Transcript profiling indicates that the absence of PsbO affects the coordination of C and N metabolism in Synechocystis sp. PCC 6803.

Abstract

Transcript profiling of nitrate-grown Synechocystis sp. PCC 6803 PsbO-free mutant cells in comparison to wild-type (WT) detected substantial deviations. Because we had previously observed phenotypical differences between Synechocystis sp. PCC 6803 WT and its corresponding PsbO-free mutant when cultivated with l-arginine as sole N source and a light intensity of 200 mumol photons m(-2) s(-1), we also performed transcript profiling for both strains grown either with nitrate or with l-arginine as sole N source. We observed a total number of 520 differentially regulated transcripts in Synechocystis WT because of a shift from nitrate- to l-arginine-containing BG11 medium, while we detected only 13 differentially regulated transcripts for the PsbO-free mutant. Thus, the PsbO-free Synechocystis mutant had already undergone a preconditioning process for growth with l-arginine in comparison to WT. While Synechocystis WT suffered from growth with l-arginine at a light intensity of 200 mumol photons m(-2) s(-1), the PsbO-free mutant developed only a minor stress phenotype. In summary, our results suggest that the absence of PsbO in Synechocystis affects the coordination of photosynthesis/respiration and l-arginine metabolism through complex probably redox-mediated regulatory pathways. In addition, we show that a comparison of the transcriptomes of nitrate-grown Synechococcus elongatus PCC 7942 WT cells and its corresponding PsbO-free mutant cells resulted in only a few differentially regulated transcripts between both strains. The absence of the manganese/calcium-stabilizing PsbO protein of PSII with an assigned regulatory function for photosynthetic water oxidation causes bigger changes in the transcriptome of the permissive photoheterotrophically growing Synechocystis sp. PCC 6803 than in the transcriptome of the obligate photoautotrophically growing S. elongatus PCC 7942.

Full text

Page 1

Physiologia Plantarum 2008
Copyright ª Physiologia Plantarum 2008, ISSN 0031-9317
Transcript profiling indicates that the absence of PsbO
affects the coordination of C and N metabolism in
Synechocystis sp. PCC 6803
Sarah Schrieka, Eneas Aguirre-von-Wobeserb, Anke Nodopa, Anke Beckerc, Bas W. Ibelingsd,
Jasper Bokd, Dorothee Staigera, Hans C. P. Matthijsb, Elfriede K. Pistoriusaand Klaus-Peter Michela,*
aLehrstuhl fu ¨r Molekulare Zellphysiologie, Universita ¨t Bielefeld, Universita ¨tsstr. 25, D-33615 Bielefeld, Germany
bInstitute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, NL-1018WS Amsterdam, The Netherlands
cLehrstuhl fu ¨r Genetik, Universita ¨t Bielefeld, Universita ¨tsstr. 25, D-33615 Bielefeld, Germany
dDepartment of Foodweb Studies, Centre for Limnology, Netherlands Institute of Ecology, NL-3631AC Nieuwersluis, The Netherlands
Correspondence
*Corresponding author,
e-mail: klauspeter.michel@
uni-bielefeld.de
Received3December2007;revised7April
2008
doi: 10.1111/j.1399-3054.2008.01119.x
Transcript profiling of nitrate-grown Synechocystis sp. PCC 6803 PsbO-free
mutant cells in comparison to wild-type (WT) detected substantial deviations.
Because we had previously observed phenotypical differences between
Synechocystis sp. PCC 6803 WT and its corresponding PsbO-free mutant
when cultivated with L-arginine as sole N source and a light intensity of
200 mmol photons m22s21, we also performed transcript profiling for both
strains grown either with nitrate or with L-arginine as sole N source. We
observed a total number of 520 differentially regulated transcripts in
Synechocystis WT because of a shift from nitrate- to L-arginine-containing
BG11 medium, while we detected only 13 differentially regulated transcripts
for the PsbO-free mutant. Thus, the PsbO-free Synechocystis mutant had
already undergone a preconditioning process for growth with L-arginine in
comparison to WT. While Synechocystis WT suffered from growth with L-
arginine at a light intensity of 200 mmol photons m22s21, the PsbO-free
mutant developed only a minor stress phenotype. In summary, our results
suggest that the absence of PsbO in Synechocystis affects the coordination of
photosynthesis/respiration and
L-arginine metabolism through complex
probably redox-mediated regulatory pathways. In addition, we show that
acomparisonofthetranscriptomesofnitrate-grownSynechococcuselongatus
PCC 7942 WT cells and its corresponding PsbO-free mutant cells resulted in
only a few differentially regulated transcripts between both strains. The
absence of the manganese/calcium-stabilizing PsbO protein of PSII with an
assigned regulatory function for photosynthetic water oxidation causes bigger
changesinthetranscriptomeofthepermissivephotoheterotrophicallygrowing
Synechocystis sp. PCC 6803 than in the transcriptome of the obligate
photoautotrophically growing S. elongatus PCC 7942.
Introduction
PSII is a multisubunit complex with more than 20
polypeptides and represents a water:plastoquinone oxi-
doreductase. PSII contains several associated cofactors
and is embedded in the thylakoid membrane of higher
plants, eukaryotic algae and cyanobacteria (Barber and
Abbreviations – Hik,histidinekinase;OEC,oxygen-evolvingcomplex;PsbO,manganese/calcium-stabilizingprotein;Rre,response
regulator; WT, wild-type.
Physiol. Plant. 2008
1

