Caffeic acid phenethyl ester protects mice from lethal endotoxin shock and inhibits lipopolysaccharide-induced cyclooxygenase-2 and inducible nitric oxide synthase expression in RAW 264.7 macrophages via the p38/ERK and NF-kappaB pathways.

Abstract

Caffeic acid phenethyl ester has been shown to have anti-inflammatory and anti-cancer effects. We examined the effects of caffeic acid phenethyl ester on lipopolysaccharide-induced production of nitric oxide and prostaglandin E2, and expression of inducible nitric oxide synthase and cyclooxygenase-2 in RAW 264.7 macrophages. We also investigated the effects of caffeic acid phenethyl ester on lipopolysaccharide-induced septic shock in mice. Our results indicate that caffeic acid phenethyl ester inhibits lipopolysaccharide-induced nitric oxide and prostaglandin E2 production in a concentration-dependent manner and inhibits inducible nitric oxide synthase and cyclooxygenase-2 in RAW 264.7 cells, without significant cytotoxicity. To further examine the mechanism responsible for the inhibition of inducible nitric oxide synthase and cyclooxygenase-2 expression by caffeic acid phenethyl ester, we examined the effect of caffeic acid phenethyl ester on lipopolysaccharide-induced nuclear factor-kappaB activation and the phosphorylation of mitogen-activated protein kinases. Caffeic acid phenethyl ester treatment significantly reduced nuclear factor-kappaB translocation and DNA-binding in lipopolysaccharide-stimulated RAW 264.7 cells. This effect was mediated through the inhibition of the degradation of inhibitor kappaB and by inhibition of both p38 mitogen-activated protein kinase and extracellular signal-regulated kinase phosphorylation, at least in part by inhibiting the generation of reactive oxygen species. Furthermore, caffeic acid phenethyl ester rescued C57BL/6 mice from lethal lipopolysaccharide-induced septic shock, while decreasing serum levels of tumor necrosis factor-alpha and interleukin-1beta. Collectively, these results suggest that caffeic acid phenethyl ester suppresses the induction of cytokines by lipopolysaccharide, as well as inducible nitric oxide synthase and cyclooxygenase-2 expression, by blocking nuclear factor-kappaB and p38/ERK activation. These findings provide mechanistic insights into the anti-inflammatory and chemopreventive actions of caffeic acid phenethyl ester in macrophages.

Full text

Page 1

The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
Contents lists available at ScienceDirect
The International Journal of Biochemistry
& Cell Biology
journal homepage: www.elsevier.com/locate/biocel
Caffeic acid phenethyl ester protects mice from lethal endotoxin shock
and inhibits lipopolysaccharide-induced cyclooxygenase-2 and
inducible nitric oxide synthase expression in RAW 264.7
macrophages via the p38/ERK and NF-?B pathways
Won-Kyo Junga,1, Inhak Choib,1, Da-Young Leeb, Sung Su Yeac, Yung Hyun Choid,
Moon-Moo Kime, Sae-Gwang Parkb, Su-Kil Seob, Soo-Woong Leeb, Chang-Min Leef,
Yeong-Min Parkf, Il-Whan Choib,∗
aDepartment of Marine Life Science, Chosun University, Gwangju 501-759, South Korea
bDepartment of Microbiology, Center for Viral Disease Research, Bio-Marker Research Center for Personalized Therapy, Inje University College of Medicine,
Gaegum-Dong, Jin-Gu, Busan 614-735, South Korea
cDepartment of Biochemistry, Inje University College of Medicine, Busan 614-735, South Korea
dDepartment of Biochemistry, Dong-Eui University College of Oriental Medicine, Busan 614-052, South Korea
eDepartment of Chemistry, Dong-Eui University, Busan 614-714, South Korea
fDepartment of Microbiology and Immunology, Pusan National University College of Medicine, Busan 602-739, South Korea
a r t i c l ei n f o
Article history:
Received 14 January 2008
Received in revised form 4 April 2008
Accepted 5 May 2008
Available online 15 May 2008
Keywords:
Caffeic acid phenethyl ester
Inducible nitric oxide synthase
Cyclooxygenase-2
Nuclear factor-?B
Septic shock
a b s t r a c t
Caffeic acid phenethyl ester has been shown to have anti-inflammatory and anti-cancer
effects. We examined the effects of caffeic acid phenethyl ester on lipopolysaccharide-
induced production of nitric oxide and prostaglandin E2, and expression of inducible nitric
oxide synthase and cyclooxygenase-2 in RAW 264.7 macrophages. We also investigated the
effects of caffeic acid phenethyl ester on lipopolysaccharide-induced septic shock in mice.
Our results indicate that caffeic acid phenethyl ester inhibits lipopolysaccharide-induced
nitric oxide and prostaglandin E2production in a concentration-dependent manner and
inhibits inducible nitric oxide synthase and cyclooxygenase-2 in RAW 264.7 cells, without
significant cytotoxicity. To further examine the mechanism responsible for the inhibition of
inducible nitric oxide synthase and cyclooxygenase-2 expression by caffeic acid phenethyl
ester, we examined the effect of caffeic acid phenethyl ester on lipopolysaccharide-induced
nuclear factor-?B activation and the phosphorylation of mitogen-activated protein kinases.
Caffeicacidphenethylestertreatmentsignificantlyreducednuclearfactor-?Btranslocation
and DNA-binding in lipopolysaccharide-stimulated RAW 264.7 cells. This effect was medi-
ated through the inhibition of the degradation of inhibitor ?B and by inhibition of both p38
mitogen-activated protein kinase and extracellular signal-regulated kinase phosphoryla-
tion, at least in part by inhibiting the generation of reactive oxygen species. Furthermore,
caffeic acid phenethyl ester rescued C57BL/6 mice from lethal lipopolysaccharide-induced
septic shock, while decreasing serum levels of tumor necrosis factor-? and interleukin-
1?. Collectively, these results suggest that caffeic acid phenethyl ester suppresses
Abbreviations: CAPE, caffeic acid phenethyl ester; iNOS, inducible nitric oxide synthase; PGE2, prostaglandin E2; COX-2, cyclooxygenase-2; TNF-?,
tumor necrosis factor-?; IL-1?, interleukin-1?; NF-?B, nuclear factor-?B; I?B, inhibitory factor of NF-kB; MAPK, mitogen-activated protein kinases; ROS,
reactive oxygen species; MOF, multiple organ failure.
∗Corresponding author. Tel.: +82 51 890 6461; fax: +82 51 891 6004.
E-mail address: cihima@inje.ac.kr (I.-W. Choi).
1These authors contributed equally to this work.
1357-2725/$ – see front matter © 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.biocel.2008.05.005

