gobert RP, Sattonnet-Roche P, Richards CA, Merlo Pich E, et al.
(1998) Highly controlled gene expression using combinations of a tissue-specific
promoter, recombinant adenovirus and a tetracycline-regulatable transcription
factor. Gene Ther 5: 1213–1220.
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org 14 February 2008 | Volume 3 | Issue 2 | e1609

Page 15

33. d’Albis A, Couteaux R, Janmot C, Mira JC (1989) Myosin isoform transitions in
regeneration of fast and slow muscles during postnatal development of the rat.
Dev Biol 135: 320–325.
34. Kim JM, Lee KH, Jeon YJ, Oh JH, Jeong SY, et al. (2006) Identification of
genes related to Parkinson’s disease using expressed sequence tags. DNA Res 13:
275–286.
35. Watts GD, Wymer J, Kovach MJ, Mehta SG, Mumm S, et al. (2004) Inclusion
body myopathy associated with Paget disease of bone and frontotemporal
dementia is caused by mutant valosin-containing protein. Nat Genet 36:
377–381.
36. Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmuller H, et al. (2007) The
ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human
myopathy. Nat Cell Biol 9: 379–390.
37. Landsverk ML, Li S, Hutagalung AH, Najafov A, Hoppe T, et al. (2007) The
UNC-45 chaperone mediates sarcomere assembly through myosin degradation
in Caenorhabditis elegans. J Cell Biol 177: 205–210.
38. Nagaraju K, Casciola-Rosen L, Lundberg I, Rawat R, Cutting S, et al. (2005)
Activation of the endoplasmic reticulum stress response in autoimmune myositis:
potential role in muscle fiber damage and dysfunction. Arthritis Rheum 52:
1824–1835.
39. Nagaraju K, Raben N, Loeffler L, Parker T, Rochon PJ, et al. (2000)
Conditional up-regulation of MHC class I in skeletal muscle leads to self-
sustaining autoimmune myositis and myositis-specific autoantibodies. Proc Natl
Acad Sci U S A 97: 9209–9214.
40. Acosta-Alvear D, Zhou Y, Blais A, Tsikitis M, Lents NH, et al. (2007) XBP1
controls diverse cell type- and condition-specific transcriptional regulatory
networks. Mol Cell 27: 53–66.
41. Blais A, Tsikitis M, Acosta-Alvear D, Sharan R, Kluger Y, et al. (2005) An initial
blueprint for myogenic differentiation. Genes Dev 19: 553–569.
42. Nakanishi K, Dohmae N, Morishima N (2007) Endoplasmic reticulum stress
increases myofiber formation in vitro. Faseb J 21: 2994–3003.
43. Iioka H, Iemura S, Natsume T, Kinoshita N (2007) Wnt signalling regulates
paxillin ubiquitination essential for mesodermal cell motility. Nat Cell Biol 9:
813–821.
44. Grossman SR, Deato ME, Brignone C, Chan HM, Kung AL, et al. (2003)
Polyubiquitination of p53 by a ubiquitin ligase activity of p300. Science 300:
342–344.
45. Dubowitz V (1985) Muscle biopsy: A practical approach; Ed B-TWBSn, editor.
London, Toronto.
46. Gomez TS, Hamann MJ, McCarney S, Savoy DN, Lubking CM, et al. (2005)
Dynamin 2 regulates T cell activation by controlling actin polymerization at the
immunological synapse. Nat Immunol 6: 261–270.
RNF5 in ER-Related Disorders
PLoS ONE | www.plosone.org 15 February 2008 | Volume 3 | Issue 2 | e1609