Page 2

Kuhlbrandt1999,Ke2001).Itsoxygen-evolvingcomplex
(OEC) contains a cluster of four manganese (Mn) atoms,
several calcium ions (Ca21) and several chloride ions
(Cl2).ThestructureofPSIIhasbeeninvestigatedwithhigh
resolution EM and X-ray crystallography for cyanobac-
teria (Ferreira et al. 2004, Kamiya and Shen 2003, Loll
et al. 2005, Zouni et al. 2001) as well as for higher plants
(Hankamer et al. 1997, 1999, Rhee et al. 1998). The
process of charge separation is catalyzed by the D1/D2
reaction center complex. This heterodimeric protein
complex is highly conserved among the different oxy-
genic photosynthetic organisms, while in contrast, the
extrinsic proteins of the OEC differ substantially between
species. Only PsbO (manganase-stabilizing protein
[MSP]) is ubiquitously found in all oxyphototrophs. PsbP
and PsbQ are present in green algae and higher plants,
whilePsbUandPsbVareonlyfoundincyanobacteriaand
red algae. However, genes encoding proteins with
similarity to PsbP and PsbQ have recently also been
detected in cyanobacteria and red algae (Kashino et al.
2002, Thornton et al. 2004). A list of extrinsic polypep-
tides in different types of oxyphototrophs has been
published (De Las Rivas et al. 2004). In contrast to their
initially assigned role as ligands for the Mn cluster, latest
results suggest that the extrinsic peptides provide the
proteinaceous environment to stabilize the Mn cluster
and maintain optimal levels of calcium and chloride for
photosynthetic water oxidation (Debus 1992). Isolated
Synechocystis sp. PCC 6803 PSII particles contain all five
extrinsic proteins, PsbO, PsbU, PsbV, PsbP and PsbQ.
ThosePSII complexes, which contain PsbQinadditionto
PsbU and PsbV, had the highest oxygen-evolving activity
(Roose et al. 2007).
PSII continuously undergoes assembly and disassem-
bly processes because of light-mediated damage causing
a temporal heterogeneity of PSII (Anderson et al. 1995,
Aro et al. 1993). In addition to the five extrinsic poly-
peptides, a peptide named Psb27 transiently associates
with premature cyanobacterial PSII complexes. Psb27 is
assigned a role in the assembly of the OEC and in the
turnover process of the PSII complex (Nowaczyk et al.
2006). Because PsbO is present in all oxyphototrophs, an
ancestral OEC might have only had a PsbO protein
associated with the intrinsic proteins of the PSII core.
Thus,theotherextrinsicproteinsmighthaveevolvedlater
during evolution as part of a strategy to optimize the OEC
and its acclimation to different environmental conditions
(Blankenship and Hartman 1998, Olson 2001).
PsbO is a protein of 25–33 kDa in size and has
acalculatedpIof4.5–5.7indifferentoxyphototrophs(De
Las Rivas and Barber 2004, De Las Rivas et al. 2007).
Biochemically purified PsbO has a low Ca21-binding
activity(HerediaandDeLasRivas2003,Kruketal.2003,
