Regulation of cysteinyl leukotriene receptor 2 expression--a potential anti-tumor mechanism.

Abstract

The cysteinyl leukotrienes receptors (CysLTRs) are implicated in many different pathological conditions, such as inflammation and cancer. We have previously shown that colon cancer patients with high CysLT(1)R and low CysLT(2)R expression demonstrate poor prognosis. Therefore, we wanted to investigate ways for the transcriptional regulation of CysLT(2)R, which still remains to be poorly understood.
We investigated the potential role of the anti-tumorigenic interferon α (IFN-α) and the mitogenic epidermal growth factor (EGF) on CysLT(2)R regulation using non-transformed intestinal epithelial cell lines and colon cancer cells to elucidate the effects on the CysLT(2)R expression and regulation. This was done using Western blot, qPCR, luciferase reporter assay and a colon cancer patient array. We found a binding site for the transcription factor IRF-7 in the putative promoter region of CysLT(2)R. This site was involved in the IFN-α induced activity of the CysLT(2)R luciferase reporter assay. In addition, IFN-α induced the activity of the differentiation marker alkaline phosphatase along with the expression of mucin-2, which protects the epithelial layer from damage. Interestingly, EGF suppressed both the expression and promoter activity of the CysLT(2)R. E-boxes present in the CysLT(2)R putative promoter region were involved in the suppressing effect. CysLT(2)R signaling was able to suppress cell migration that was induced by EGF signaling.
The patient array showed that aggressive tumors generally expressed less IFN-α receptor and more EGFR. Interestingly, there was a negative correlation between CysLT(2)R and EGFR expression. Our data strengthens the idea that there is a protective role against tumor progression for CysLT(2)R and that it highlights new possibilities to regulate the CysLT(2)R.

Full text

Page 1

Regulation of Cysteinyl Leukotriene Receptor 2
Expression—A Potential Anti-Tumor Mechanism
Cecilia Magnusson1, Astrid M. Bengtsson1, Minghui Liu1, Jian Liu1, Yvonne Ceder3, Roy Ehrnstro ¨m2,
Anita Sjo ¨lander1*
1Cell and Experimental Pathology, Department of Laboratory Medicine, Lund University, Ska ˚nes University Hospital, Malmo ¨, Sweden, 2Pathology, Department of
Laboratory Medicine, Lund University, Ska ˚nes University Hospital, Malmo ¨, Sweden, 3Clinical Chemistry, Department of Laboratory Medicine, Lund University, Ska ˚nes
University Hospital, Malmo ¨, Sweden
Abstract
Background: The cysteinyl leukotrienes receptors (CysLTRs) are implicated in many different pathological conditions, such
as inflammation and cancer. We have previously shown that colon cancer patients with high CysLT1R and low CysLT2R
expression demonstrate poor prognosis. Therefore, we wanted to investigate ways for the transcriptional regulation of
CysLT2R, which still remains to be poorly understood.
Methodology/Principal Findings: We investigated the potential role of the anti-tumorigenic interferon a (IFN-a) and the
mitogenic epidermal growth factor (EGF) on CysLT2R regulation using non-transformed intestinal epithelial cell lines and
colon cancer cells to elucidate the effects on the CysLT2R expression and regulation. This was done using Western blot,
qPCR, luciferase reporter assay and a colon cancer patient array. We found a binding site for the transcription factor IRF-7 in
the putative promoter region of CysLT2R. This site was involved in the IFN-a induced activity of the CysLT2R luciferase
reporter assay. In addition, IFN-a induced the activity of the differentiation marker alkaline phosphatase along with the
expression of mucin-2, which protects the epithelial layer from damage. Interestingly, EGF suppressed both the expression
and promoter activity of the CysLT2R. E-boxes present in the CysLT2R putative promoter region were involved in the
suppressing effect. CysLT2R signaling was able to suppress cell migration that was induced by EGF signaling.