Page 2

W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
2573
the induction of cytokines by lipopolysaccharide, as well as inducible nitric oxide synthase
and cyclooxygenase-2 expression, by blocking nuclear factor-?B and p38/ERK activation.
These findings provide mechanistic insights into the anti-inflammatory and chemopreven-
tive actions of caffeic acid phenethyl ester in macrophages.
© 2008 Elsevier Ltd. All rights reserved.
1. Introduction
Caffeic acid phenethyl ester (CAPE), a potent flavonoid
anti-oxidant, is an active component in propolis. It
has strong anti-viral, anti-tumoral, anti-inflammatory,
anti-oxidant, neuroprotective, anti-atherosclerotic and
immunomodulatory properties in diverse systems (Orsolic
et al., 2005). CAPE is also a potent and specific inhibitor
of nuclear transcription factor-?B (NF-?B) activation
(Natarajan et al., 1996). NF-?B is normally present in the
cytosol and exists as an inactive complex with a class of
inhibitory proteins, known as inhibitor ?B (I?B) proteins.
Following an inflammatory stimulus, the phosphorylation
of I?B triggers its degradation and the translocation of NF-
?B to the nucleus, where it binds to promoter regions and
induces the expression of a wide variety of genes involved
in inflammation, including those encoding cytokines (such
as IL-1, IL-6 and TNF-?), enzymes (including nitric oxide
synthase), adhesion molecules and acute-phase proteins.
Becauseofitsubiquitousroleinthepathogenesisofinflam-
matory gene expression, NF-?B is a current target for the
treatment of various diseases (Barnes and Karin, 1997;
Makarov, 2000; Renard and Raes, 1999).
Nitric oxide has been shown to be an important regula-
tory molecule in diverse physiological functions, including
vasodilation, neural communication and host defense
(MacMicking et al., 1997; Mitchell et al., 1995). In mam-
malian cells, nitric oxide (NO) is synthesized by three
different isoforms of nitric oxide synthase (NOS): endothe-
lial NOS (eNOS), neuronal NOS (nNOS) and inducible
NOS (iNOS). Importantly, iNOS is highly expressed in
lipopolysaccharide (LPS)-activated macrophages and con-
tributes to the pathogenesis of septic shock (Petros et al.,
1991; Thiemermann, 1997). The promoter region of the
murinegeneencodingiNOScontainsNF-?Bbindingmotifs.
It has been reported that binding of NF-?B to the NF-?B
sites upstream of the iNOS promoter plays an important
role in the LPS-induced upregulation of the iNOS gene.
Cyclooxygenase (COX) is an enzyme that catalyzes the
conversion of arachidonic acid to prostaglandin H2, a pre-
cursor for a variety of biologically active mediators, such as
prostaglandin E2(PGE2), prostacyclin and thromboxane A2
(Picot et al., 1994; Hawkey, 1999). Two forms of COX have
been identified: cyclooxygenase-1 (COX-1), a constitutive
cyclooxygenase, and cyclooxygenase-2 (COX-2), which is
induced in response to many stimulants and is activated
at sites of inflammation (Mitchell et al., 1995; Smith et
al., 1996). COX-2 is rapidly produced in macrophages and
endothelial cells in response to proinflammatory cytokines
and may be responsible for the edema and vasodilation
associatedwithinflammation.Itiswellknownthatinflam-
matorymediators,includingNOandCOX-2,areresponsible
for the symptoms of many inflammatory diseases, such
as rheumatoid arthritis, chronic hepatitis and pulmonary
fibrosis (Isomaki and Punnonen, 1997; Tilg et al., 1992;
Coker and Laurent, 1998). Thus, inhibition of these inflam-
matory mediators is an important target in the treatment
of inflammatory diseases.
Septic shock is a severe inflammatory response that
is triggered by systemic infection and is characterized
by hypoperfusion of major organs, leading to multiple
organ failure (MOF), shock and death. The pathogenesis
of sepsis involves a progressive and dynamic expansion
of a systemic inflammatory response to bacterial infection
(Glauser, 1996). LPS, an integral part of the outer mem-
brane of Gram-negative bacteria, is a major pathogenic
factor in septic shock. Many treatment strategies for this
condition have been developed, but the mortality rate has
not improved substantially (Bone et al., 1995; Giroi et al.,
1997).
LPS causes phosphorylation of p38 mitogen-activated
protein kinases (MAPKs), extracellular signal-regulated
kinase (ERK)-1/2 and c-Jun NH2-terminal kinase (JNK),
leading to the activation of NF-?B in macrophages. More-
over, three well-defined MAPKs, ERK-1/2, p38 MAPK and
JNK/SAPK,havebeenimplicatedinthetranscriptionalregu-
lation of the iNOS and COX-2 genes. Collectively, the results
of these studies suggest that MAPK activation significantly
regulates NO and PGE2production by controlling the acti-
vation of NF-?B.
In this study, we investigated the effects and mecha-
nisms of action of CAPE (Fig. 1) on endotoxin-stimulated
proinflammatory mediators, and the findings suggest that
CAPE has therapeutic potential against inflammatory dis-
eases, including sepsis and endotoxemia.
2. Materials and methods
2.1. Materials
CAPE, LPS (Escherichia coli 026:B6), p-nitrophenyl
phosphate and 3-(4,5-dimethylthiazol-2-yl)-2,5-dipheny-
ltetrazolium bromide (MTT) were purchased from Sigma
(St. Louis, MO). RT-PCR reagents were purchased from
Promega (Madison, WI). Reagents for Lightshift chemilu-
minescent electrophoretic mobility shift assays, nuclear
and cytoplasmic extraction and biotin 3?end labeling were
purchased from Pierce (Rockford, IL). Specific antibod-
ies against iNOS, COX-2 and p65 were purchased from
Fig. 1. Structure of caffeic acid phenethyl ester (2-cyclohexylethyl (E)-3-
(3,4-dihydroxyphenyl)prop-2-enoate).