Murray and Barber 2006). Investigation of crystallized
PSIIcomplexesofThermosynechococcuselongatusBP-1
indicatedthatatleastoneCa21isboundtoPsbO(Ferreira
et al. 2004). PsbO contains two conserved cysteine
residues,whichmayformadisulfidebridgeandmayhave
a function in the regulation of the oxygen-evolving
activity in cyanobacteria. Moreover, PsbO turned out to
be a highly flexible molecule that undergoes substantial
conformational changes. As a consequence, bound–
unbound transitions of PsbO to PSII have been suggested
(De Las Rivas and Barber 2004). Because PsbO-free
mutants of Synechocystis sp. PCC 6803 (Burnap and
Sherman1991,Mayesetal.1991,Philbricketal.1991)as
well as of Synechococcus elongatus PCC 7942 (Bockholt
et al. 1991, Engels et al. 1994) still grow photoautotro-
phically, PsbO is not directly involved in the water-
oxidizing reaction. The function of the absent PsbO is
probably carried out in part by the PsbV protein (Shen
et al. 1995). However, the PsbO-free mutants were more
prone to light-induced damage than wild-type (WT) and
were not able to grow in media with low Ca21and Cl2
concentrations. The latter finding is in line with the
assigned function of PsbO to maintain optimal concen-
trations ofCa21andCl2forthe OEC.Besides, substantial
evidence assigns additional functions to PsbO. (1) The
unicellular, aerobic and diazotrophic strain Cyanothece
sp. ATCC 51142 performs a temporal separation of N2
fixationandphotosyntheticO2evolutionduringadiurnal
cycle to protect the O2-labile nitrogenase complex
(Meunier et al. 1998, Sherman et al. 1998, Tucker et al.
2001). Extended studies of photosynthetic parameters of
Cyanothece revealed that the O2evolution character-
istics at specific time-points of the diurnal cycle resem-
bled those of a PsbO-free Synechocystis sp. PCC 6803
mutant. The changes in PSII activity may, thus, in part be
because of conformational changes of the highly flexible
PsbO, which probably facilitates bound-to-unbound
transitions in PSII. (2) PsbO may also play a role in the
stabilization of PSII dimers by increasing the size of
interconnecting areas of the luminal surfaces of PSII
dimers. This bridging may play an important role in the
regulation of the dimer–monomer interconversions that
are associated with the rapid turnover of the D1 protein
(De Las Rivas and Barber 2004). The dimer–monomer
interconversions may also be related to a switch from
apredominantlylineartoapredominantlycyclicelectron
flow activity in cyanobacteria (Sherman et al. 1998). (3)
Recently, a GTP-binding enzymatic activity upon illumi-
nation has been described for PsbO of higher plants. This
activity may represent some kind of a light-mediated
signal, which affects the regulation of D1 protein
degradation (Lundin et al. 2007, Spetea et al. 1994). (4)
A possible dual functionof PsbO has also been described
2
Physiol. Plant. 2008

