An inverse agonist of the histamine H(3) receptor improves wakefulness in narcolepsy: studies in orexin-/- mice and patients.

Abstract

Narcolepsy is characterized by excessive daytime sleepiness (EDS), cataplexy, direct onsets of rapid eye movement (REM) sleep from wakefulness (DREMs) and deficiency of orexins, neuropeptides that promote wakefulness largely via activation of histamine (HA) pathways. The hypothesis that the orexin defect can be circumvented by enhancing HA release was explored in narcoleptic mice and patients using tiprolisant, an inverse H(3)-receptor agonist. In narcoleptic orexin(-/-) mice, tiprolisant enhanced HA and noradrenaline neuronal activity, promoted wakefulness and decreased abnormal DREMs, all effects being amplified by co-administration of modafinil, a currently-prescribed wake-promoting drug. In a pilot single-blind trial on 22 patients receiving a placebo followed by tiprolisant, both for 1 week, the Epworth Sleepiness Scale (ESS) score was reduced from a baseline value of 17.6 by 1.0 with the placebo (p>0.05) and 5.9 with tiprolisant (p<0.001). Excessive daytime sleep, unaffected under placebo, was nearly suppressed on the last days of tiprolisant dosing. H(3)-receptor inverse agonists could constitute a novel effective treatment of EDS, particularly when associated with modafinil.

Full text

Page 1

Regular article
AN INVERSE AGONIST OF THE HISTAMINE H3-RECEPTOR
IMPROVES WAKEFULNESS IN NARCOLEPSY: STUDIES IN
OREXIN-/- MICE AND PATIENTS

Jian-Sheng Lin1, Yves Dauvilliers2, Isabelle Arnulf3, Hélène Bastuji4, Christelle Anaclet1,
Régis Parmentier1, Laurence Kocher5, Masashi Yanagisawa6, Philippe Lehert7, Xavier
Ligneau8, David Perrin8, Philippe Robert8, Michel Roux9, Jeanne-Marie Lecomte9 and Jean-
Charles Schwartz8, 9

1 INSERM-U628, 69373-Lyon, France; Université Claude Bernard, 69373-Lyon, France.
2 Neurologie, INSERM-U888, CHU Hôpital Gui de Chauliac, 34925-Montpellier, France.
3 Hôpital de la Pitié-Salpêtrière, 75651-Paris, France.
4 Hôpital Neurologique, INSERM-U879, 69667-Bron, France.
5 Centre Hospitalier Lyon Sud, 69495-Pierre-Bénite, France.
6 Howard Hughes Medical Institute, University of Texas Southwestern Medical Center,
Dallas, TX 75390-8584, U.S.A.
7 Statistics Department, Faculty of Economics, FUCAM, Louvain Academy, Belgium.
8 Bioprojet-Biotech, 35762-Saint Grégoire, France.
9 Bioprojet, 75002-Paris, France.


Running title: H3-RECEPTOR INVERSE AGONIST & NARCOLEPSY



Correspondence should be addressed to

Dr. Jian-Sheng Lin, D.Sc., M.D.

INSERM/UCBL-U628, Integrated Physiology of Brain Arousal Systems
Department of Experimental Medicine, Faculty of Medicine, Claude Bernard University,
8 avenue Rockefeller, 69373 Lyon Cedex 08, France.

Tel (33) 4 78 77 70 41
Fax (33) 4 78 77 71 50
Email lin@univ-lyon1.fr

1
HAL author manuscript inserm-00215993, version 1
HAL author manuscriptHAL author manuscriptHAL author manuscript
HAL author manuscript inserm-00215993, version 1
Neurobiology of Disease 2007;:epub ahead of printNeurobiology of Disease 2008;30(1):74-83
HAL author manuscript inserm-00215993, version 1

Page 2

Abbreviations

DOPAC/DA, dihydroxyphenyl acetic acid/dopamine
DREM, direct REM sleep onset from wakefulness
ECG, electrocardiogram
EDS, excessive daytime sleepiness
EEG, electroencephalogram
EMG, electromyogram
ESS, Epworth sleepiness scale
HA, histamine
KO, knockout
MHPG/NA, 4-hydroxy-3-methoxy-phenylglycol/noradrenaline
MSLT, multiple sleep latency tests
MWT, maintenance of wakefulness test
REM, rapid eye movement
SWS, slow wave sleep
t-MeHA, tele-methylhistamine
WASO, wake-up episodes after sleep onset
WT, wild-type

