Differential expression of GADD45β in normal and osteoarthritic cartilage: Potential role in homeostasis of articular chondrocytes

Hospital for Special Surgery, New York, New York, United States
Arthritis & Rheumatology (Impact Factor: 7.76). 07/2008; 58(7):2075-87. DOI: 10.1002/art.23504
Source: PubMed


Our previous study suggested that growth arrest and DNA damage–inducible protein 45β (GADD45β) prolonged the survival of hypertrophic chondrocytes in the developing mouse embryo. This study was undertaken, therefore, to investigate whether GADD45β plays a role in adult articular cartilage.
Gene expression profiles of cartilage from patients with late-stage osteoarthritis (OA) were compared with those from patients with early OA and normal controls in 2 separate microarray analyses. Histologic features of cartilage were graded using the Mankin scale, and GADD45β was localized by immunohistochemistry. Human chondrocytes were transduced with small interfering RNA (siRNA)–GADD45β or GADD45β-FLAG. GADD45β and COL2A1 messenger RNA (mRNA) levels were analyzed by real-time reverse transcriptase–polymerase chain reaction, and promoter activities were analyzed by transient transfection. Cell death was detected by Hoechst 33342 staining of condensed chromatin.
GADD45β was expressed at higher levels in cartilage from normal donors and patients with early OA than in cartilage from patients with late-stage OA. All chondrocyte nuclei in normal cartilage immunostained for GADD45β. In early OA cartilage, GADD45β was distributed variably in chondrocyte clusters, in middle and deep zone cells, and in osteophytes. In contrast, COL2A1, other collagen genes, and factors associated with skeletal development were up-regulated in late OA, compared with early OA or normal cartilage. In overexpression and knockdown experiments, GADD45β down-regulated COL2A1 mRNA and promoter activity. NF-κB overexpression increased GADD45β promoter activity, and siRNA-GADD45β decreased cell survival per se and enhanced tumor necrosis factor α–induced cell death in human articular chondrocytes.
These observations suggest that GADD45β might play an important role in regulating chondrocyte homeostasis by modulating collagen gene expression and promoting cell survival in normal adult cartilage and in early OA.