Page 3

for green algal photosynthesis. Besides its regular
function, PsbO has a function similar to thioredoxin in
Scenedesmus obliquus (Heide et al. 2004). (5) Compar-
ative growth analyses of Synechocystis sp. PCC 6803 WT
grown with L-arginine and 200 mmol photons m22s21
andaPsbO-freemutantshowedaseverestressphenotype
in WT, whereas the mutant developed no comparable
stressphenotype(Stephanetal.2000).Indetail,growthof
WT with L-arginine and 200 mmol photons m22s21led
to accumulation of large amounts of cyanophycin
granules, a severely reduced content of thylakoid mem-
branes, a strongly reduced pigmentation and a decreased
photosynthetic activity compared with nitrate-grown WT
cells. As a consequence, WT cannot be cultivated for
several growth cycles with L-arginine and 200 mmol
photons m22s21(Stephan et al. 2000). Obviously, the
presence or absence of PsbO determines whether
Synechocystissp.PCC6803underthechosenconditions
could efficiently use L-arginine as N source for growth or
whether the cells predominantly store
cyanophycin granules and develop a stress phenotype.
Thus, a complex interrelationship between photosyn-
thetic water oxidation and L-arginine catabolism (Quin-
teroetal.2000,Stephanetal.2000)and/ortheenigmatic
metabolism of cyanophycin may exist (Allen 1984,
Kolodny et al. 2006, Mackerras et al. 1990a, 1990b,
Maheswaran et al. 2006, Simon 1987).
Ingeneral,efficient photosynthesisrequiresanoptimal
organization of the participating thylakoid membrane–
protein complexes and efficient mechanisms to adjust
metabolic pathways, especially those of C and N
metabolism, in response to the photosynthetic capacity
and environmental cues.
To improve the knowledge on a suggested regulatory
role of PsbO, the transcriptomes of nitrate-grown PsbO-
free Synechocystis sp. PCC 6803 mutant and Synecho-
cystis sp. PCC 6803 WT were compared when the
illumination was set at 200 mmol photons m22s21. In
addition, the transcriptomes of Synechocystis sp. PCC
6803 WT and the PsbO-free mutant grown with L-
arginine as sole N source were compared with those of
Synechocystis sp. PCC 6803 WT and the PsbO-free
mutant grown with nitrate, respectively. We wanted to
answer the question whether changes in the tran-
scriptomes between PsbO-free mutant and WT occur,
which may help to answer the question why the PsbO-
free mutant seemed to be by far better preconditioned
than WT to efficiently grow with L-arginine as sole N
source when the illumination corresponds to 200 mmol
photons m22s21.
To investigate whether the absence of PsbO has
identical or different consequences on the transcriptome
of an obligate photoautotrophic strain, we further
L-arginine in
compared a PsbO-free S. elongatus PCC 7942 mutant
with its corresponding WT strain grown with nitrate and
200 mmol photons m22s21.
Materials and methods
Cyanobacterial strains, growth conditions, cell
harvest and isolation of RNA
The cyanobacterial strains Synechocystis sp. PCC 6803
WTand S. elongatus PCC 7942 WT were obtained from
the Pasteur Culture Collection of Cyanobacterial Strains,
Paris, France. The PsbO-free mutants were the same as
described earlier (Bockholt et al. 1991, Engels et al.
1994).Cyanobacteriawerecultivatedin250 mlgaswash
bottles (16 cm in height and 4.5 cm in diameter), which
were placed in a water basin (size 40 ? 70 ? 25 cm) set
at 30?C. Illumination was with six beams (Philips Cool
Spot,Philips,Hamburg,Germany,;12?,150 W)placed
36 cm above the culture bottles. The ambient illumina-
tion at the outside of the culture bottles was 200 mmol
photons m22s21. The light intensity was determined
with a LI-250 Light Meter with a LI-190SZ Quantum
Sensor (LI-COR, Lincoln, NE) measuring photons
between 400 and 700 nm. Because the cultures revealed
a higher growth rate at 200 mmol photons m22s21than
at an illumination of 50 mmol photons m22s21(not
shown), this light regime obviously did not cause
substantial photoinhibitory damage. The BG11 medium
was continuously bubbled through two manometers
(Porter Instruments, Hatfield, PA) with 20 l h212% CO2-
enrichedair.GrowthwasperformedwithmodifiedBG11
medium (Stephan et al. 2000) with nitrate as N source
(17.7 mM sodium nitrate) or with nitrate-free BG11
containing 5 mM L-arginine–HCl to which 50 mM 4-(2-
hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS)–
NaOH pH 7.5 was added to prevent acidification. After
48 h of growth with nitrate or L-arginine, the pH of the
CO2-aerated BG11 medium was between 7.0 and 7.5
(Nodop et al. 2006). Growth of the PsbO-free mutants
was performed as described above, except that the
growth medium contained either kanamycin sulfate
(7.5 mg l21for the Synechocystis sp. PCC 6803 PsbO-
free mutant) or chloramphenicol (10 mg l21for the
S. elongatus PCC 7942 PsbO-free mutant). The standard
culture inoculum corresponded to an absorbance of 0.3
at 750 nm (OD750 nm). Growth rates were determined by
measuring the OD750 nmof cell suspensions. The Chl
content was determined according to previously pub-
lished protocols (Grimme and Boardman 1972). After
48 h of growth, cells were harvested and mixed 1:1 with
crushed ice and centrifuged in a table top centrifuge for
5 min at 3000 g. Isolation of total RNAwas performed as
Physiol. Plant. 2008
3