Conclusions/Significance: The patient array showed that aggressive tumors generally expressed less IFN-a receptor and
more EGFR. Interestingly, there was a negative correlation between CysLT2R and EGFR expression. Our data strengthens the
idea that there is a protective role against tumor progression for CysLT2R and that it highlights new possibilities to regulate
the CysLT2R.
Citation: Magnusson C, Bengtsson AM, Liu M, Liu J, Ceder Y, et al. (2011) Regulation of Cysteinyl Leukotriene Receptor 2 Expression—A Potential Anti-Tumor
Mechanism. PLoS ONE 6(12): e29060. doi:10.1371/journal.pone.0029060
Editor: Patricia T. Bozza, Fundac ¸a ˜o Oswaldo Cruz, Brazil
Received June 14, 2011; Accepted November 20, 2011; Published December 15, 2011
Copyright: ? 2011 Magnusson et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants for AS from the Swedish Cancer Foundation (www.cancerfonden.se), the Swedish Medical Research Council (www.
vr.se), the Foundations at Skanes University Hospital, Gunnar Nilsson Foundation (www.cancerstiftelsen.com), the O¨sterlund Foundation (www.medmicro.se/
stiftelse.htm), and for CM and AMB from the Royal Physiographic Society in Lund (www.fysiografen.se). The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: anita.sjolander@med.lu.se
Introduction
Prolonged inflammation is known to increase the risk of
developing cancer [1,2]. It has been estimated that 15% of all
cancers can be accredited to infectious agents [3]. Tumor
microenvironment has often been associated with infiltrating
leukocytes in the tumor tissue and the surrounding stroma [4].
Moreover, patients with ulcerative colitis display a 30 to 50%
increased risk of developing colon cancer [5]. Elevated levels of
inflammatory mediators, such as the cysteinyl leukotrienes
(cysLTs), have been found in these patients [6]. CysLTs is the
collective name for LTC4, LTD4 and LTE4. They are lipid
mediators derived from arachidonic acid through the 5-lipoox-
ygenase (5-LO) pathway [7]. In addition to inflammatory bowel
disease (IBD) [7], they have been implicated in the pathogenesis of
several chronic inflammatory diseases, such as asthma, pulmonary
fibrosis, and atherosclerosis [8,9]. The known biological effects of
cysLTs are mediated through two different G-protein coupled
receptors (GPCRs): CysLT1R [10], which is the high affinity
receptor for LTD4and CysLT2R [11], which is the high affinity
receptor for LTC4. Recently, an orphan GPCR denoted as
GPR17 was found to be an additional receptor for cysLTs. GPR17
can also be activated by uracil nucleotides [12]. There is a 38%
sequence similarity between CysLT1R and CysLT2R and they are
both able to induce calcium release upon activation [13,14].
However, they do not appear to be functionally interchangeable
and they might even antagonize each other’s actions. For example,
CysLT2R has been found to inhibit CysLT1R-induced prolifera-
tion in mast cells [15]. Colon tumors generally have an increased
expression of CysLT1R [16] and a decreased expression of
CysLT2R [17]. It has also been observed that colon cancer
patients with high expression levels of CysLT1R have poor
prognosis. Similar results are also seen in patients with breast
cancer [18]. CysLT2R has, on the other hand, been implicated in
PLoS ONE | www.plosone.org1 December 2011 | Volume 6 | Issue 12 | e29060

Page 2

the differentiation of Caco-2 cells [17] and is involved in vascular
permeability [19]. This indicates that CysLT2R has a more
protective role in cancer development while CysLT1R favors
tumor progression.