Download full-text


Available from: Luiz Fernando Zerbini, May 16, 2014
28 Reads
  • Source
    • "During the more advanced stages of OA, the fibrocartilaginous cartilage contains collagens, such as type I and type III [43–45], while we find the amount of collagen type II decreases as seen by quantitative immunohistochemistry [44]. In contrast, microarray investigations demonstrate an overall increased anabolism and an up-regulation of mRNAs also of cartilage-specific collagens [46, 47]. In any case, the altered matrix composition seems to be one reason for the long-term failure of the repair tissue to initiate a restitutio ad integrim. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The most common diseases of the joints and its tissues are osteoarthritis and rheumatoid arthritis, with osteoarthritis being anticipated to be the fourth leading cause of disability by the year 2020. To date, no truly causal therapies are available, and this has promoted tissue engineering attempts mainly involving mesenchymal stem cells. The goal of all tissue repairs would be to restore a fully functional tissue, here a hyaline articular cartilage. The hyaline cartilage is the most affected in osteoarthritis, where altered cell-matrix interactions gradually destroy tissue integrity. In rheumatoid arthritis, the inflammatory aspect is more important, and the cartilage tissue is destroyed by the invasion of tumor-like pannus tissue arising from the inflamed synovia. Furthermore, the fibrocartilage of the meniscus is clearly involved in the initiation of osteoarthritis, especially after trauma. Recent investigations have highlighted the role of migratory progenitor cells found in diseased tissues in situ. In osteoarthritis and rheumatoid arthritis, these chondrogenic progenitor cells are involved in regeneration efforts that are largely unsuccessful in diseased cartilage tissue. However, these progenitor cells are interesting targets for a cell-based regenerative therapy for joint diseases.
    Current Rheumatology Reports 11/2014; 16(11):461. DOI:10.1007/s11926-014-0461-4 · 2.87 Impact Factor
  • Source
    • "Total cellular RNA was isolated from pellet cultures of human OA chondrocytes and submitted to qRT-PCR as previously described [40], [67]. PCR primer pairs for the following human genes were used: GAPDH (NM_002046, forward 579–598: TGGTATCGTGGAAGGACTCA and reverse 701–683: GCAGGGATGATGTTCTGGA); TIMP3 (NM_000362.4 forward 1193–1211: CCTTGGCTCGGGCTCATC and reverse 1313–1333: GGATCACGATGTCGGAGTTG) and MMP10 (NM_002425.2, forward 1278–1298: GCCAGTCCATGGAGCAAGGCT; and reverse 1472–1449: TCGCCTAGCAATGTAACCAGCTGT). Annealing temperatures were 58°C for GAPDH and MMP10 and 60°C for TIMP3; mRNA expression levels were normalized to the expression of GAPDH, as previously described [21], [40], [74]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The non-canonical NF-κB activating kinase IKKα, encoded by CHUK (conserved-helix-loop-helix-ubiquitous-kinase), has been reported to modulate pro- or anti- inflammatory responses, cellular survival and cellular differentiation. Here, we have investigated the mechanism of action of IKKα as a novel effector of human and murine chondrocyte extracellular matrix (ECM) homeostasis and differentiation towards hypertrophy. IKKα expression was ablated in primary human osteoarthritic (OA) chondrocytes and in immature murine articular chondrocytes (iMACs) derived from IKKα(f/f):CreERT2 mice by retroviral-mediated stable shRNA transduction and Cre recombinase-dependent Lox P site recombination, respectively. MMP-10 was identified as a major target of IKKα in chondrocytes by mRNA profiling, quantitative RT-PCR analysis, immunohistochemistry and immunoblotting. ECM integrity, as assessed by type II collagen (COL2) deposition and the lack of MMP-dependent COL2 degradation products, was enhanced by IKKα ablation in mice. MMP-13 and total collagenase activities were significantly reduced, while TIMP-3 (tissue inhibitor of metalloproteinase-3) protein levels were enhanced in IKKα-deficient chondrocytes. IKKα deficiency suppressed chondrocyte differentiation, as shown by the quantitative inhibition of.Alizarin red staining and the reduced expression of multiple chondrocyte differentiation effectors, including Runx2, Col10a1 and Vegfa,. Importantly, the differentiation of IKKα-deficient chondrocytes was rescued by a kinase-dead IKKα protein mutant. IKKα acts independent of its kinase activity to help drive chondrocyte differentiation towards a hypertrophic-like state. IKKα positively modulates ECM remodeling via multiple downstream targets (including MMP-10 and TIMP-3 at the mRNA and post-transcriptional levels, respectively) to maintain maximal MMP-13 activity, which is required for ECM remodeling leading to chondrocyte differentiation. Chondrocytes are the unique cell component in articular cartilage, which are quiescent and maintain ECM integrity during tissue homeostasis. In OA, chondrocytes reacquire the capacity to proliferate and differentiate and their activation results in pronounced cartilage degeneration. Τηυσ, our findings are also of potential relevance for defining the onset and/or progression of OA disease.
    PLoS ONE 09/2013; 8(9):e73024. DOI:10.1371/journal.pone.0073024 · 3.23 Impact Factor
  • Source
    • "For example, studies found that COL13 was increased in OA articular cartilage and that transgenic mice overexpressing COL13 had abnormally high bone mineral density [35, 36]. The expression of ENPP1 and ANKH was elevated in OA meniscal cells, menisci, or articular cartilage [4, 34, 37]. SMAD1 induced terminal differentiation of chondrocytes and promoted calcification [38]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Phosphocitrate (PC) inhibited meniscal calcification and the development of calcium crystal-associated osteoarthritis (OA) in Hartley guinea pigs. However, the mechanisms remain elusive. This study sought to examine the biological activities of PC in the absence of calcium crystals and test the hypothesis that PC is potentially a meniscal protective agent. We found that PC downregulated the expression of many genes classified in cell proliferation, ossification, prostaglandin metabolic process, and wound healing, including bloom syndrome RecQ helicase-like, cell division cycle 7 homolog, cell division cycle 25 homolog C, ankylosis progressive homolog, prostaglandin-endoperoxide synthases-1/cyclooxygenase-1, and plasminogen activator urokinase receptor. In contrast, PC stimulated the expression of many genes classified in fibroblast growth factor receptor signaling pathway, collagen fibril organization, and extracellular structure organization, including fibroblast growth factor 7, collagen type I, alpha 1, and collagen type XI, alpha 1. Consistent with its effect on the expression of genes classified in cell proliferation, collagen fibril organization, and ossification, PC inhibited the proliferation of OA meniscal cells and meniscal cell-mediated calcification while stimulating the production of collagens. These findings indicate that PC is potentially a meniscal-protective agent and a disease-modifying drug for arthritis associated with severe meniscal degeneration.
    07/2013; 2013(8):726581. DOI:10.1155/2013/726581
Show more