Page 3

2574
W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies
against I?B, ERK, phosphorylated (p)-ERK 1/2, p38, p-p38,
JNK/SAPK and p-JNK/SAPK were purchased from Cell Sig-
naling Technology (Beverly, MA).
2.2. Cell culture
RAW 264.7 macrophages, obtained from the American
TypeCultureCollection(Manassas,VA,USA),werecultured
in RPMI supplemented with 10% fetal bovine serum, peni-
cillin (100U/mL) and streptomycin (100?g/mL) at 37◦C in
a 5% CO2humidified air environment.
2.3. Cell viability assay
Cell viability was evaluated using the MTT reduction
assay, as previously described (Jin et al., 2007).
2.4. Nitrite assay
The concentrations of NO in sera and culture super-
natantsweredeterminedasnitriteusingtheGriessreagent
as described previously (Coker and Laurent, 1998).
2.5. Western blot analysis
Cells were washed three times with PBS and lysed
with lysis buffer (1% Triton X-100, 1% deoxycholate,
0.1% NaN3). Equal amounts of protein were separated
on 10% SDS-polyacrylamide minigels and transferred to
Immobilon polyvinylidenedifluoride membranes (Milli-
pore). After incubation with the appropriate primary
antibody, the membranes were incubated for 1h at
room temperature with a secondary antibody conjugated
to horseradish peroxidase. Following three washes in
Tris–bufferedsaline–Tween(TBST),immunoreactivebands
were visualized using the ECL detection system. In a paral-
lelexperiment,nuclearproteinwaspreparedusingnuclear
extraction reagents according to the manufacturer’s proto-
col.
2.6. RT-PCR
Total RNA (1.0?g) from cells was reverse-transcribed
using M-MLV reverse transcriptase to produce cDNA. RT-
generated cDNAs encoding iNOS, COX-2, TNF-?, IL-1? and
GAPDH were amplified by PCR using selective primers
(Table 1).
2.7. Enzyme-linked immunosorbent assay (ELISA)
The levels of TNF-?, IL-1? and PGE2were determined
by ELISA. ELISA kits from R&D Systems (Minneapolis, MN)
were employed for the measurement of TNF-? and IL-
1?, and a kit from Cayman Chemical (Ann Arbor, MI) was
employed for the measurement of PGE2.
2.8. Electrophoretic mobility shift assay (EMSA)
Nuclear
PER nuclear extraction reagent. As a probe for the
gelretardation assay,an
the immunoglobulin
?-chain
CCGGTTAACAGAGGGGGCTTTCCGAG-3?) was synthesized.
A non-radioactive method was used whereby the 3?end
of the probe was labeled with biotin according to the
manufacture’s protocol (Pierce). The binding reactions
contained 10?g of nuclear extract protein, buffer, 50ng of
poly(dI–dC) and 20fM biotin-labeled DNA. The reactions
were incubated for 20min at room temperature in a
final volume of 20?L. The competition reactions were
conducted by adding a 100-fold excess of cold ?B or
an irrelevant oligonucleotide (cAMP-response element,
CRE) to the reaction mix. The reaction mixture was
electrophoretically separated on a 5% polyacrylamide
gel in 0.5× Tris–borate buffer and transferred to a nylon
membrane. The biotin-labeled DNA was detected using
a LightShift chemiluminescent electrophoretic mobility
shift assay kit.
extractswere prepared usingtheNE-
oligonucleotide
binding
harboring
(?B, site5?-
2.9. Confocal laser scanning microscopy
The nuclear localization NF-?B p65 was examined
by indirect immunofluorescence assay using confocal
microscopy. RAW 264.7 cells were cultured directly on
glass coverslips in 24-well plates for 24h. After stimu-
lation with 5?g/mL LPS and/or 50?M CAPE, the cells
were fixed with 4% paraformaldehyde in PBS, permeabi-
lized with 0.2% Triton X-100 in PBS and blocked with 1.5%
normal donkey serum (Sigma). A polyclonal antibody to
NF-?B p65 (1?g/well) was applied for 1h, followed by
1h of incubation with fluorescein isothiocyanate (FITC)-
conjugateddonkeyanti-rabbitIgG.AfterwashingwithPBS,
Table 1
Sequences of the primers used in RT-PCR analysis
GenePrimerSequence Accession number
iNOS
Sense primer
Antisense primer
Sense primer
Antisense primer
Sense primer
Antisense primer
Sense primer
Antisense primer
Sense primer
Antisense primer
ATGTCCGAAGCAAACATCAC
TAATGTCCAGGAAGTAGGTG
CAGCAAATCCTTGCTGTTCC
TGGGCAAAGAATGCAAACATC
CTCGTGCTGTCGGACCCATAT
TTGAAGACAAACCGCTTTTCCA
ATGAGCACAGAAAGCATGATC
TACAGGCTTGTCACTCGAATT
TTTGTGATGGGTGTGAACCACGAG
GGAGACAACCTGGTCCTCAGTGTA
NM010927
COX-2
M94967
IL-1ˇ
NM008361
TNF-˛
NM013693
GAPDH
XM983052

Page 4

W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
2575
the coverslips were mounted with Fluoromount-G, and
fluorescence was visualized using a Zeiss LSM 510 Meta
microscope.
2.10. Measurement of intracellular reactive oxygen
species (ROS) generation
ROS were measured using a previously described
method with modifications (Cho et al., 2000). To measure
intracellular ROS, the cells were incubated for 4h at 37◦C
in PBS containing 5?M 2?,7?-dichlorofluorescein diacetate
(DCFDA, Molecular Probes, Eugene, OR) to label intracellu-
lar ROS. The cells were then immediately subjected to FACS
analysis (BD Biosciences, Rutherford, NJ).
2.11. In vivo endotoxin shock model
All experimental animals (female C57BL/6 mice) used
in this study were treated in accordance with proto-
cols approved by the Institutional Animal Care and Use
Committee of the Inje University College of Medicine.
Murine endotoxic shock was induced by intravenous
(i.v.) injection of LPS (100?L in saline). The effects of
CAPE on cytokine levels in endotoxin-shocked mice were
estimated by administering CAPE 16h and 10min (1 and
10mg/kg, respectively, intraperitoneally (i.p.)) prior to LPS
(2.5mg/kg) injection. Stock solution of CAPE was dissolved
in DMSO and further dilutions were made in PBS. After 1
and 4h, serum samples were obtained and TNF-? and IL-
1? levels, respectively, were measured. The survival of the
mice (LPS, 20mg/kg) was monitored every day for 10 days.
2.12. Histological examination
Fifteen to 20min after LPS challenge of the mice, their
lungs and kidneys were removed and fixed in 10% neutral
buffered formalin. For histological examination, 4-?m sec-
tionsoffixedembeddedtissueswerecut,mountedonglass
slides, deparaffinized and stained with hematoxylin and
eosin.
Fig. 2. Effect of CAPE on LPS-induced NO production in RAW 264.7 cells.
RAW 264.7 cells were pretreated with the indicated concentrations of
CAPE for 2h before being incubated with LPS (5?g/mL) for 24h. Culture
supernatants were then isolated and analyzed for nitrite production. Each
value indicates the mean±S.E.M. from three independent experiments.
*Indicates a significant difference (p<0.05) relative to cells treated with
LPS in the absence of CAPE.
2.13. Determination of pulmonary edema
Themouselungwet-to-dryweightratio(W/Dratio)was
used as an index of pulmonary edema. LPS-treated mice
were examined 12h after LPS injection. The lungs were
removed from the mice, and the wet weight was recorded.
Then,thelungswereplacedinanovenat50◦Cfor24h,and
the dry weight was recorded. The W/D ratio was calculated
by dividing the wet weight by the dry weight.
2.14. Statistical analysis
Data values given represent means±S.E.M. Statistical
significance was determined by analysis of variance, fol-
lowed by Scheffe’s test. A value of p<0.05 was deemed
statistically significant.
3. Results
3.1. Effect of CAPE on LPS-induced NO production
To evaluate the effect of CAPE on NO production in
LPS-stimulated RAW 264.7 macrophages, we measured
nitrite released into the culture medium using the Griess
reagent. RAW 264.7 cells were treated with various con-
centrations of CAPE (0, 10, 30 or 50?M) for 2h before
adding LPS (5?g/mL). The LPS-induced elevation in nitrite
concentration in the medium decreased in a CAPE dose-
dependent manner (Fig. 2). According to the NO detection
assay, NO was significantly increased to 5.7 times the basal
level in RAW 264.7 cells after 24h of LPS stimulation, and
this increase was inhibited by CAPE treatment in a dose-
dependent manner.
To exclude the possibility that the inhibition of NO pro-
duction was due to cytotoxicity caused by CAPE treatment,
MTT assays were performed in RAW 264.7 macrophages
treated with CAPE for 24h (Fig. 3). At the concentrations
used (10–50?M), CAPE did not affect cell viability. Thus,
the inhibitory activity of CAPE on LPS-stimulated NO pro-
Fig. 3. Effects of CAPE on viability of RAW 264.7 cells. Cells were treated
with the indicated concentrations of CAPE (0, 10, 30 or 50?M) for 2h
before a 24-h treatment with LPS (5?g/mL). Cell viability was assessed
using an MTT reduction assay, and the surviving cell values are expressed
as a percent of control treated cells (no addition of CAPE). Each value
indicates the mean±S.E.M. from three independent experiments.