2
HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 3

Abstract

Narcolepsy is characterized by excessive daytime sleepiness(EDS), cataplexy, direct
onsets of rapid eye movement(REM) sleep from wakefulness(DREMs) and deficiency of
orexins, neuropeptides that promote wakefulness largely via activation of histamine(HA)
pathways. The hypothesis that the orexin defect can be circumvented by enhancing HA
release was explored in narcoleptic mice and patients using tiprolisant, an inverse H3-receptor
agonist. In narcoleptic orexin-/-mice, tiprolisant enhanced HA and noradrenaline neuronal
activity, promoted wakefulness and decreased abnormal DREMs, all effects being amplified
by co-administration of modafinil, a currently prescribed wake-promoting drug. In a pilot
single-blind trial on 22 patients receiving a placebo followed by tiprolisant, both for one
week, the Epworth Sleepiness Scale(ESS) score was reduced from a baseline value of 17.6 by
1.0 with the placebo(p>0.05) and 5.9 with tiprolisant(p<0.001). Excessive daytime sleep,
unaffected under placebo, was nearly suppressed on the last days of tiprolisant-dosing. H3-
receptor inverse agonists could constitute a novel effective treatment of EDS, particularly
when associated with modafinil.


Keywords: Narcolepsy; sleep disorders; histamine; orexin; H3-receptor inverse agonist;
wakefulness; somnolence.

3
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 4

Introduction
Narcolepsy is a rare disabling sleep disorder with a prevalence of 0.02-0.18%; it is
characterized by excessive daytime sleepiness (EDS) and abnormal rapid eye movement
(REM or paradoxical) sleep manifestations, including cataplexy (sudden loss of muscle tone
triggered by strong emotions), direct transitions from wakefulness to REM sleep (DREMs),
sleep paralysis and hypnagogic hallucinations (Baumann et al., 2005; Mignot, 2005; Mignot
and Nishino, 2005; Dauvilliers et al., 2007).
Recent data in animal models revealed that deficient orexin (also known as hypocretin)
transmission causes narcolepsy (Lin et al., 1999; Chemelli et al., 1999). A marked decrease in
orexin-A levels in the cerebrospinal fluid and in the number of orexin neurons in post-mortem
brain tissues was also reported in patients with narcolepsy with cataplexy (Nishino et al.,
2000). Orexins are excitatory peptides released by neurons from the lateral hypothalamus with
widespread projections namely to aminergic neurons known to be involved in the control of
wakefulness, e.g. histaminergic or noradrenergic neurons (Bayer et al., 2001; Eriksson et al.,
2001; Bourgin et al., 2000). Since orexin neurons promote wakefulness, treatment by orexin
administration would be desirable in narcoleptic patients but, as is often the case with
peptides, it is not practically feasible for bioavailability reasons.
We reasoned that the lack of orexins could be circumvented by activating histaminergic
neurons pharmacologically. Histaminergic neurons emanate from the tuberomammillary
nucleus in the posterior hypothalamus and send excitatory terminals to the whole
telencephalon. These neurons represent a major waking system in the brain (Schwartz et al.,
1991; Lin, 2000) and appear necessary for the waking effect of orexins (Huang et al., 2001).
We examined this hypothesis, first using a reliable animal model of narcolepsy, the
orexin-/-mouse, which displays DREMs, a characteristic symptom of the disease (Chemelli et
al., 1999; Mignot, 2005; Fujiki, et al., 2006), then in narcoleptic patients, by testing the effects

4
HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1

Page 5

of tiprolisant (BF2.649), a potent and selective inverse agonist of the H3 receptors (Ligneau et
al., 2007a and 2007b) in both proof-of-concept studies. This class of agents is known to
promote wakefulness by inhibiting the constitutively active H3-autoreceptor, thereby
enhancing histaminergic neuron activity and histamine (HA) release (Schwartz et al., 1991;
Lin, 2000; Morisset et al., 2000; Vanni-Mercier et al., 2003; Parmentier et al., 2002, 2007).