Interferons (IFNs) are part of our defense system against viruses,
bacteria, parasites, and malignant cells [20]. Both type I (for
example IFN-a and IFN-b), and type II (IFN-c) IFNs are
produced during the early innate immune response. However,
while IFN-c is secreted mainly by natural killer cells and T-cells,
the type I IFNs are produced by most cell types following virus
infection or toll-like receptor activation [21]. IFN activation results
in the increased activity of the transcription factor interferon
regulatory factor 7 (IRF-7), which is involved in a positive
feedback loop to augment a larger induction of IFN-a and IFN-b
genes [22]. Even though both types of IFNs have been implicated
to have anti-carcinogenic effects, the type I IFNs exhibit stronger
anti-proliferative and anti-angiogenic effects and have been
proposed to have apoptotic effects on cancer cells [23,24]. In a
mouse model, the type I IFNs have also been implicated to have
anti-inflammatory functions in colitis [25]. In addition, they have
demonstrated some effectiveness in the treatment of IBD patients
[26]. We located a predicted IRF-7 binding site in the putative
promoter region of the CysLT2R, which suggests that the CysLT2R
promoter might be regulated by the IFN-a. This is interesting
given that the anti-proliferative and anti-tumorigenic effects
attributed to the IFN-a are consistent with the observed
characteristics of the CysLT2R function [17]. IFN-c has previously
been reported to increase the expression of CysLT2R mRNA and
protein in eosinophils [27]. In addition it enhances the cysLT-
induced inflammatory response of primary endothelial cells [28].
Epidermal growth factor (EGF) signaling via the EGFR is a
known inducer of cell proliferation and tumor cell invasion
[29,30]. Examining the putative promoter region for the
CysLT2R, we located four conserved E-box elements (consensus
sequence CANNTG). EGF signaling has been seen to induce
transcriptional repression through E-boxes [31].
In this study, we found novel regulation factors for the CysLT2R.
The anti-tumorigenic cytokine IFN-a is able to increase the
transcription of the CysLT2R while EGF, a known inducer of cell
proliferation and migration, suppresses the CysLT2R expression.
This is consistent with the proposed anti-tumorigenic role for
CysLT2R in colon cancer.
Materials and Methods
Chemicals
The rabbit polyclonal anti-human CysLT2R antibody (diluted
1:1000) was purchased from Innovagen (Lund, Sweden). The
ligand LTC4and Montelukast were from Cayman Chemicals Co.
(Ann Arbor, MI). The mouse anti-actin (diluted 1:2000) and goat
anti-IFNa/bR1 antibodies (diluted 1:100, immunohistochemistry)
were purchased from Sigma Chemicals Co. (St. Louis). The
IFNaR1 antibody (diluted 1:1000) was from Novus Biologicals
(Litteleton, CO). The EGFR (diluted 1:10, immunohistochemistry)
was purchased from Zymed Laboratories Inc. (San Francisco,
CA). EGFR (diluted 1:800, Western blot) while the pEGFR
(diluted 1:1000) antibodies were from BD Transduction Labora-
tories (Erembodegem, Belgium). The total Snal 1 antibody (diluted
1:500) was from Proteintech Group Inc. (Chicago, IL) and the
pSnail antibody (diluted 1:500) was from AbCam (Cambridge,
UK). The secondary peroxidase linked goat anti-rabbit and anti-
mouse antibodies (diluted 1:5000) were from Dako (Glostrup,
Denmark). Methyl-3H-thymidine, the enhanced chemilumines-
cence (ECL) reagents and the Western blot detection reagents as
well as the hyperfilm were from Amersham International
(Buckinghamshire, UK). TaqMan primers and master mix for
real-time PCR were purchased from Applied Biosystems (Cam-
bridge, UK). The RNeasy Plus Mini kit was from Qiagen GmbH
(Hilden, Germany). Unless otherwise stated, all other reagents
were of analytical grade and purchased from Sigma Chemicals
Co. (St. Louis, MO) or from ICN (Temecula, CA).
Cell Culture
The non-transformed human intestinal epithelial cell line (Int
407) [32], which exhibits typical epithelial morphology and
growth, was cultured as a monolayer for approximately five days
in Eagle’s basal medium supplemented with 15% newborn calf
serum. The two colon cancer cell lines, Caco-2 (DSMZ No: ACC
169) and SW 480 (DSMZ No: ACC 313), were respectively grown
in Dulbecco’s modified Eagle medium and RPMI 1640 supple-
mented with 10% and 20% fetal bovine serum respectively. All
media was supplemented with 2 mM L-glutamine, 55 IU/mL
penicillin and 55 mg/mL streptomycin. The cell lines were
cultured at 37uC in a humidified atmosphere with 5% CO2.