Page 5

2576
W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
Fig.4. EffectsofCAPEonLPS-inducedPGE2productioninRAW264.7cells.
RAW 264.7 cells were incubated with CAPE (0, 10, 30 and 50?M) in the
presence or absence of LPS (5?g/mL) for 24h. PGE2concentration was
measured in culture media using a commercial ELISA kit. Each value indi-
cates the mean±S.E.M. from three independent experiments. *Indicates
a significant difference (p<0.05) relative to cells treated with LPS in the
absence of CAPE.
duction was not due to any cytotoxic action on RAW 264.7
macrophages.
3.2. CAPE suppresses LPS-induced PGE2production
Because PGE2 is the most prominent inflammatory
product of COX-2 activity, we quantified PGE2in the super-
natant. RAW 264.7 macrophages were pretreated with
CAPEfor2handthenstimulatedwith5?g/mLLPSfor24h.
PretreatmentofthecellswithCAPE(0,10,30or50?M)and
LPS resulted in a significant dose-dependent reduction in
PGE2production (Fig. 4). These results show that pretreat-
ment with CAPE significantly suppresses the expression of
LPS-stimulated proinflammatory mediators.
3.3. Effects of CAPE on LPS-induced iNOS and COX-2
expression
To determine the mechanism by which CAPE reduced
LPS-induced NO and PGE2 production, we studied the
ability of CAPE (0, 10, 30 or 50?M) to influence the LPS-
inducedproductionofiNOSorCOX-2.Asshownbywestern
blot analysis, LPS treatment significantly increased the
expression of iNOS and COX-2. However, this expression
was markedly attenuated in RAW 264.7 macrophages pre-
treated with CAPE (Fig. 5). Western blots showed induction
of iNOS and COX-2 proteins in RAW 264.7 cells after 24h of
incubation with 5?g/mL LPS (Fig. 5A). This induction was
suppressedinaconcentration-dependentmannerbyCAPE.
RT-PCR analysis also showed that iNOS and COX-2 mRNA
levels were correlated with the levels of the corresponding
proteins (Fig. 5B). These findings indicate that treatment
with CAPE significantly suppressed the LPS-stimulated
induction of iNOS and COX-2 through transcriptional inhi-
bition.
3.4. Effects of CAPE on LPS-induced TNF-˛ and IL-1ˇ
production
We next attempted to determine the potential effects of
CAPE on the production of the proinflammatory cytokines
Fig. 5. Inhibition of LPS-induced iNOS and COX-2 protein (A) and mRNA
(B) expression by CAPE in RAW 264.7 macrophages. (A) RAW 264.7 cells
(5×105cell/mL) were incubated with the indicated concentrations of
CAPE(0,10,30and50?M)2hbeforeLPS(5?g/mL)treatmentfor24h.Cell
lysates were electrophoresed, and the expression levels of iNOS and COX-
2 were detected with specific antibodies. (B) After LPS treatment for 6h,
total RNA was prepared from RAW 264.7 cells and RT-PCR was preformed
for the iNOS and COX-2 genes. ?-actin and GAPDH were used as internal
controls for western blot analysis and RT-PCR assays, respectively. This
experimentwaspreformedintriplicateandsimilarresultswereobtained.
TNF-? and IL-1?. RAW 264.7 cells were incubated with
CAPE (0, 10, 30 or 50?M) in the presence or absence of
LPS (5?g/mL) for 24h, and TNF-? and IL-1? levels were
measured in the culture media using ELISA. The levels
of both cytokines were increased in the culture media
of LPS-stimulated RAW 264.7 cells, and these increases
were significantly decreased in a concentration-dependent
manner by treatment with CAPE (Fig. 6A). In a parallel
experiment, RT-PCR was performed to determine whether
CAPE inhibited the expression of these cytokines at the
transcriptional level. Treatment of RAW 264.7 cells with
different concentrations of CAPE for 2h before LPS treat-
ment resulted in a dose-dependent decrease in the mRNAs
encoding IL-1? and TNF-? (Fig. 6B). These results suggest
that CAPEacts primarily by preventing the accumulation of
proinflammatory cytokines at the transcriptional level.
3.5. Inhibition of NF-?B activation by CAPE in
LPS-stimulated RAW 264.7 cells
Activation of NF-?B is necessary for the induction of
iNOS, COX-2 genes and cytokines. We next examined the
activation of NF-?B in RAW 264.7 cells in response to LPS
(Fig. 7). It is known that NF-?B, when activated by LPS,
enters the nucleus and induces gene expression. The het-
eromeric NF-?B complex is sequestered in the cytoplasm
asaninactiveprecursor,complexedwithaninhibitoryI?B-

Page 6

W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
2577
Fig. 6. Effects of CAPE on LPS-induced TNF-? and IL-1? production in
RAW 264.7 cells. RAW 264.7 cells were incubated with CAPE (0, 10, 30
and 50?M) for 2h before LPS treatment (5?g/mL), and total RNA and
the supernatants were isolated at 3 and 24h after LPS treatment, respec-
tively. Extracellular levels of TNF-? and IL-1? were measured in culture
media using commercial ELISA kits (A). After incubation for 3h, the levels
of TNF-˛ and IL-1ˇ mRNAs were determined by RT-PCR (B). Each value
indicates the mean±S.E.M. from three independent experiments. *Indi-
cates a significant difference (p<0.05) relative to cells treated with LPS in
the absence of CAPE.
likeprotein,andLPSinducesNF-?Bactivationbyincreasing
levels of the nuclear p65 protein, which is associated with
decreased levels of cytosolic I?B? protein. LPS treatment
caused a significant increase in the DNA-binding activity
of NF-?B, as determined by an electrophoretic mobility
shift assay (Fig. 7A). In contrast, treatment with CAPE sig-
nificantly suppressed the induced DNA-binding activity of
NF-?B by LPS at early time points.
We also investigated the effect of CAPE on LPS-induced
NF-?B p65 nuclear translocation. Significant levels of NF-
?B p65 localized to the nucleus 15min after LPS treatment
(Fig. 7B). Levels of the p65 protein decreased in the nuclei
of cells exposed to both LPS and CAPE, indicating that CAPE
inhibits the nuclear translocation of the p65 protein. To
determine whether the inhibition of NF-?B DNA binding
by CAPE was related to I-?B? degradation, the cytoplasmic
levels of I-?B? were examined by western blot analysis.
Pretreatment of RAW 264.7 cells with CAPE blocked LPS-
induced I-?B? degradation. This finding provides evidence
that CAPE inhibits the activation of NF-?B.
To clearly understand the influence of CAPE on NF-?B
p65 nuclear translocation, the NF-?B p65 nucleus shift in
RAW 264.7 cells was analyzed using confocal microscopy
(Fig. 7C). Confocal images revealed that NF-?B p65 was
normally sequestered in the cytoplasmic compartment
(Fig. 7C, MED panel), and robust nuclear accumulation
of NF-?B p65 was induced in RAW 264.7 cells following
stimulation with LPS (Fig. 7C, LPS panel). The LPS-induced
Fig. 7. Effects of CAPE on NF-?B activity in LPS-stimulated RAW 264.7
macrophages. (A) Nuclear extracts (5?g) were prepared and analyzed
for DNA binding activity of NF-?B using an electrophoretic mobility shift
assay. RAW 264.7 cells were pretreated with vehicle or the indicated
concentrations of CAPE for 2h before stimulation with LPS (5?g/mL)
for another 1h. The result shown is representative of three independent
experiments. (B) The p65 subunit of NF-?B in nuclear protein extracts and
levels of I-?B? in the cytosolic protein were determined by a western blot
analysis. RAW 264.7 cells were treated with LPS (5?g/mL) for 0.5h, and
p65 protein and I-?B? were detected using specific antibodies. (C) RAW
264.7 cells were pretreated with 50?M CAPE for 2h before stimulation
with LPS (5?g/mL) for 20min. The p65 protein localization in cells was
determined with an anti-p65 antibody and a FITC-labeled anti-rabbit IgG
antibody, and cells were viewed with laser confocal scanning microscopy.
A representative of three to five independent experiments is shown.