Material and Methods
Animals and Surgery
All experiments followed EEC (86/609/EEC) and French National Committee (decree
87/848) directives and every effort was made to minimize the number of animals used and
any pain and discomfort. Prepro-orexin knockout (KO) mice were offspring of the mouse
strain generated by Chemelli et al. (1999) and kept on C57BL/6J genomic background. After
backcrossing male orexin-/- mice and female wild-type (WT) mice for nine generations, the
obtained orexin+/- mice were crossed to produce heterozygote and homozygote WT and KO
littermates. To determine their genotypes with respect to orexin gene, tail biopsies were
performed at the age of 4 weeks for DNA detection using PCR. The KO and WT alleles were
amplified using a neo primer, 5’-CCGCTATCAGGACATAGCGTTGGC, and two genomic
primers, 5’-GACGACGGCCTCAGACTTCTTGGG and
5’TCACCCCCTTGGGATAGCCCTTCC, the latter being common to KO and WT mice. The
expected products were 600 and 400 base pairs for KO and WT, respectively.
At the age of 12 weeks and with a body weight of 30±2 g, mice used for EEG and sleep-
wake studies were chronically implanted, under deep gas anesthesia using isoflurane (2%, 200
ml/min) and a TEM anesthesia system (Bordeaux, France), with six cortical electrodes
(gold-plated tinned copper wire, Ø = 0.4 mm, Filotex, Draveil, France) and three muscle
electrodes (fluorocarbon-coated gold-plated stainless steel wire, Ø = 0.03 mm, Cooner Wire

5
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1

Page 6

Chatworth, CA, U.S.A.) to record the electroencephalogram (EEG) and electromyogram
(EMG) and to monitor the sleep-wake cycle. All electrodes were previously soldered to a
multi-channel electrical connector and each was separately insulated with a covering of
heat-shrinkable polyolefin/polyester tubing. Cortical electrodes were inserted into the dura
through 3 pairs of holes (Ø = 0.5 mm) made in the skull, located respectively in the frontal (1
mm lateral and anterior to the bregma), parietal (1 mm lateral to the midline at the midpoint
between the bregma and lambda), and occipital (2 mm lateral to the midline and 1 mm
anterior to the lambda) cortex. Muscle electrodes were inserted into the neck muscles. Finally,
the electrode assembly was anchored and fixed to the skull with Super-Bond (Sun Medical
Co., Shiga, Japan) and dental cement. This implantation allows stable and long-lasting
polygraphic recordings (Parmentier et al., 2002).

Polygraphic recording in the mouse and data acquisition and analysis
After surgery, the animals were housed individually in transparent barrels (Ø = 20 cm,
height = 30 cm) placed in an insulated sound-proof recording room maintained at an ambient
temperature of 23 ± 1°C and on a 12 h light/dark cycle (lights-on at 7 a.m.), standard food and
water being available ad libitum. A videocamera with infrared and digital time recording
capabilities was set up in the recording room to observe and score, when necessary, the
animals’ behavior during the light or dark phase. After a 7-day recovery period, mice were
habituated to the recording cable for 7 days before polygraphic recordings were started.
Cortical EEG (contralateral frontoparietal leads) and EMG signals were amplified, digitized
with a resolution of 256 and 128 Hz, respectively, and computed on a CED 1401 Plus
(Cambridge, UK). Using a Spike2 script and with the assistance of spectral analysis using the
fast Fourier transform, polygraphic records were visually scored by 30-sec epochs for
wakefulness (W), slow wave sleep (SWS), and paradoxical or rapid eye movement (REM)