The cells were regularly tested to ensure the absence of
mycoplasma contamination.
Cell Lysates
Cells were washed, scraped with ice-cold 16PBS, and
centrifuged for 5 min at 1000 g. The cell pellets were lysed with
lysis buffer [33] for 30 min on ice, homogenized 10 times with a
20G needle, and centrifuged for 5 min at 500 g.
Gel Electrophoresis and Immunoblotting
To ensure equal loading, all samples were evaluated and
compensated for protein concentration using the Coomassie blue
protein assay. Proteins were denatured by boiling in sample buffer
for 5 min [34]. The samples were subjected to electrophoresis on
8% or 10% polyacrylamide gels in the presence of 10% SDS. The
immunoblotting and developing were performed as described in
Nielsen et al. [34].
Real-Time PCR Analysis
Cells were washed in PBS and immediately frozen at 280uC.
Thereafter, they were scraped in lysis buffer provided in the kit
and homogenized 10 times with a 20G needle. RNA was purified
on RNeasy MinElute Spin Columns and dissolved in RNase free
H2O. cDNA synthesis was performed using RevertAid H Minus
M-MuLV reverse transcriptase (Fermentas Life Sciences). The
mRNA expression levels of CysLT2R, CysLT1R, mucin-2 and the
endogenous housekeeping gene, hypoxanthine phosphoribosyl-
transferase 1 (HPRT-1), were quantified using real-time PCR
analysis (TaqMan Chemistry). cDNA was mixed with 0.9 mM
TaqMan primers and master mix and amplified at 60uC in an
Mx3005P thermocycler (Stratagene). The following primers were
used: CysLT2R (Hs00252658_s1), CysLT1R (Hs00929113_m1),
mucin-2 (Hs00159374_m1), and HPRT-1 (Hs99999909_m1). The
samples were analyzed and normalized against HPRT-1 using the
MxPro software (Stratagene).
Plasmid Constructs
Human CysLT2R promoter fragments were subcloned into a
pGL3-enhancer vector (Promega) containing a luciferase reporter
gene. To produce construct I, one thousand base pairs upstream of
the transcription start site of the CysLT2R gene were amplified
from genomic DNA extracted from the human Int 407 cell line by
nested PCR. The following primers were used in the process:
Regulation of Cysteinyl Leukotriene Receptor 2
PLoS ONE | www.plosone.org2 December 2011 | Volume 6 | Issue 12 | e29060

Page 3

forward 59-ACATCAGGCAGCATTAATGT-39and reverse 59-
GGACATAAATTTTCTCTCCAT-39, followed. This was fol-
lowed by a PCR that use the following primers; forward 59-
TTATGAGCTCGTTTCAAAACATTAAATG TAAC-39 and
reverse59-TTCTAAGCTTGCTGGGTTAAAAAGAAAC-39.
All PCR products were gel purified using the QIAquick gel
extraction kit (Qiagen). They were digested with restriction
enzymes and ligated into the pGL3-enhancer reporter vector
using the Quick ligation kit (New England BioLabs). The plasmids
were transformed into SoloPack Gold super competent cells
(Stratagene). To produce the clone with the deleted IRF-7 binding
site (construct II), the site directed mutagenesis with the following
primerswereused: forward
CAAAAATTATGAAATGTAATGCAGCATGT-39 and reverse
59-ACATGCTGCATTACATTTCATAATTTTTGAATGTA-
GAATAGCCAT-39. The Quickchange XL kit (Stratagene) was
used according to standard protocol. Three deletion constructs
were produced by digesting construct I with restriction enzymes.
Construct III was digested with SacI and SpeI to produce a
construct from 21 to 2412. Construct IV was digested with
HindIII and SpeI to remove the downstream part of the promoter,
thereby creating a construct between sites 21012 and 2413 of the
CysLT2R promoter. Blunt end digestion was performed using T4
DNA polymerase (Promega) and the vector was ligated back
together. The promoter construct V was digested with SacI and
SmiI to give a construct from 21 to 2187. All plasmids were
extracted using Endofree plasmid maxi kit (Qiagen) and were
sequenced accordingly.