Page 4

described previously (Michel et al. 2003). The isolation
protocol was improved by an on-column DNAse
digestion step with the RNAse-free DNAse set from
Qiagen (Hilden, Germany). RNA quantification waswith
a NanoDrop ND-1000 spectrometer (PeqLab, Erlangen,
Germany), and the integrity and quality of RNA samples
were checked with an Agilent Bioanalyzer chip (Agilent,
Waldbronn, Germany). RNAwas stored at 280?C for use
in transcript profiling and slot hybridization.
DNA microarray experiments with Synechocystis
sp. PCC 6803
For Synechocystis sp. PCC 6803, custom-designed
microarray slides (Agilent) have been used. For each
growth condition, three biological replicates were used.
To pairwise compare the relative transcript abundance
that results from experiments with WTand the PsbO-free
mutant, aliquots of 10 mg RNA from each culture have
been used for preparing cDNA by reverse transcription.
For random priming of 10 mg RNA, we used 0.5 mg of
random hexamers in a final volume of 15 ml RNAse-free
water (Amersham, Munich, Germany) and heated to
70?C for 10 min and for reverse transcription and
labeling, we used 1? first strand buffer (Invitrogen, Lofer,
Germany), 400 U Superscript III reverse transcriptase
(Invitrogen), 10 mM DTT, 1 mM final dNTP mix, 70 mM
final concentration of Cy3-dUTP or Cy5-dUTP and
RNAse-free water to 30 ml; after sequentially mixing in
of all reagents and 10 min at room temperature, the
reaction mixture was heated to 50?C for 2 h. RNA tem-
plate was hydrolyzed with 50 mM NaOH and 20 mM
EDTA by heating to 70?C for 10 min. Each reaction
mixture with cDNA was cleaned with a QIA quick spin
column according to the Qiagen protocol. The efficiency
of dye incorporation into cDNA was determined with
a NanoDrop ND-1000 instrument (Peqlab, Erlangen,
Germany). In hybridization, red- and green-labeled
cDNA were mixed equimolar in hybridization buffer
and the mixture was layered over a custom-designed 11k
60-mer oligonucleotide DNA microarray. The array
covered all 3168 open reading frames of the Synecho-
cystis sp. PCC 6803 chromosome. All hybridization steps
were performed exactly according to the Agilent 60-mer
oligonucleotide microarray processing protocol (Sure-
Hyb, SSPE wash, G4140-90050; Agilent website http://
www.chem.agilent.com/scripts/LiteraturePDF.asp?iWHID=
44844&FileName=CGH_ApplicationNote_5989-4530EN_
72dpi(RGB).pdf). Slides were slowly moved for optimal
mixing in a hybridization oven at 60?C for 18 h. After
hybridization, the arrays were washed in SSPE buffer
according to the manufacturer’s manual using acetoni-
trileinthelaststep.Afterairdrying,thearrayswerestored