6
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 7

sleep according to previously described criteria validated for mice (Valatx, 1971; Valatx and
Bugat 1974, Parmentier et al., 2002). Direct REM sleep onset (DREMs) episodes, also called
narcoleptic episodes or sleep onset REM periods by some authors (Chemilli et al., 1999;
Mignot, 2005; Fujiki et al., 2006), were defined as the occurrence of REM sleep directly from
W, namely a REM episode that follows directly a wake episode lasting more than 60 sec
without being preceded by any cortical slow activity of more that 5 sec during the 60 sec.
To assess changes in the qualitative aspects of W following different drug treatments,
200 consecutive cortical EEG samples of 30 sec were extracted from the identified waking
state 30 min after drug dosing. Analysis of EEG power spectral density was then performed
within the 0.8-60 Hz frequency range using a fast Fourier transform routine. On the basis of
visual and spectral analysis, samples containing artifacts occurring during active waking (with
large movements) or immediately before or after other vigilance states (SWS, REMs or
DREMs) were identified and omitted from the spectral analysis. Data were collapsed in 0.4
Hz bins. The power densities obtained during waking were summed over the 0.8-60 Hz
frequency band (total power). To standardize the data, all power spectral densities at the
different frequency ranges (e.g., δ 0.8-3 Hz, θ 4-10 Hz, α 10-15 Hz, β 20-30 Hz and γ 30-60
Hz) were expressed as a percentage relative to the total power of the same epochs (e.g. power
in the fast rhythm ranges (β + γ 20-60 Hz) / total power (0.8-60 Hz) = relative power in 20-60
Hz).

Drug administration and experimental procedures in the mouse
After recovery from the surgery and habituation to the recording cables, each mouse
was subjected to a recording session of two continuous days, beginning at 7 a.m. During these
periods, the animals were left undisturbed to obtain baseline parameters on the cortical EEG,
sleep-wake cycle and circadian rhythm. After baseline recordings, animals were subjected to

7
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 8

cortical EEG and sleep-wake recordings following administration of either a placebo (vehicle)
or tiprolisant and/or modafinil. The vehicle consisted of 0.05 ml of NaCl at 0.9% containing
methylcellulose at 1%. The doses used were 20 mg/kg for tiprolisant and 64 mg/kg for
modafinil because of their equal potency in wake duration, as established during a pilot study.
Drugs were dissolved in the vehicle, fresh before each administration, and were administered
orally using a mouse gavage probe (20G, Phymep, Paris). All administrations were performed
at 6.45 p.m. just before lights-off (7.00 p.m.), because orexin-/- mice display narcoleptic
attacks only during lights-off phase (Chemilli et al., 1999 and our pilot study) and therefore
this period is adequate for detecting any narcoleptic effect. The order of administration was
randomized. Polygraphic recordings were made immediately after administration and were
maintained during the whole lights-off period (12h). Two administrations were separated by a
period of 7 days (washout).

Neurochemistry in the mouse
WT and orexin-/- mice received drugs orally between 7.30 p.m. and 8.30 p.m. (dark
period). They were decapitated 90 min after dosing. Blood was collected on heparin and
stored at + 4°C before centrifugation (12,000 rpm, 20 min, + 4°C) to obtain plasma. Brain
tissues were removed out, weighed and immediately frozen in liquid nitrogen. Plasma and
tissues were stored at -80°C until analysis. Whole brain tissues were homogenized in 10
volumes (w/v) of ice-cold 0.4 N perchloric acid with 2.7 mM EDTA. The clear supernatant
obtained after centrifugation (2,000 x g, 30 min, + 4°C) was stored at -80°C before measuring
tele-methylhistamine (t-MeHA) by enzymoimmunoassay (Ligneau et al., 1998), monoamines
and their metabolites by high performance liquid chromatography (HPLC) coupled to
electrochemical detection (Ligneau et al., 2007) and drug levels by LC-MS/MS.


8
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 9

Tiprolisant and modafinil assays in the mouse
Plasma and tissue supernatants samples were extracted using 1 ml Oasis HLB SPE
cartridges (Waters, Saint-Quentin-en-Yvelines, France) preconditioned with 0.5 ml of
methanol, followed by 0.5 ml of water. Half a milliliter of the processed sample was pulled
through the cartridge before washing with 0.5 ml of 5% methanol in water and elution with
0.25 ml of methanol. The methanolic eluant was dried at 43°C under vacuum, and the dried
residue was reconstituted with 100 µl of the LC mobile phase, and an aliquot of 20 µl was
injected into the LC-MS/MS system (Waters), a Quattro Micro system equipped with an
Alliance 2795 pump and an electro-spray ionization (ESI) interface. The chromatographic
separation was carried out on a X-Terra MS C18 reversed phase column (1.5 x 100 mm, 3.5
µm, Waters) with a binary mobile phase (0.02% trifluoroacetic acid in water) in gradient
conditions (5-65% of acetonitrile in 6.5 min). The flow (0.6 ml/min) was split 1:3 and
introduced into the ESI source. Argon was used as collision gas at collision energies of 30 eV
for tiprolisant, 15 eV for modafinil and 35 eV for BF4.947 (i.e. (4[4-(2-fluorophenyl)
piperazin-1-yl] butyl)-2-naphtalenecarboxamide) used as internal standard (IS). Ions of m/z
296.1, 296 and 406.3 corresponding to the protonated molecules of tiprolisant, modafinil and
IS, respectively, were selected as precursor ions. Peak area ratios of tiprolisant/IS or
modafinil/IS over an effective calibration range of 1 to 100 ng/ml (with a limit of
quantification of 1 ng/ml) were used to determine tiprolisant and modafinil levels.