59-ATGGCTATTCTACATT-
Transient Transfections and Measurement of Luciferase
Activity
Transient transfections of Int 407 cells were carried out using
Lipofectamine LTX and Plus Reagent (Invitrogen) in serum free
medium according to the manufacturer’s instructions. The final
DNA concentration used for transfections was 1 mg/ml for all
plasmids except for the luciferase transfection control vector Renilla
(0.2 mg/ml). The transfections were carried out for 4–6 h in 37uC,
after which the medium was changed to 15% serum containing
the medium. Forty-eight hours after transfection, the cells were
stimulated with IFN-a (500–2000 U/ml) or EGF (100 ng/ml) in
serum free medium for 24 h. The cells were lysed with passive lysis
buffer (Promega) and stored in 280uC. Thawed lysates were
centrifuged for 5 min at 1000 g and analyzed using the Dual
Luciferase Reporter Assay System from Promega, following the
manufacturer’s instructions.
Electromobility Shift Assay (EMSA)
Nuclear extracts were prepared from Int 407 cell treated with
IFN-a 1000 U/ml or EGF 100 ng/ml for 24 h using the Nuclear
Extraction Kit (Chemicon International). The process was per-
formed according to the manufacturers’ instructions. In additional,
10 mM 1-Naphthyl phosphate monosodium salt monohydrate, a
broad phosphatase inhibitor, (Sigma Aldrich) was added into both
cytoplasmic and nuclear lysis buffer before use. Biotin 39 end-
labeled single-stranded oligonucleotide corresponding to the IRF-7
binding region of CysLT2R putative promoter (sense: 59-AAT CAG
GAA ATT TAA ATT TAT TAT-39 and antisense: 59-ATA ATA
AAT TTA AAT TTC CTG ATT-39) or E-box binding site (sense:
59-TTC TTT CAG CAT TTG AGA AAT GTG-39 and antisense
59-CAC ATT TCT CAA ATG CTG AAA GAA-39) were
purchased from TAG Copenhagen A/S. DNA probes were then
annealed in buffer containing 10 mM Tris, 1 mM EDTA, and
50 mM NaCl (pH 8.0) by incubating the oligonucleotides at 95uC
for 5 min then gradually reducing the heat until the DNA reached
room temperature. Binding reactions for EMSA were prepared
using the LightShift Chemiluminescent EMSA kit (Pierce Thermo
Scientific). The binding buffer for IRF-7 contained 10 mM Tris-
HCl (pH 7.5), 1 mM EDTA, 50 mM NaCl, 2 mM dithiothreitol,
5% glycerol, 0.5% NP-40, and 10 mg/ml BSA. To reduce
nonspecific binding, 62.5 mg of poly(dI-dC) was added per ml.
Each reaction contains 20 mg nuclear extract. After 20 min of
incubation with the probe at room temperature, extracts were
loaded on a 5% polyacrylamide gel. After 1 h at 100 V, the gel was
transferred onto a positive charged Nylon Membrane, (Thermo
scientific) and detected according to kit instruction. The binding
buffer for E-box contained 20 mM HEPES, pH 7.6, 150 mM KCl,
3 mMMgCl2,10%glycerol,0.2 mMZnSO4,0.3 mg/mlBSA)and
1 mg/20 mL of poly(dI:dC). The binding reaction was performed on
ice for 30 min before being loaded onto the gel. To demonstrate the
specificity of protein-DNA complex formation, a 1,000-fold molar
excess of unlabeled oligonucleotides or IRF-7 (G-8) antibody (Santa
Cruz) or SNAI 1 (E-18) antibody (Santa Cruz) was added to the
binding reaction mixtures before the probe.
