A mechanism for Ikaros regulation of human globin gene switching

Institute for Molecular Bioscience, Queensland Bioscience Precinct, University of Queensland, Queensland, Australia.
British Journal of Haematology (Impact Factor: 4.71). 06/2008; 141(3):398-406. DOI: 10.1111/j.1365-2141.2008.07065.x
Source: PubMed

ABSTRACT The human beta globin locus consists of an upstream LCR and functional genes arranged sequentially in the order of their expression during development: 5'-HBE1, HBG2, HBG1, HBD, HBB-3'. Haemoglobin switching entails the successive recruitment of these genes into an active chromatin hub (ACH). Here we show that the transcription factor Ikaros plays a major role in the formation of the beta-globin ACH, and in haemoglobin switching. In Plastic mice, where the DNA-binding region of Ikaros is disrupted by a point mutation, there is concomitant marked down-regulation of HBB, and up-regulation of HBG expression. We show for the first time Ikaros and its family member Eos, bind to critical cis elements implicated in haemoglobin switching and deletional hereditary persistence of fetal haemoglobin (HPFH). Chromatin conformation capture (3C) data demonstrated that Ikaros facilitates long-distance DNA looping between the LCR and a region upstream of HBD. This study provides new insights into the mechanism of stage-specific assembly of the beta-globin ACH, and HPFH.

Download full-text


Available from: Michael Robert Tallack, Nov 21, 2014
7 Reads
  • Source
    • "The forward and reverse RT-PCR primers used for Klf1 were 5′ ATGAGGCAGAAGAGAG AGAGGA 3′ and 5′ AAATCCTGCGTCTCCTCAGA 3′ respectively and for Hpr were 5′ GGCCAGACTTTGTTGGATTT 3′ and 5′ ACTGGCAACATCAA CAGGACT 3′. RT-PCR primers for Hba-a1 and Hbb-b1 have previously been reported [40] "
    [Show abstract] [Hide abstract]
    ABSTRACT: Position-effect variegation of transgene expression is sensitive to the chromatin state. We previously reported a forward genetic screen in mice carrying a variegated α-globin GFP transgene to find novel genes encoding epigenetic regulators. We named the phenovariant strains “Mommes” for modifiers of murine metastable epialleles. Here we report positional cloning of mutations in two Momme strains which result in suppression of variegation. Both strains harbour point mutations in the erythroid transcription factor, Klf1. One (D11) generates a stop codon in the zinc finger domain and a homozygous null phenotype. The other (D45) generates an amino acid transversion (H350R) within a conserved linker between zinc fingers two and three. Homozygous MommeD45 mice have chronic microcytic anaemia which models the phenotype in a recently described family. This is the first genetic evidence that the linkers between the zinc fingers of transcription factors have a function beyond that of a simple spacer.
    Genomics 10/2014; 105(2). DOI:10.1016/j.ygeno.2014.09.013 · 2.28 Impact Factor
  • Source
    • "Ikaros is required for the formation and DNA binding of developmental-stage specific complexes such as chromatin remodeling complexes and the polypyrimidine (PYR) complex, which occur only in adult hematopoietic cells [2, 57–59]. Lack of Ikaros in mice results in no PYR complex formation and delayed globin switching [57] [58] [60]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Discovered in the early 1990s, highly conserved DNA- and protein-binding transcription factor, Ikaros, is now considered as one of the most important players in hematopoiesis and the development of certain forms of human malignancies. The Ikaros transcription factor is a multifunctional protein regulating hematopoietic stem cells (HSCs) function, coordinating self-renewal, cell survival processes, cell cycle progression and lymphopoiesis. Ikaros is also considered as one of the most important antileukemic transcription factors. The Ikaros gene (IKZF1) alterations characterize a subset of acute lymphoblastic leukemia with significant resistance to treatment and increased risk of relapse. Hematological studies highlight shortened and modified dominant negative (DN) Ik-forms, that play an important role in the development and prognosis of hematological malignances. Currently, the extensive research in this field is on the top of interest in a battle against leukemia. Here, we describe structural and functional properties of Ikaros protein and its family members, important interactions with the nuclear proteins, its influence on gene transcriptional profiles, as well as its considerable involvement in the key hematopoietic processes.
    Acta haematologica Polonica 10/2014; 46(1). DOI:10.1016/j.achaem.2014.10.001
  • Source
    • "Keys and colleagues examined the role of Ikaros in the assembly of the human β-globin active chromatin hub and subsequent globin gene transcription [20]. Ikaros was involved in human globin gene switching through Ikaros-Eos heterodimers or homodimers [20]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation.
    PLoS ONE 07/2011; 6(7):e22907. DOI:10.1371/journal.pone.0022907 · 3.23 Impact Factor
Show more