Patients
Twenty-two adult patients (14 men and 8 women) diagnosed with narcolepsy,
comprising 21 with clear-cut cataplexy, were included in the study. Inclusion criteria for
narcolepsy were the presence of EDS and of, at least, two direct onsets on REM sleep from
wakefulness (DREMs) and a mean sleep latency of less than 8 min during the multiple sleep

9
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 10

latency tests (MSLT) in accordance with the ICSD-2 criteria (The International Classification
of Sleep Disorders, 2005). At the time of study, all patients had persistent EDS (recurrent
sleep attacks almost daily for at least 3 months), in some cases despite their treatment with
modafinil or methylphenidate (12 patients, i.e. 54.5%). The remaining 10 patients had no
treatment, although they suffered from moderate to severe somnolence and attacks of
cataplexy. One of them also presented an obstructive sleep apnea syndrome that has been well
controlled by continuous positive air pressure for several years. An ESS – a well-validated
auto-questionnaire – with a score below 10 at baseline was an exclusion criterion. All patients
were recruited from the sleep medicine practices of the 4 participating centers.

Design of the clinical study
Experiments were undertaken with the understanding and written consent of each
patient; the protocol was approved by the Ethics Committee of Lyon (France) and was in
compliance with national legislation and the Code of Ethical Principles for Medical Research
Involving Human Subjects of the World Medical Association (Declaration of Helsinki).
This study was a pilot, prospective, comparative, sequential placebo-controlled, single-
blind, multi-center study of a fixed dose of tiprolisant. All stimulant treatments were stopped
at least three days before inclusion. In contrast, stable dose of anticataplectic medication for at
least 3 months was tolerated (except tricyclic antidepressants, which were stopped before the
study, since they display histamine H1 receptor antagonist activity and entail possible drug
interaction with tiprolisant). Such medication (mainly venlafaxine) was taken by 8 patients,
i.e. 36.3%. Other medications such as central hypertensive drugs, codeine and
dextropropoxyphen were forbidden.

10
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 11

Following the completion of screening procedures, patients received once a day, for one
week, capsules of placebo, followed, on the next week by capsules containing 40 mg of
tiprolisant taken in the morning, approximately 1 hour after awakening.
Study assessments were conducted during visits at baseline and at the end of weeks 1
and 2. Sleepiness assessed using the ESS (Johns, 1991) was the principal endpoint of the
study. A sleep diary was used to record the number and duration of sleep episodes during the
night and day and the global clinical impression of change was also completed. A plasma
dosage of tiprolisant was performed 3 hours after the morning intake at the last visit. Adverse
events were collected throughout the study. Investigators rated the severity and the
relationship of each event to study medication or placebo. Safety measures included clinical
laboratory tests (hematology and blood chemistry), vital signs, 12-lead ECG, and physical
examinations conducted at study visits.

Chemicals
Drugs were expressed as equivalent of base. Their sources were as follows: tiprolisant
[1-{3-[3-(4-chlorophenyl)propoxy]propyl}piperidine, hydrochloride] (Ligneau et al., 2007a
and b) and BF30 [1-[3-(4-chlorophenyl)propyl]-4-phenylpiperazine, hydrochloride] were
provided by Pr Schunack (Free University, Berlin, Germany) and Interquim (Barcelona,
Spain), their synthesis will be described elsewhere. Modafinil [(diphenyl-methyl) sulphinyl-2-
acetamide] was either synthesized in the Bioprojet-Biotech laboratory or obtained from
Cephalon (Modiadal®, Paris, France). Dopamine, DOPAC, noradrenaline, MHPG (4-
hydroxy-3-methoxy-phenylglycol), t-MeHA, were from Sigma (Isle d’Abeau, France). All
other chemicals were obtained from commercial sources and were of the highest purity
available.