Alkaline Phosphatase Activity
The assay was performed as previously described [35]. Briefly,
alkaline phosphatase activity was measured using disodium p-
nitrophenyl phosphate as substrate. Caco-2 cells were seeded in
Petri dishes and incubated for 24 h at 37uC. Five hundred to
2000 U/ml of IFN-a and/or 40 nM of LTC4was added to the
cells and subsequently incubated for 72 h at 37uC. New LTC4
was added every 24 h. Sodium butyrate (2 mM) was used as a
positive control (data not shown). The alkaline phosphatase
activity was estimated by measuring the level of p-nitrophenol at
405 nm.
Thymidine Incorporation Assay
Caco-2 cells were grown in flat-bottomed 96 well plates for five
days. The medium was changed to serum-free 2 h prior to
stimulation. Cells were stimulated with LTC4 (40 nM), IFN-a
(1000 U/ml) or EGF (100 ng/ml) for 48 h. DNA synthesis was
assessed by adding 0.5 mCi of [3H] thymidine during the final 18 h
of stimulation. The wells were washed once with PBS and
incubated with 0.05% trypsin-EDTA solution/well for 5 min at
37uC. Cells were harvested and collected on a filter paper in a
Perkin Elmer harvester. The filter paper was dried and [3H]
thymidine incorporation was measured in a 1450 Microbeta
Trilux liquid scintillation counter (Wallac).
Cell Migration Assay
Cell migration was analyzed in a modified Boyden chamber,
which consisted of two chambers separated by a polycarbonate
PVDF membrane (pore size of 8 mm) that was covered with a
collagen I gel (3 mg/ml). Int 407 cells were grown for 18 h in the
presence or absence of LTC4(40 nM) and/or EGF (100 ng/ml) in
medium containing 1.5% serum. Fifteen percent serum was used
as a positive control. Cells were added to the upper well and
allowed to migrate into the chamber for 18 h at 37uC. The
migrated cells were fixed in 4% paraformaldehyde and the
membranes were stained with a 1% crystal violet/10% in a
methanol solution. The membranes were washed in PBS and the
remaining dye was removed with 10% SDS. The absorbance was
measured at 590 nm.
Patient Samples
Archival formalin fixed and paraffin embedded colon cancer
and control colon specimens of colorectal cancer patients
Regulation of Cysteinyl Leukotriene Receptor 2
PLoS ONE | www.plosone.org3December 2011 | Volume 6 | Issue 12 | e29060

Page 4

collected in 1990 were obtained from the biobanks of Malmo ¨
University Hospital. Tissues from 78 patients with varying grades
and stages of the disease were included. Grading of the tumors
was performed using Dukes’ classification [36]. The matched
control samples of normal colon tissue in this investigation were
taken from the borders of the surgical specimens.
Ethics Statement
This study was performed after ethical permission from the
Regional Ethical Review Board, Lund University # 367/2005.
Archival tissue specimens from 78 colon cancer patients that were
operated between 1990 and 1991 were used in the present study.
Since the samples were old and taken from different parts of the
region, it was not possible to obtain written consent from each
patient. Detailed information describing the study and tissue
microarray (TMA) construction was published in 2006 in a daily
newspaper and patients were offered to contact us by mail or by
phone if they had any objections. None of the 78 patients objected.
This procedure was performed following strict guidelines from the
Regional Ethical Review Board in Lund who approved the
procedure.
Tissue Arrays and Immunohistochemistry
For histological assessment, the archival paraffin-embedded
colorectal cancer and normal mucosa specimens were used and
prepared as previously described [16]. The array was stained with
anti-IFNa/bR1, EGFR and CysLT2R antibodies. Secondary
peroxidase antibodies used were from Dako. After immunostain-
ing, all slides were counterstained with Mayer’s hematoxylin.
Statistical Analyses
Statistical significance was determined as P,0.05 by two-tailed
Student’s t test or one-way ANOVA. Pearson’s correlation test was
used when comparing different sets of immunohistochemistry
staining. SPSS software 16,0 (SPSS, Inc.) was used for the patient
material analysis.