Page 7

2578
W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
translocation of NF-?B p65 was completely abolished by
pretreatment with CAPE (Fig. 7C, LPS+CAPE panel). The
translocation of NF-?B p65 was not induced in cells after
pretreatment with CAPE alone, in the absence of LPS stim-
ulation (Fig. 7C, CAPE panel). These results show that CAPE
inhibits the translocation of NF-?B p65. Taken together,
theseresultssuggestthattheinhibitionofNF-?Bactivation
by CAPE is the mechanism responsible for its suppression
of NO, PGE2and proinflammatory cytokines in RAW 264.7
cells.
3.6. Effects of CAPE on LPS-induced ROS production
To assess the mechanism responsible for the inhibitory
effect of CAPE on NF-?B activation, we examined the effect
ofCAPEontheLPS-inducedproductionofROSinRAW264.7
cells. It has been reported that ROS are involved in the acti-
vation of NF-?B. Cells were incubated with CAPE (0, 10, 30
or 50?M) in the presence or absence of LPS (5?g/mL) for
24h. As shown in Fig. 8, LPS-stimulated RAW 264.7 cells
showed increased ROS production. In contrast, pretreat-
ment of cells with CAPE resulted in a significant reduction
in ROS production in the presence of LPS.
3.7. Effect of CAPE on the phosphorylation of MAPKs in
LPS-stimulated RAW 264.7 cells
Subsequentexperimentsweredesignedtoelucidatethe
signaling cascades that induce the expression of the iNOS
and COX-2 genes in RAW 264.7 cells in response to stim-
ulation by LPS. There is evidence that MAP kinases play a
key role in the regulation of cell growth and differentiation
and in the control of cellular responses to cytokines and
stresses. They play a key role in the activation of NF-?B.
Moreover, MAP kinase is known to be important in iNOS
and COX-2 expression.
To investigate whether the inhibition of NF-?B acti-
vation by CAPE was mediated through the MAP kinase
pathway, we examined the effect of CAPE on the LPS-
induced phosphorylation of ERK-1/2, p38 and JNK/SAPK in
RAW 264.7 cells using western blot analysis (Fig. 9). We
haveshownthattheseproteinsarephosphorylatedfollow-
ing stimulation with LPS. Thus, we examined the effects
of CAPE on the LPS-induced activation of ERK-1/2, p38
and JNK/SAPK MAP kinase. CAPE (50?M) markedly inhib-
ited p38 and ERK-1/2 MAP kinase activation, whereas the
phosphorylation of JNK/SAPK MAP kinase was not affected
(Fig. 9A). The amount of non-phosphorylated p38 and ERK-
1/2 was unaffected by LPS or CAPE treatment.
We confirmed the importance of ERK-1/2 and p38,
but not of JNK/SAPK, in iNOS and COX-2 production in
RAW 264.7 cells using specific inhibitors of each kinase:
U0126 (30?M), SB203580 (10?M) and SP600125 (40?M),
respectively (Fig. 9B). LPS-induced iNOS and COX-2 expres-
sion was significantly suppressed by U0126 and SB203580
but not by SP600125.
Taken together, the ERK-1/2 and p38 MAP kinase path-
waysareimportantintheLPS-mediatedexpressionofiNOS
Fig. 8. Effects of CAPE on LPS-induced ROS production in RAW 264.7 cells. RAW 264.7 cells were pretreated with the indicated concentrations of CAPE (0,
10, 30 and 50?M) 2h before LPS (5?g/mL) treatment for 24h. Cells were resuspended and mean fluorescence intensity (MFI) was measured using flow
cytometry. Each value represents the results of three independent experiments.