11
HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 12

Statistical analysis
In the animal study, statistics were performed using ANOVA followed by the
appropriate post-hoc test as indicated in the legends of Figures 1 and 2. In the patient study,
the principal endpoint was changes in the ESS score at the end of each week and secondary
endpoints were number of diurnal somnolence episodes on the patient's diary, total nocturnal
sleep time and global opinion of the investigators. Each patient acted as his/her own control.
All analyses were performed on the intention-to-treat population, including all the 22 patients
enrolled. One patient had to discontinue tiprolisant treatment after 3 days and was excluded
from the efficacy analysis. The t-tests, which compared the variables measured during the
tiprolisant period versus the placebo period, were performed on the paired data, only when
both values were available.

Results
Tiprolisant enhances histaminergic and noradrenergic neuron activity in orexin-/- mice
In orexin-/- mice, HA neuron activity during the lights-off period (or dark phase during
which rodents are active) was assessed by measuring the cortical level of tele-methyl
histamine (t-MeHA), a major extracellular metabolite of HA. t-MeHA was slightly but not
significantly decreased as compared to wild-type (WT) mice but nearly doubled upon
treatment with tiprolisant at a supramaximal dose, as was the case in WT mice (Figure 1a).
Modafinil, a drug currently used to decrease EDS in narcolepsy (Mignot and Nishino, 2005;
Dauvilliers et al., 2007), enhanced t-MeHA levels to a lower extent (42%) but, when
associated to tiprolisant, the effect of the H3 receptor inverse agonist was strongly enhanced
(216% activation in orexin-/- mice). Noradrenergic neuron activity, assessed by the 4-
hydroxy-3-methoxy-phenylglycol/noradrenaline (MHPG/NA) ratio, was also slightly but not
significantly decreased in orexin-/- mice and activated by tiprolisant in both WT and orexin-/-

12
HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1

Page 13

mice (43% and 22%, respectively). Modafinil alone did not modify noradrenergic activity, but
enhanced the tiprolisant-elicited activation in both WT and orexin-/- mice (86 % and 121%,
respectively; Figure 1b). Tiprolisant did not affect cortical dopaminergic activity, assessed by
the dihydroxyphenyl acetic acid/dopamine (DOPAC/DA) ratio, or its decrease elicited by
modafinil (Figure 1c); neither did it affect cortical serotoninergic activity, assessed by 5-
hydroxyindoleacetate/serotonine ratio (not shown). The apparently synergistic interactions
between modafinil and tiprolisant did not result from changes in their plasma or brain
pharmacokinetics since tiprolisant levels were unaffected and modafinil levels in plasma and
brain were, actually, decreased by 18% and 49%, respectively (Figure 1d).

Tiprolisant enhances wakefulness and cortical arousal, decreases DREM episodes and
synergizes with modafinil in orexin-/- mice.
During the lights-off period, both tiprolisant and modafinil markedly enhanced
wakefulness at the expense of slow wave sleep (SWS) and REM sleep (Figure 2A). However,
unlike that of modafinil, the awakening effect of tiprolisant was characterized by an
enhancement of cortical arousal, as revealed by the spectral analysis of the
electroencephalogram (EEG) during waking (Figure 2B-C). Indeed, cortical fast θ activity (7-
10 Hz) and fast rhythms (β and γ ranges, 20-60 Hz), both known to occur notably during
exploration, attention or other cognitive activities, were enhanced markedly after tiprolisant,
but not modafinil dosing (Figure 2C). In addition, whereas both tiprolisant and modafinil
decreased total REM sleep, only tiprolisant considerably decreased both the number and
duration of DREMs episodes (Figure 2D, E), mostly during the early hours after dosing.
Associating tiprolisant to modafinil resulted in a markedly enhanced and qualitatively
modified action of the former on several aspects (Figure 2A-E). Firstly, there was an
enhanced promotion of wakefulness, with a nearly total suppression of SWS and REM sleep

13
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 14

during 3-6 h (Figure 2A, D). Moreover, there was not only an amplification of the
enhancement of fast θ activity and fast rhythms observed with tiprolisant alone, but also a
qualitative change manifested by a decrease in the slow component of the EEG (in the fast δ
and slow θ ranges, namely 2-7 Hz, see Figure 2B-C) during waking. Finally, the peak
frequency of EEG power in θ activity was moved from 6.5 Hz, seen with the vehicle or either
drug administered alone, to 7.0 Hz seen with tiprolisant and modafinil association (Figure
2B). These effects, which did not occur with either drug administered alone, indicates a potent
and enhanced cortical activation with suppression of cortical EEG signs of somnolence and
drowsiness.