Results
An IRF-7 Binding Site and Four E-boxes Have Been Found
to be Present in the CysLT2R Promoter Region
To increase the understanding of the role of cysteinyl
leukotrienes in inflammation-induced colorectal carcinogenesis,
we examined possible ways by which the expression of CysLT2R
can be regulated, with one of the receptors generating the effects
of leukotrienes. The promoter region of CysLT2R contains
several interesting binding sites for known transcription factors
and transcriptional repressors. Previous reports from our
laboratory have shown that CysLT2R is down regulated in colon
cancer [17,37] and that it is involved in colon cancer cell
differentiation [17] as well as in decreased cell migration in breast
cancer cells [18]. Therefore, it was of particular interest that a
putative binding element for IRF-7 and four E-box elements were
present in the promoter region of the CysLT2R. Five constructs
of the CysLT2R promoter region were created and ligated into a
pGL3-enhancer reporter vector to evaluate the importance of
IRF-7 and the E-boxes for activation/transcription of CysLT2R
(Fig. 1A). IFN-a can be used to activate the transcription factor
IRF-7. However, the presence of the IFN-a receptor IFN-aR1 is
needed to do this. The presence of the IFN-aR1 is confirmed in
the intestinal cell lines intended for this study (Fig. 1B). Likewise,
the expression of the EGFR (Fig. 1C) and the CysLT2R (Fig. 1D)
was verified.
CysLT2R Promoter Activity is Activated by the IFN-a via an
IRF-7 Binding Site and It is Repressed by the EGF Through
the E-boxes Present in the Putative Promoter Region
We have seen that CysLT2R expressions were altered in
patient’s tumor material, which might be due to a changed
‘‘microenvironment around the tumor’’. Therefore, we decided
to search for a Th1 regulatory cytokine motif in the promoter
region of the CysLT2R. The presence of a putative IRF-7 binding
site in the CysLT2R promoter region indicated that the Th1 pro-
inflammatory cytokine IFN-a ought to induce CysLT2R promoter
activity and transcription of the CysLT2R encoding gene. A
dilution series with IFN-a showed that 1000 U/ml IFN-a
generated an optimal activation of CysLT2R (Fig. 2A). To
elucidate whether IFN-a induces the CysLT2R through IRF-7
binding to its putative binding site in the promoter region, the
promoter activity for deletion mutant constructs I-V were tested
(Fig. 2B). IFN-a induced a significant two-fold activation of the
CysLT2R in the non-transformed cell line Int 407 (construct I).
This activation was partly reduced in the DIRF-7 mutant
(construct II). IFN-a was unable to induce the CysLT2R promoter
activity in constructs IV and V, which both lacked full-length
IRF-7 response elements. However, a significant reduction in
activation compared to wild-type construct I was also observed
for construct III, which contains an intact IRF-7 response
element but lacks the part upstream of bp 2412. Taken together,
this indicates that the IFN-a-induced activation of the CysLT2R
requires the IRF-7 binding site for complete activation, but also
needs additional unidentified binding elements located up-stream
of the IRF-7 site for full activation.
Further examination of the CysLT2R promoter sequence
revealed the presence of four conserved E-box elements. EGF
signaling can induce repressor elements that bind to mentioned
sequences. Four of the CysLT2R luciferase reporter constructs
were used to investigate the effects of EGF on the CysLT2R. We
found that EGF suppressed CysLT2R luciferase reporter activity
(Fig. 2C). The importance of the E-boxes was investigated by
testing the ability of the EGF to suppress CysLT2R promoter
activity in three deletion constructs, (construct III, with only E-
box 4 present, construct IV containing three E-boxes, and
construct V without any E-boxes). The EGF-induced reduction of
CysLT2R promoter activity significantly declined with a decreas-
ing number of E-boxes present in the putative promoter region.
There was a statistically significant difference between the EGF-
induced reductions of construct IV and construct V. However,
the reduction is probably mediated both through an E-box-
dependent as well as an E-box-independent pathway in the
intestinal cells.