Page 8

W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
2579
Fig. 9. Effects of CAPE on LPS-induced phosphorylation of ERK-1/2,
SAPK/JNK and p38 MAP kinase in RAW 264.7 cells. RAW 264.7 cells were
treated with vehicle or the indicated concentrations of CAPE for 2h before
incubation with LPS (5?g/mL) for 30min. (A) Cell extracts were then
prepared and subjected to western blotting with antibodies specific for
phosphorylated forms of ERK-1/2, SAPK/JNK and p38. (B) Cells treated
with LPS (5?g/mL) for 24h in the presence of ERK (U0126, 30?M), p38
MAPK (SB203580, 10?M) and JNK (SP600125, 40?M) inhibitors. Results
represent three independent experiments.
and COX-2. These results suggest that phosphorylation of
p38 and ERK-1/2 is involved in the inhibitory effect of CAPE
on LPS-induced NF-?B binding in RAW 264.7 cells.
3.8. CAPE prevents LPS-induced septic shock in mice
We assessed whether the administration of CAPE to
C57BL/6 mice would improve survival of LPS-induced
shock. Mice were administered either CAPE or vehicle, and
16h later were injected i.v. with LPS (20mg/kg, Fig. 10A).
LPS administration resulted in the death of all mice within
2 days. In contrast, all mice treated with 10mg/kg CAPE
prior to LPS survived.
Next, we examined the effect of CAPE on the LPS-
induced serum levels of TNF-? in mice (Fig. 10B). TNF-?
has been shown to be a key mediator of septic shock
in several models of endotoxemia. Naive animals (saline)
showed undetectable levels of TNF-? (the assay detec-
tion limit was 20pg/mL), whereas mice treated with
moderate level of LPS (2.5mg/kg) showed serum TNF-?
levels of 2098.3±285.9ng/mL. Pretreatment with CAPE
significantly reduced endotoxin-induced TNF-? release to
579.7±136.9ng/mL. Similarly, i.v. administration of LPS at
6h increased serum levels of nitrite (115.89±24.35?M),
as estimated by the Griess reaction (Fig. 10C). Nitrate
levels were also significantly reduced by pretreatment
with CAPE at 1 or 10mg/kg (i.p.), to 58.24±9.81?M
or 33.42±8.86?M, respectively (Fig. 10C). It has been
reported that CAPE inhibits NF-?B activation (Natarajan et
al., 1996). However, the inhibition of LPS-elicited NF-?B
activationbyCAPEhasnotyetbeenappraisedinmice.CAPE
inhibited TNF-? expression in parallel with NF-?B activa-
tion in vivo (Fig. 10D), confirming that TNF-? expression is
tightly regulated by NF-?B.
To examine the effect of CAPE (1 or 10mg/kg) on tis-
sue injury, tissues were harvested from animals following
injectionwithLPS(Fig.10E).Variousorganswereexamined
for septic shock-induced morphological changes. It is well
known that endotoxin or LPS can provoke a disseminated
intravascular coagulation (DIC), systemic inflammatory
response syndrome (Erlich et al., 1999; Inoue et al., 2005;
Opal, 2007). DIC is a severe clinical condition, typically
characterized by organ failure and a tendency to bleed,
and has a high mortality rate. Massive congestion and
cellular infiltration in the pulmonary interstitia (Fig. 10E,
LPS+Vehicle, Lung panel) and considerable hemorrhag-
ing in the renal medullae (Fig. 10E, LPS+Vehicle, Kidney
panel) were observed. The increased pulmonary edema
and hemorrhaging in the renal medullae were significantly
reduced by the administration of CAPE (Fig. 10E, LPS+CAPE
10 panel). Moreover, the lung W/D ratio as an index of
pulmonary edema increased from 4.28±0.06 to 4.91±0.2
after LPS injection. By contrast, in the mice pretreated
with CAPE (10mg/kg), the increase in the W/D ratio was
markedly reduced, giving a ratio of 4.41±0.14 (Fig. 10F).
These results suggest that CAPE attenuates LPS-induced
pathological changes. Thus, these data provide evidence
that CAPE exerts anti-inflammatory actions both in vitro
and in vivo.
4. Discussion
The present study was undertaken to examine the
pharmacological and biological effects of CAPE on the pro-
duction of inflammatory mediators in mouse macrophage
RAW 264.7 cells stimulated with LPS, and the effects of
CAPE in animal models of Gram-negative septic shock.
To further understand the molecular mechanism of CAPE
activityinmacrophages,weinvestigatedtheeffectsofCAPE
ontheproductionofNO,theexpressionlevelsofiNOS,COX-
2andcytokines(TNF-?,IL-1?),theactivationofMAPKsand
the activation of the transcription factor NF-?B.
The results of this study indicate that CAPE effectively
inhibits LPS-induced production of TNF-?, IL-1?, NO and
PGE2through a blockade of NF-?B and the MAPK pathway
in RAW 264.7 macrophages. In an animal model of sep-
tic shock, administration of CAPE inhibited LPS-stimulated
increasesinplasmaconcentrationsofTNF-?andactivation
ofNF-?Binmouselungtissue.TheinhibitoryeffectofCAPE
on inflammatory mediator expression suggests one of the
mechanisms responsible for its anti-inflammatory action
and its potential for use as a therapeutic agent for treating
LPS-induced sepsis syndrome.

Page 9

2580
W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
Fig. 10. Effects of CAPE on LPS-induced septic shock in mice. CAPE (1 and 10mg/kg) was administered i.p. 16h and 10min prior to LPS injection. (A) CAPE
treatment improved survival of mice in a model of LPS-induced septic shock. Survival (10 mice per group) was monitored for 10 days after i.v. injection
of LPS (20mg/kg). (B) 1h after LPS injection, a serum sample was obtained by cardiac puncture and TNF-? content was determined by ELISA as described
in Section 2. (C) Dose effects of CAPE on LPS-induced production of serum nitrite. Serum nitrite levels from various groups were monitored 6h after LPS
administration. CAPE (1 and 10mg/kg, i.p.) was administered 16h and 10min prior to LPS (2.5mg/kg, i.v.) injection. Serum nitrite concentrations were
determined using Griess reagent, as described in Section 2. (D) CAPE (1 and 10mg/kg) inhibited LPS-induced NF-?B activation. Lungs were removed
30min after LPS (2.5mg/kg) injection. Nuclear extracts from the lungs were incubated with biotin-labeled ?B oligonucleotide and electrophoresed on a 5%
polyacrylamide gel. A 100-fold excess of cold ?B or an irrelevant motif, CRE, was added as a competitor. Each value indicates the mean±S.E.M. from three to
five separate experiments (n=5 per group). *Indicates a significant difference (p<0.05) relative to mice treated with LPS in the absence of CAPE. (E) CAPE (1
and 10mg/kg, i.p.) was administered 16h and 10min prior to LPS injection. Massive congestion and cellular infiltration in the pulmonary interstitium and
considerable hemorrhaging in renal medullae were observed (LPS+Vehicle panel). All of these histological changes were prevented by pretreatment with
CAPE (LPS+CAPE 10, 10mg/kg) before LPS injection. Lungs and kidneys were removed 10min after LPS injection, fixed in 10% formalin and stained with
hematoxylin and eosin (×200). (F) Lung wet-to-dry weight ratio (W/D). Each value indicates the mean±S.E.M. (n=5 per group). *Indicates a significant
difference (p<0.05) relative to mice treated with LPS in the absence of CAPE.