under a nitrogen atmosphere until readout with an
Agilent Microarray Scanner G2505B (default settings).
Fluorescence intensity values have been extracted with
the FEATURE EXTRACTIONsoftwareversion8.1.1.1(Agilent).In
subsequent data analyses, the mean signal of all pixels
within each spot was used. Background subtraction was
omitted, and normalization and data averaging were
performed by established procedures (Aguirre-von-Wo-
beser et al., PhD thesis in preparation).
DNA microarray experiments with S. elongatus
PCC 7942
The sequencing of the S. elongatus genome has been
performed by the Synechococcus elongatus PCC 7942
Functional Genome Project Initiative at Texas A&M Uni-
versity, College Station, TX, USA, headed by Professor
Susan Golden. The results are available at http://genome.
ornl.gov/microbiol/synPCC7942/(NC_007604.Thegenome
of S. elongatus PCC 7942 consists of 2.7 Mbps with
a total of 2612 annotated chromosomally localized
protein-encoding genes, 53 tRNA genes and 50 plas-
mid-localized protein-encoding genes (JGI annotation).
The overall GC content corresponds to 55.4%. On the
basis of the annotated protein-encoding genes and 183
additionally predicted genes, in particular small poly-
peptide-encoding genes, a total of 2898 70-mer oligo-
nucleotides were designed using the
software (Bioinformatics Resource Facility, CeBiTec,
Bielefeld University). The oligonucleotides were syn-
thesized by Operon Biotechnologies GmbH (Cologne,
Germany). Oligonucleotide probes were printed in
four replicates. In addition, several control spots were
applied to the slides: five 70-mer oligonucleotides
directed against NT03SE0857 (rpsO), NT03SE0747
(rpsI), NT03SE2644 (rpmI), NT03SE0278 (rpsP) and
NT03SE0452(gap)(70,80and90%identity)werespotted
in four replicates to function as a stringency control. As
a negative control, four alien 70-mer oligonucleotides
againstSinorhizobiummeliloti
-SMb20959, -SMb20961and -SMb21008 were spotted
in four replicates, and eight alien 70-mer oligonu-
cleotides against Medicago truncatula AlienMT000016,
-MT000017, -MT000018 and -MT000019 were spotted
two times in four replicates. Five alien spikes 1 to 5
(Stratagene,LaJolla,CA)in4replicates,96emptyspotsin
4 replicatesandspottingbufferin292replicateswere also
applied. Microarrays were produced and processed as
describedpreviously(Bruneetal.2006).Oligonucleotides
(40 mM) in 1.5 M betaine and 3? SSC (1? SSC is 0.15 M
sodiumchlorideand0.015 Msodiumcitrate)wereprinted
ontoNexterionSlideE(SchottAG,Mainz,Germany)using
the MicroGrid II 610 spotter (BioRobotics, Cambridge,
OLIGODESIGNER
alien-SMb20957,
4
Physiol. Plant. 2008

