FGF2 Signaling in Mouse Embryonic Fibroblasts Is Crucial for Self-Renewal of Embryonic Stem Cells

Max Delbrück Center, Berlin, Germany.
Cells Tissues Organs (Impact Factor: 2.14). 02/2008; 188(1-2):52-61. DOI: 10.1159/000121282
Source: PubMed


Human embryonic stem cells (hESCs) can be maintained undifferentiated (pluripotent) or differentiated to basically all functional cell types, depending on the culture conditions used. Culture of hESCs in the presence of medium conditioned by mouse embryonic fibroblasts (MEFs) can be used to keep hESCs undifferentiated. This observation suggests that MEFs produce factors required for the pluripotency of hESCs. The data presented here show that fibroblast growth factor 2 (FGF2) treatment of MEFs is crucial for the production of these factors. To identify the potential factors that are expressed in the presence of FGF2 in MEFs, a global expression profile analysis using microarrays was performed. This analysis indicated that 17 secreted factors are downregulated in the absence of FGF2. These factors include several ligands for known signaling receptors, extracellular proteases and components of the extracellular matrix, that may all be involved in signaling events. Surprisingly, we found that selective blocking of extracellular signal-regulated kinase (ERK) signaling by the MAPK/ERK kinase (MEK) inhibitor U0126 affected the expression of only some of the FGF2-regulated genes, suggesting FGF2-induced pathways that are independent of ERK signaling. It has been shown recently that activation of Activin/Nodal signaling and inhibition of bone morphogenetic protein signaling are required for the maintenance of pluripotency. Accordingly, among the 17 FGF2-regulated genes we found inhibin beta B that can lead to the assembly of Activin B and gremlin 1 that codes for an antagonist of bone morphogenetic proteins. This study identifies potentially important factors involved in the maintenance of pluripotency in hESCs and may allow the development of defined culture conditions without contaminating material from animal cells.