Page 10

W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
2581
NO and prostaglandins, which are produced by iNOS
and COX-2, respectively, have been implicated as impor-
tant mediators of inflammation. Our results demonstrate
that CAPE inhibits LPS-induced NO and PGE2 produc-
tion in a concentration-dependent manner in RAW 264.7
macrophages. This suppression was correlated with down-
regulation of iNOS and COX-2 expression. The effects
of these inflammatory mediators may be double-edged.
Both abnormally low and high levels of these mediators
may contribute to the pathogenesis of inflammatory dis-
eases.Thus,potentialinhibitorsofendotoxin-inducediNOS
and COX-2 may be effective therapeutically in preventing
inflammatory reactions and diseases.
It has been reported that abnormalities in the produc-
tion or function of cytokines, such as TNF-? and IL-1?,
play roles in many inflammatory lesions (De Nardin, 2001).
TNF-? is primarily produced by monocytes, macrophages
and T cells, and has various proinflammatory effects on
many cell types. It is a potent activator of macrophages
and can stimulate the production or expression of IL-6,
IL-1?, PGE2, collagenase and adhesion molecules. TNF-?
elicits a number of physiological effects, including septic
shock, inflammation and cytotoxicity (Tracey and Cerami,
1989). IL-1? is also a major proinflammatory cytokine, pri-
marily released by macrophages, and it is believed to play
an important role in the pathophysiology of rheumatoid
arthritis (Dayer, 2003). Inflammatory stimuli, such as LPS,
induce excessive production of cytokines by macrophages,
a process that is then further increased by autocrine and
paracrine routes, tremendously increasing the severity of
the immune response which causes inflammation (Gautier
et al., 2005; Crespo et al., 2000). Thus, the inhibition of
cytokine production or function is a key mechanism in the
controlofinflammation.Inthepresentstudy,wefoundthat
CAPE significantly inhibited the production of the proin-
flammatory cytokines TNF-? and IL-1? in RAW 264.7 cells
stimulated by LPS. These findings provide evidence that
CAPE possesses useful anti-inflammatory activity.
NF-?B is a pleiotropic regulator of various genes
involved in immune and inflammatory responses. It has
been shown that NF-?B activation is a key factor in
the production of iNOS, COX-2 and various cytokines in
macrophages in response to LPS (Lawrence et al., 2001;
Baldwin, 1996). Because the expression of these proin-
flammatorymediatorsismodulatedbyNF-?B,ourfindings
suggest that CAPE treatment blocks the degradation of I?B
and activation of NF-?B in RAW 264.7 macrophages. In
this study, we describe novel anti-inflammatory mecha-
nisms mediated by CAPE based on the inhibition of the
LPS-mediated activation of NF-?B.
It has been shown that several natural anti-oxidant
compounds directly inhibit the expression of the NF-?B-
dependent cytokines iNOS and COX-2, and thus reduce
inflammation (Ma et al., 2003; Surh et al., 2001). The
suppressive effects of these anti-oxidant compounds on
the production of the associated inflammatory media-
tors are associated with their anti-oxidant activities. The
anti-oxidant NF-?B inhibitors restrict the production of
inflammatory mediators by suppressing the expression
of the corresponding genes, and also prevent inflam-
matory diseases. Moreover, changes in intracellular ROS
can regulate signal transduction pathways, leading to the
modulation of NF-?B activity. In the present study, we
demonstrated that CAPE has intracellular radical scav-
enging activity in RAW 264.7 cells, suggesting a possible
mechanism for the inhibitory effect of CAPE on NF-
?B activation. Therefore, the potential inhibition of ROS
generation by CAPE is consistent with the inhibition of NF-
?B-dependent cytokines and iNOS and COX-2 expression,
and thus reduced inflammation.
Various intracellular signaling pathways are involved
in the modulation of NF-?B activity and inflammatory
cytokine expression. The MAPKs are a group of signaling
molecules that appear to play important roles in inflam-
matoryprocesses.LPSregulatesiNOSandCOX-2expression
through a MAPK signaling pathway. LPS treatment results
in the phosphorylation of p38, ERK-1/2 and JNK, leading to
NF-?B activation in macrophages (Cario et al., 2000; Zhang
et al., 1999). Activation of MAPK has been demonstrated to
be important in the regulation of iNOS and COX-2 expres-
sion through control of the activation of NF-?B (Suh et al.,
2006; Pergola et al., 2006). Thus, we investigated the effect
of CAPE on the LPS-stimulated phosphorylation of MAPK
in RAW 264.7 cells. Interestingly, only the phosphorylation
of p38 and ERK-1/2 in response to LPS was decreased by
CAPE treatment; no significant changes were observed in
LPS-induced phosphorylation of JNK/SAPK in response to
CAPE treatment. These results suggest that p38 and ERK-
1/2, but not JNK/SAPK, are involved in the inhibitory effect
of CAPE on LPS-induced iNOS and COX-2 expression, and
NF-?B activation.
CAPE has a potent inhibitory action on iNOS expression
in RAW 264.7 cells. This in vitro finding correlated well
with the in vivo outcome. The large amount of NO pro-
duced in response to bacterial LPS or cytokines plays an
important role in endotoxemia and inflammatory condi-
tions(Stocletetal.,1998;Giddayetal.,1998;Thiemermann,
1997). Administration of CAPE induced a significant reduc-
tion in the NO level in mice. These results show that the
effect of CAPE on LPS-induced mortality depends on the
decreased production of NO. Because the major problem
in endotoxemia in humans and experimental animals is
increased NO concentration in the plasma due to iNOS
expression,whicheventuallyleadstoMOF,itisveryimpor-
tant for any therapeutic agent to inhibit iNOS expression
and/or enzyme activity. The inducibility of iNOS by LPS has
already been shown to be dependent upon transcription
triggeredbyNF-?B(Wonetal.,2006;Xieetal.,1994).Inthe
presentstudy,wedemonstratedthatCAPEreducesthepro-
duction of NO and the expression of NF-?B in LPS-induced
septic shock.
In summary, we have demonstrated that treatment of
RAW 264.7 cells with CAPE can decrease levels of pro-
inflammatory mediators following LPS stimulation. CAPE
significantly inhibited the release of NO, PGE2, TNF-? and
IL-1? in a concentration-dependent manner, acting at the
transcriptional level. The anti-inflammatory properties of
CAPE were mediated by the down-regulation of NF-?B,
p38 and ERK-1/2, and the inhibition of ROS accumulation.
An in vivo assay also showed that CAPE protected against
the lethality triggered by acute endotoxin administration.
Thus, we conclude that CAPE possesses potential anti-