Tiprolisant improves EDS in narcoleptic patients
Demographic, clinical characteristics and current symptomatology are shown in Table 1.
All patients presented persistent sleepiness at baseline (in some cases despite treatments), with
an ESS above or equal to 10 (max 24). One patient complained of moderate headaches and
rebound of cataplectic attacks after stopping clomipramine and methylphenidate treatments;
this patient was under tiprolisant for 3 days when she discontinued the trial. Therefore, 21
patients completed the study.
We observed significant differences regarding the EDS with the medication as
compared to placebo. Whereas the mean ESS score (± S.D.) during the placebo period (16.55
± 4.86) did not significantly differ from the ESS score at inclusion (17.55 ± 3.89), the score
under tiprolisant treatment (11.81 ± 6.11) showed a 4.86 ± 5.12 point reduction [95% CI:
2.22, 7.56] when compared to placebo (p=0.0006) and a 5.86 ± 5.51 point reduction [95% CI:
3.42, 8.34] when compared to baseline (p<0.0001) (Figure 3a). Besides, 9 patients were
normalized (ESS < 11). The mean of total numbers of diurnal sleep episodes was significantly
reduced between placebo (14.32 ± 9.54) and tiprolisant period (9.99 ± 9.45), a difference of

14
HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1

Page 15

4.36 [95% CI: 3.35, 5.37] episodes per week (p<0.001, Figure 3c). This effect became larger
along with time of tiprolisant treatment (2.0 ± 2.1 episodes recorded on day 1 vs. 0.3 ± 1.0 on
day 7, p=0.0046), whereas corresponding values did not change under placebo (1.9 ± 2.1 and
1.7 ± 2.2 on days 1 and 7, respectively), suggesting a delay in reaching the maximum effect of
tiprolisant on this parameter (Figure 3b). The total nocturnal sleep duration was slightly
reduced, although not significantly, between placebo and tiprolisant periods (8.0 ± 1.7 h/night
vs. 7.5 ± 2.0). The number and duration of wake-up episodes after sleep onset (WASO) did
not significantly differ between the two periods, in spite of a tendency to increase (Figure 3d-
f). The global opinion of the investigators on efficacy was significantly better after the
tiprolisant period (moderate or good efficacy at 68.2%) than after placebo (moderate or good
efficacy at 9.1% only) (p=0.0002).
Tiprolisant dosages were performed at the end of the treatment period with a median
sampling time at 3.75 h after the last drug intake. The plasma level average was 100.6 ± 78.1
ng/ml (n=17). Elevated plasma levels (> 150 ng/ml) were observed in 5 patients, in some
cases related to the experience of adverse events occurring a few hours after drug intake.
No serious adverse event was noted during the study; 11 patients experienced 23
adverse events during tiprolisant treatment as compared to 7 patients experiencing 13 adverse
events during placebo treatment. Among the 22 patients, the most frequent adverse events
during the tiprolisant period were headache (n=5), nausea (n=4), insomnia (n=2), malaise
(n=2) and sweating (n=2). The majority (95%) of adverse events occurred during the first 3
days of treatment. Seven adverse events rated severe occurred in 6 patients during tiprolisant
period (and two under the placebo period), six of them likely or very likely related to the
tiprolisant treatment, i.e. insomnia (n=2), malaise sensation (n=2), nausea (n=1) and
hallucination (n=1). None of these adverse events led to treatment cessation and 21/22
patients fully complied with the prescribed treatments. However, one patient reduced the

15
HAL author manuscript inserm-00215993, version 1HAL author manuscript inserm-00215993, version 1 HAL author manuscript inserm-00215993, version 1