Page 5

UK) equipped with 48 SMP3 stealth pins (TeleChem
International, Inc., Sunnyvale, CA). DNA was cross-
linked to the surface by incubation of the slides for 2 h at
85?C.
Isolation of total RNA, cDNA synthesis, dye labeling,
microarray hybridization and image acquisition have
been performed as previously described (Nodop et al.
2008).
Microarray data analysis
Mean signal and mean background intensities were
obtained for each spot of the microarray images using
the IMAGENE 6.0 software (Bio DiscoveryInc., LosAngeles,
CA) for spot detection, image segmentation and signal
quantification. Spots were flagged empty if R ? 0.5 in
both channels, where R corresponds to the equation
[(signal mean) 2 (background mean)]/background SD.
The remaining spotswere considered for further analysis.
After subtraction of the local background intensities from
the signal intensities and introduction of a floor value of
20,thelog2valueoftheratioofintensitieswascalculated
for each spot using the formula Mi¼ log2(Ri/Gi). Ri¼
Ich1(i)2 Bgch1(i)andGi¼ Ich2(i)2 Bgch2(i),whereIch1(i)or
Ich2(i)is the intensity of a spot in channel 1 or channel 2
andBgch1(i)orBgch2(i)isthebackgroundintensityofaspot
in channel 1 or channel 2, respectively. The mean
intensity was calculated for each spot, Ai¼ log2(RiGi)0.5
(Dudoit et al. 2002). A normalization method based on
local regression was applied according to Yang et al.
(2002),Mi¼ log2(Ri/Gi) / log2(Ri/Gi) 2 c(A) ¼ log2
{Ri/[kj(A)Gi]}, where c(A) is the LOWESS (locally
weighted scatterplot smoothing) fit to the MA plot.
Normalization and t statistics were carried out using the
EMMA 2.2 microarray data analysis software developed at
the Bioinformatics Resource Facility, Center for Bio-
technology, Bielefeld University (Dondrup et al. 2003)
(http://www.cebitec.uni-bielefeld.de/groups/brf/software/
emma_info/). Significant upregulation or downregulation
of genes was identified by t statistics (Dudoit et al. 2002).
Genes were classified differentially expressed if P
? 0.051 and M ? 0.90 or M ? 20.90. Each experiment
was performed with three biological replicates, two
technical replicates and one dye swap.
Slot-blot DNA–RNA hybridization analysis
For slot-blot RNA hybridization experiments, 2 mg total
RNA was denatured for 10 min at 68?C in a formalde-
hyde/formamide-containing buffer and transferred to
HybondN1membranes (Amersham Pharmacia Biotech,
Freiburg, Germany) using the BioRad dot-blot SF micro-
filtration apparatus (BioRad, Munich, Germany) as
described in the manufacturer’s manual. RNA was UV
cross-linked to the membrane, and samples were probed
with different polymerase chain reaction-derived digox-
igenin-dUTP (Dig-dUTP)-labeled gene-specific DNA
probes (Table 1). Detection was performed with the
CDP-Starready-to-use system
Germany) according to the manufacturer’s recommen-
dation.ThernpBprobewasusedtoensureequalloading.
(Roche,Mannheim,
Results
Growth of Synechocystis sp. PCC 6803 WTand
a PsbO-free Synechocystis mutant
Synechocystis sp. PCC 6803 WTand a PsbO-free mutant
were cultivated in BG11 medium either with nitrate or
with L-arginineinastreamof2%CO2-enrichedairfor24,
48 and 72 h and with an illumination of 200 mmol
photons m22s21(see Materials and methods). Growth
curves, Chl content and appearance of cultures are
presented in Fig. 1. Electron micrographs of cells grown
under these conditions have previously been published
(Stephan et al. 2000). Nitrate-grown Synechocystis sp.
PCC6803WTcellsexhibitedaslightlyhighergrowthrate
and Chl content than the PsbO-free mutant cells.
Cultivation with L-arginine as sole N source caused
a stress phenotype in WT. The cells turned yellowish, the
thylakoid membranes and phycobilisomes became
severely degraded and the cells accumulated fairly high
amounts of cyanophycin granules. In contrast, the PsbO-
free Synechocystis mutant grew with L-arginine without
developing symptoms of severe stress. The appearance of
the L-arginine-grown mutant cells was almost similar to
those cells grown with nitrate (Fig. 1). Only minor
amounts of cyanophycin granules accumulated in the
Table 1. Primers used for preparation of DNA probes for slot-blot RNA–
DNA hybridization.
Gene Name
Amplified
product (bps) DNA sequence 5# / 3# direction
sll1336 sll1336
FR
slr0782
FR
cad
FR
speA
FR
speA1
FR
rnpB
FR
1686ATGTCGTACTGAGTCGCTTC
TGGAGTGCAACATGCTGGA
CCATCCTCGTCCTGTGATTG
CCAGTACGAATTGCACCATC
ACCTCTTCCAAGCTGATCTG
AGGCAGTGACATCGACGGTA
GTTGGACCATTGACGACAGC
CTGTCCAACATATCAGCTCG
GCCTCCTGGAGCATTGAAGA
CCAGCTTGACCAATTCCACA
GCGGCCTATGGCTCTAATCA
TTGACAGCATGCCACTGGAC
slr0782
1325
sll1683
858
slr0662
739
slr1312
853
slr1469
599
Physiol. Plant. 2008
5