Page 11

2582
W.-K. Jung et al. / The International Journal of Biochemistry & Cell Biology 40 (2008) 2572–2582
inflammatory activity and beneficial characteristics for the
treatment of endotoxin shock or sepsis.
Acknowledgments
This work was supported by the Korea Research
Foundation Grant funded by the Korean Government
(KRF-2005-041-E00158), and by the Korea Science and
EngineeringFoundation(KOSEF)GrantfundedbytheKorea
Government (MOST) (No. R13-2007-023-00000-0).
References
BaldwinJrAS.TheNF-kappaBandI-kappaBproteins:newdiscoveriesand
insights. Annual Review of Immunology 1996;14:649–83.
Barnes PJ, Karin M. Nuclear factor-kappaB: a pivotal transcription factor in
chronic inflammatory diseases. The New England Journal of Medicine
1997;336:1066–71.
Bone RC, Balk RA, Fein AM, Perl TM, Wenzel RP, Reines HD, et al. A second
large controlled clinical study of E5, a monoclonal antibody to endo-
toxin: results of a prospective, multicenter, randomized, controlled
trial. Critical Care Medicine 1995;23:994–1006.
Cario E, Rosenberg IM, Brandwein SL, Beck PL, Reinecker HC, Podolsky DK.
Lipopolysaccharide activates distinct signaling pathways in intestinal
epithelialcelllinesexpressingToll-likereceptors.JournalofImmunol-
ogy 2000;164:966–72.
Cho KJ, Yun CH, Yoon DY, Cho YS, Rimbach G, Packer L, et al. Effect of
bioflavonoids extracted from the bark of Pinus maritima on proin-
flammatory cytokine interleukin-1 production in lipopolysaccharide-
stimulated RAW 264.7. Toxicology and Applied Pharmacology 2000;
168:64–71.
Coker RK, Laurent GJ. Pulmonary fibrosis: cytokines in the balance. The
European Respiratory Journal 1998;11:1218–21.
Crespo A, Filla MB, Russell SW, Murphy WJ. Indirect induction of suppres-
sor of cytokine signalling-1 in macrophages stimulated with bacterial
lipopolysaccharide: partial role of autocrine/paracrine interferon-
alpha/beta. The Biochemical Journal 2000;349:99–104.
De Nardin E. The role of inflammatory and immunological mediators in
periodontitis and cardiovascular disease. Annals of Periodontology
2001;6:30–40.
Dayer JM. The pivotal role of interleukin-1 in the clinical manifesta-
tions of rheumatoid arthritis. Rheumatology (Oxford) 2003;42(Suppl.
2):ii3–10.
Erlich J, Fearns C, Mathison J, Ulevitch RJ, Mackman N. Lipopolysaccharide
induction of tissue factor expression in rabbits. Infection and Immu-
nity 1999;67:2540–6.
Gautier G, Humbert M, Deauvieau F, Scuiller M, Hiscott J, Bates EE, et al.
A type I interferon autocrine-paracrine loop is involved in Toll-like
receptor-induced interleukin-12p70 secretion by dendritic cells. The
Journal of Experimental Medicine 2005;201:1435–46.
Gidday JM, Park TS, Shah AR, Gonzales ER. Modulation of basal and
postischemic leukocyte–endothelial adherence by nitric oxide. Stroke
1998;29:1423–9.
Giroi BP, Quint PA, Barton P, Kirsch EA, Kitchen L, Goldstein B, et al. Prelim-
inary evaluation of recombinant amino-terminal fragment of human
bactericidal/permeability-increasing protein in children with severe
meningococcal sepsis. Lancet 1997;350:1439–43.
GlauserMP.Theinflammatorycytokines.Newdevelopmentsinthepatho-
physiology and treatment of septic shock. Drugs 1996;52(S2):9–17.
Hawkey CJ. Cox-2 inhibitors. Lancet 1999;353:307–14.
Inoue K, Takano H, Shimada A, Yanagisawa R, Sakurai M, Yoshino S, et
al. Urinary trypsin inhibitor protects against systemic inflammation
induced by lipopolysaccharide. Molecular Pharmacology 2005;67:
673–80.
IsomakiP,PunnonenJ.Proandanti-inflammatorycytokinesinrheumatoid
arthritis. Annals of Medicine 1997;29:499–507.
Jin CY, Lee JD, Park C, Choi YH, Kim GY. Curcumin attenuates the release
of pro-inflammatory cytokines in lipopolysaccharide-stimulated BV2
microglia. Acta Pharmacologica Sinica 2007;28:1645–51.
Lawrence T, Gilroy DW, Colville-Nash PR, Willoughby DA. Possible new
role for NF-?B in the resolution of inflammation. Nature Medicine
2001;7:1291–7.
Ma Q, Kinneer K, Ye J, Chen BJ. Inhibition of nuclear factor ?B by phenolic
antioxidants: interplay between antioxidant signaling and inflamma-
tory cytokine expression. Molecular Pharmacology 2003;64:211–9.
MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function.
Annual Review of Immunology 1997;15:323–30.
MakarovSS.NF-?Basatherapeutictargetinchronicinflammation:recent
advances. Molecular Medicine Today 2000;6:441–8.
Mitchell JA, Larkin S, Williams TJ. Cyclooxygenase 2: regulation and rele-
vance in inflammation. Biochemical Pharmacology 1995;50:1535–42.
Natarajan K, Singh S, Burke Jr TR, Grunberger D, Aggarwal BB. Caffeic
acid phenethyl ester is a potent and specific inhibitor of activation of
nuclear transcription factor NF-kappa B. Proceedings of the National
Academy of Sciences of the United States of America 1996;93:9090–5.
Opal SM. The host response to endotoxin, antilipopolysaccharide strate-
gies, and the management of severe sepsis. International Journal of
Medical Microbiology 2007;297:365–77.
Orsolic N, Terzic S, Mihaljevic Z, Sver L, Basic I. Effects of local administra-
tion of propolis and its polyphenolic compounds on tumor formation
and growth. Biological & Pharmaceutical Bulletin 2005;28:1928–33.
PergolaC,RossiA,DugoP,CuzzocreaS,SautebinL.Inhibitionofnitricoxide
biosynthesis by anthocyanin fraction of blackberry extract. Nitric
Oxide 2006;15:30–9.
Petros A, Bennett D, valance P. Effect of nitric oxide synthase inhibitors on
hypotension in patients with septic shock. Lancet 1991;338:1557–8.
Picot D, Loll PJ, Garavito RM. The X-ray crystal structure of the membrane
protein prostaglandin H2 synthase-1. Nature 1994;367:243–9.
Renard P, Raes M. The proinflammatory transcription factor NF-?B: a
potential target for novel therapeutical strategies. Cell Biology and
Toxicology 1999;15:341–4.
Smith WL, Garavito RM, Dewitt DL. Prostaglandin endoperoxide H syn-
thases (cyclooxygenase)-1 and -2. The Journal of Biological Chemistry
1996;271:33157–60.
Stoclet JC, Muller B, Andriantsitohaina R, Kleschyov A. Overproduction
of nitric oxide in pathophysiology of blood vessels. Biochemistry
1998;63:826–32.
Suh SJ, Chung TW, Son MJ, Kim SH, Moon TC, Son KH, Kim HP, et al. The
naturally occurring biflavonoid, ochnaflavone, inhibits LPS-induced
iNOS expression, which is mediated by ERK1/2 via NF-kappaB reg-
ulation, in RAW264.7 cells. Archives of Biochemistry and Biophysics
2006;447:136–46.
Surh YJ, Chun KS, Cha HH, Han SS, Keum YS, Park KK, et al.
Molecular mechanisms underlying chemopreventive activities of
anti-inflammatory phytochemicals: down-regulation of COX-2 and
iNOS through suppression of NF-?B activation. Mutation Research
2001;480–481:243–68.
Thiemermann C. Nitric oxide and septic shock. General Pharmacology
1997;29:159–66.
Tilg H, Wilmer A, Vogel W, Herold M, Nolchen B, Judmaier G, et al.
Serum levels of cytokines in chronic liver diseases. Gastroenterology
1992;103:264–74.
Tracey KJ, Cerami A. Studies of cachexia in parasitic infection. Annals of
the New York Academy of Sciences 1989;569:211–8.
Won JH, Im HT, Kim YH, Yun KJ, Park HJ, Choi JW, et al. Anti-inflammatory
effect of buddlejasaponin IV through the inhibition of iNOS and COX-2
expressioninRAW264.7macrophagesviatheNF-kappaBinactivation.
British Journal of Pharmacology 2006;148:216–25.
Xie QW, Kashiwabara Y, Nathan C. Role of transcription factor NF-kappa
B/Rel in induction of nitric oxide synthase. The Journal of Biological
Chemistry 1994;269:4705–8.
Zhang FX, Kirschning CJ, Mancinelli R, Xu XP, Jin Y, Faure E, et al.
Bacterial lipopolysaccharide activates nuclear factor-kappaB through
interleukin-1signalingmediatorsinculturedhumandermalendothe-
lial cells and mononuclear phagocytes. The Journal of Biological
Chemistry 1999;274:7611–4.