Download full-text


Available from: Daniel Besser, Oct 04, 2015
1 Follower
41 Reads
  • Source
    • "Many growth factors have been found to play a role in hESCs, in particular FGF2, IGF1, and EGF. FGF2 signaling is crucial for maintaining hESCs in an undifferentiated state and enabling self-renewal4567. EGF plays a role in proliferation and survival8, and IGF contributes to self-renewal and pluripotency79. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Sprouty (Spry) genes encode negative regulators of receptor tyrosine kinase (RTK) signaling, which plays important roles in human embryonic stem cells (hESCs). SPRY2 and SPRY4 are the two most highly expressed Sprouty family members in hESCs, suggesting that they may influence self-renewal. To test this hypothesis, we performed siRNA-mediated knock down (KD) studies. SPRY2 KD resulted in increased cell death and decreased proliferation, whereas SPRY4 KD enhanced survival. In both cases, after KD the cells were able to differentiate into cells of the three germ layers, although after SPRY2 KD there was a tendency toward increased ectodermal differentiation. SPRY2 KD cells displayed impaired mitochondrial fusion and cell membrane damage, explaining in part the increased cell death. These data indicate that Sprouty genes regulate pathways involved in proliferation and cell death in hESCs.
    Scientific Reports 07/2013; 3:2277. DOI:10.1038/srep02277 · 5.58 Impact Factor
  • Source
    • "The house-keeping genes GAPDH (homo sapiens) and Gus (mus musculus) were used as endogenous references. The sequences of the primers used are reported (hs: homo sapiens, mm: mus musculus): GAPDHFw(hs) 5′tgcaccaccaactgcttagc3′ and GAPDHRw(hs) 5′ggcatggactgtggtcatgag3′ [46]; ERGFw(hs) 5′cgcagagttatcgtgccagcagat3′ and ERGRw(hs) 5′ccatattctttcaccgcccactcc3′ [11]; PIM1Fw(hs) 5′cgagcatgacgaagagatcat 3′ and PIM1Rw(hs) 5′tcgaaggttggcctatctga3′ [47]; Hprt1Fw(mm) 5′tcagtcaacgggggacataaa3′ and Hprt1Rw(mm) 5′ggggctgtactgcttaaccag3′ [48]; Cdh5Fw(mm) 5′agacacccccaacatgctac3′ and Cdh5Rw(mm) 5′gcaaactctccttggagcac3′ [49]; Mmp3Fw(mm) 5′aagggtggatgctgtctttgaagc3′ and Mmp3Rw(mm) 5′gccatagcacatgctgaacaaagc3′ [50]; Edn1Fw(mm) 5′gcgtcgtaccgtatggactgg3′ and Edn1Rw(mm) 5′atgccttgatgctattgctgatg3′; Irs1Fw(mm) 5′taggcagcaatgagggcaactc3′ and Irs1Rw(mm) 5′tgaggtcctggttgtgaattg3′; Egln3Fw(mm) 5′ggcacctgcgaggcgaccagat3′ and Egln3Rw(mm) 5′tggcgaacataacctgtcccattt3′; Dpysl3Fw(mm) 5′cgagcagcagcagtagcagcga3′ and Dpysl3Rw(mm) 5′atgcctccagggatcaccatcttc3′; Cyp1bFw(mm) 5′gcctgccactattacggaca3′ and Cyp1b1Rw(mm) 5′acaacctggtccaactcagc3′ [51]; Has2Fw(mm) 5′cgagtctatgagcaggagctg3′ and Has2Rw(mm) 5′gtgattccgaggaggagagaca3′ [52]; EdnraFw(mm) 5′tacaagggcgagctgcatag3′ and EdnraRw(mm) 5′catgagggtgtagaagattgctg3′; Ccl9Fw(mm) 5′ggccagctgggtctgcccac3′ and Ccl9Rw(mm) 5′tgcccggcctggtacacccac3′; Gpr149Fw(mm) 5′cgttgccttcgatgggaaaaa3′ and Gpr149Rw(mm) 5′gctcctttgtagcttcacactca3′; Id1Fw(mm) 5′ttggtctgtcggagcaaagcgt3′ and Id1Rw(mm) 5′cgtgagtagcagccgttcatgt3′; PIM1Fw(mm) 5′gatcatcaagggccaagtgt3′ and PIM1Rw(mm) 5′gatggttccggatttcttca3′ [53]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The ERG gene belongs to the ETS family of transcription factors and has been found to be involved in atypical chromosomal rearrangements in several cancers. To gain insight into the oncogenic activity of ERG, we compared the gene expression profile of NIH-3T3 cells stably expressing the coding regions of the three main ERG oncogenic fusions: TMPRSS2/ERG (tERG), EWS/ERG and FUS/ERG. We found that all three ERG fusions significantly up-regulate PIM1 expression in the NIH-3T3 cell line. PIM1 is a serine/threonine kinase frequently over-expressed in cancers of haematological and epithelial origin. We show here that tERG expression induces PIM1 in the non-malignant prostate cell line RWPE-1, strengthening the relation between tERG and PIM1 up-regulation in the initial stages of prostate carcinogenesis. Silencing of tERG reversed PIM1 induction. A significant association between ERG and PIM1 expression in clinical prostate carcinoma specimens was found, suggesting that such a mechanism may be relevant in vivo. Chromatin Immunoprecipitation experiments showed that tERG directly binds to PIM1 promoter in the RWPE-1 prostate cell line, suggesting that tERG could be a direct regulator of PIM1 expression. The up-regulation of PIM1 induced by tERG over-expression significantly modified Cyclin B1 levels and increased the percentage of aneuploid cells in the RWPE-1 cell line after taxane-based treatment. Here we provide the first evidence for an ERG-mediated PIM1 up-regulation in prostate cells in vitro and in vivo, suggesting a direct effect of ERG transcriptional activity in the alteration of genetic stability.
    PLoS ONE 11/2011; 6(11):e28162. DOI:10.1371/journal.pone.0028162 · 3.23 Impact Factor
  • Source
    • "Depriving hESC of MEF secreted factors is known to lead to differentiation [12], [13]. HES3-GFP-LC3 cells cultured for 3 days under feeder-free conditions in unconditioned medium display an increase in both the number of fluorescent puncta (Fig. 4 D) as compared to HES3-GFP-LC3 cells in conditioned medium (Fig. 3C), and LC3-II processing (Fig. 3E, lane 2 and Fig. 4G). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Autophagy (macroautophagy) is a degradative process that involves the sequestration of cytosolic material including organelles into double membrane vesicles termed autophagosomes for delivery to the lysosome. Autophagy is essential for preimplantation development of mouse embryos and cavitation of embryoid bodies. The precise roles of autophagy during early human embryonic development, remain however largely uncharacterized. Since human embryonic stem cells constitute a unique model system to study early human embryogenesis we investigated the occurrence of autophagy in human embryonic stem cells. We have, using lentiviral transduction, established multiple human embryonic stem cell lines that stably express GFP-LC3, a fluorescent marker for the autophagosome. Each cell line displays both a normal karyotype and pluripotency as indicated by the presence of cell types representative of the three germlayers in derived teratomas. GFP expression and labelling of autophagosomes is retained after differentiation. Baseline levels of autophagy detected in cultured undifferentiated hESC were increased or decreased in the presence of rapamycin and wortmannin, respectively. Interestingly, autophagy was upregulated in hESCs induced to undergo differentiation by treatment with type I TGF-beta receptor inhibitor SB431542 or removal of MEF secreted maintenance factors. In conclusion we have established hESCs capable of reporting macroautophagy and identify a novel link between autophagy and early differentiation events in hESC.
    PLoS ONE 11/2011; 6(11):e27485. DOI:10.1371/journal.pone.0027485 · 3.23 Impact Factor
Show more