Article

A mechanism for Ikaros regulation of human globin gene switching

Institute for Molecular Bioscience, Queensland Bioscience Precinct, University of Queensland, Queensland, Australia.
British Journal of Haematology (Impact Factor: 4.96). 06/2008; 141(3):398-406. DOI: 10.1111/j.1365-2141.2008.07065.x
Source: PubMed

ABSTRACT The human beta globin locus consists of an upstream LCR and functional genes arranged sequentially in the order of their expression during development: 5'-HBE1, HBG2, HBG1, HBD, HBB-3'. Haemoglobin switching entails the successive recruitment of these genes into an active chromatin hub (ACH). Here we show that the transcription factor Ikaros plays a major role in the formation of the beta-globin ACH, and in haemoglobin switching. In Plastic mice, where the DNA-binding region of Ikaros is disrupted by a point mutation, there is concomitant marked down-regulation of HBB, and up-regulation of HBG expression. We show for the first time Ikaros and its family member Eos, bind to critical cis elements implicated in haemoglobin switching and deletional hereditary persistence of fetal haemoglobin (HPFH). Chromatin conformation capture (3C) data demonstrated that Ikaros facilitates long-distance DNA looping between the LCR and a region upstream of HBD. This study provides new insights into the mechanism of stage-specific assembly of the beta-globin ACH, and HPFH.

Download full-text

Full-text

Available from: Michael Robert Tallack, Nov 21, 2014
0 Followers
 · 
127 Views
  • Source
    • "The forward and reverse RT-PCR primers used for Klf1 were 5′ ATGAGGCAGAAGAGAG AGAGGA 3′ and 5′ AAATCCTGCGTCTCCTCAGA 3′ respectively and for Hpr were 5′ GGCCAGACTTTGTTGGATTT 3′ and 5′ ACTGGCAACATCAA CAGGACT 3′. RT-PCR primers for Hba-a1 and Hbb-b1 have previously been reported [40] "
    [Show abstract] [Hide abstract]
    ABSTRACT: Position-effect variegation of transgene expression is sensitive to the chromatin state. We previously reported a forward genetic screen in mice carrying a variegated α-globin GFP transgene to find novel genes encoding epigenetic regulators. We named the phenovariant strains “Mommes” for modifiers of murine metastable epialleles. Here we report positional cloning of mutations in two Momme strains which result in suppression of variegation. Both strains harbour point mutations in the erythroid transcription factor, Klf1. One (D11) generates a stop codon in the zinc finger domain and a homozygous null phenotype. The other (D45) generates an amino acid transversion (H350R) within a conserved linker between zinc fingers two and three. Homozygous MommeD45 mice have chronic microcytic anaemia which models the phenotype in a recently described family. This is the first genetic evidence that the linkers between the zinc fingers of transcription factors have a function beyond that of a simple spacer.
    Genomics 10/2014; 105(2). DOI:10.1016/j.ygeno.2014.09.013 · 2.79 Impact Factor
  • Source
    • "Ikaros is required for the formation and DNA binding of developmental-stage specific complexes such as chromatin remodeling complexes and the polypyrimidine (PYR) complex, which occur only in adult hematopoietic cells [2, 57–59]. Lack of Ikaros in mice results in no PYR complex formation and delayed globin switching [57] [58] [60]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Discovered in the early 1990s, highly conserved DNA- and protein-binding transcription factor, Ikaros, is now considered as one of the most important players in hematopoiesis and the development of certain forms of human malignancies. The Ikaros transcription factor is a multifunctional protein regulating hematopoietic stem cells (HSCs) function, coordinating self-renewal, cell survival processes, cell cycle progression and lymphopoiesis. Ikaros is also considered as one of the most important antileukemic transcription factors. The Ikaros gene (IKZF1) alterations characterize a subset of acute lymphoblastic leukemia with significant resistance to treatment and increased risk of relapse. Hematological studies highlight shortened and modified dominant negative (DN) Ik-forms, that play an important role in the development and prognosis of hematological malignances. Currently, the extensive research in this field is on the top of interest in a battle against leukemia. Here, we describe structural and functional properties of Ikaros protein and its family members, important interactions with the nuclear proteins, its influence on gene transcriptional profiles, as well as its considerable involvement in the key hematopoietic processes.
    Acta haematologica Polonica 10/2014; 46(1). DOI:10.1016/j.achaem.2014.10.001
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Over the last few years important new insights into the process of long-range gene regulation have been obtained. Gene regulatory elements are found to engage in direct physical interactions with distant target genes and with loci on other chromosomes to modulate transcription. An overview of recently discovered long-range chromosomal interactions is presented, and a network approach is proposed to unravel gene-element relationships. Gene expression is controlled by regulatory elements that can be located far away along the chromosome or in some cases even on other chromosomes. Genes and regulatory elements physically associate with each other resulting in complex genome-wide networks of chromosomal interactions. Here we describe several well-characterized cases of long-range interactions involved in the activation and repression of transcription. We speculate on how these interactions may affect gene expression and outline possible mechanisms that may facilitate encounters between distant elements. Finally, we propose that a genome-wide network analysis may provide new insights into the logic of long-range gene regulation.
    Molecular BioSystems 12/2008; 4(11):1046-57. DOI:10.1039/b803580f · 3.18 Impact Factor
Show more