Analysis of IRF-7 and E-box DNA binding activities on the
CysLT2R putative promoter region in Int 407 cells were performed
to compliment the luciferase experiments (Fig. 2D). The EMSA
results showed that IRF-7 containing complexes were detected in
both untreated and IFN-a treated cells. We found an increased
association upon the stimulation of the complexes. The addition of
cold probe and anti-IRF-7 antibody competed with IRF-7 in
binding the IRF-7 binding site on the promoter region. The
addition of cold probe could completely inhibit probe-protein
complex formation. Likewise, Snail-containing complexes were
detected in both untreated and EGF treated cells. We found
increased association upon stimulation of the complex. The
addition of cold probe could completely inhibit the formation of
probe-protein complex. Moreover, additional anti-Snail antibody
reduced the probe-protein complex formation.
Next, we wanted to see that the regulatory effects for IFN-a and
EGF observed in connection with CysLT2R luciferase reporter
Regulation of Cysteinyl Leukotriene Receptor 2
PLoS ONE | www.plosone.org4 December 2011 | Volume 6 | Issue 12 | e29060

Page 5

activity also affected CysLT2R mRNA and protein expression.
Consistent with the results from the gene activation assay, the IFN-
a significantly up-regulated both the CysLT2R mRNA (peaking at
12 h) and the protein (maximum increase at 24 h) (Fig. 2E). The
EGF induced a significant suppression of both the CysLT2R
mRNA and the protein expression (Fig. 2F).
EGFR and Snail Activation is Involved in EGF Repressing
CysLT2R
Stimulation with EGF leads to the activation of the EGFR
(Fig. 3A) and to the activation of Snail (Fig. 3B), a transcriptional
repressor known to bind to E-box elements. It is likely that the
EGF-induced suppression of the CysLT2R is generated by Snail
that binds to the E-box elements present in the promoter region of
the CysLT2R. Interestingly, an induction of CysLT1R mRNA is
observed after EGF treatment of intestinal cells at the same time as
CysLT2R mRNA is suppressed (Fig. 3C), indicating, as earlier
suggested, opposing effects of the CysLTRs [37].
IFN-a Can Induce Differentiation of Caco-2 Cells
Sodium butyrate is a known inducer of differentiation in Caco-2
cells [38], which is frequently used as a model system for
differentiation in cell culture [39]. The activation of different
luminal brush border proteins, such as alkaline phosphatase, can be
used as a measurement for epithelial cell differentiation. Previously,
we have shown that the CysLT2R ligand LTC4is able to induce
differentiation in Caco-2 cells [17]. IFN-a induced a small but
significant increase in the activation of alkaline phosphatase,
indicating increased differentiation of Caco-2 cells. IFN-a had,
however, no additive effect to the alkaline phosphatase activity
induced by LTC4 (Fig. 4A). To confirm the effect of alkaline
phosphatase activity, an additional differentiation assay was used.
Mucin-2 is a marker for intestinal cell differentiation [40]. Both
LTC4and IFN-a could significantly induce mucin-2 mRNA in
Caco-2 cells (Fig. 4B). The CysLT2R antagonist AP-100984 could
significantly block both LTC4induction of mucin-2, which was not
seen with the specific CysLT1R antagonist Montelukast. This
strengthens the hypothesis that CysLT2R might have a protective
role in colon cancer and in normal intestinal mucosa. We have
previouslyshownthatLTC4doesnotinduceproliferationinCaco-2
cells [17]. Here, we show that IFN-a does not induce a proliferative
response either. EGF, on the other hand, is a known mitogen
inducer [41] and was used here as a positive control (Fig. 4C). This
corresponds well to the previous reported roles of the CysLTRs.
We next investigated the effect of CysLT2R signaling on Int 407
cell migration. We found that LTC4-induced activation of
CysLT2R reduced Int 407 cell migration (Fig. 4D). Furthermore,
we also found that EGF-induced Int 407 cell migration could be
suppressed by CysLT2R activation (Fig. 4D).
EGFR Inversely Correlates with CysLT2R in Colorectal
Cancer
Next, we wanted to clarify if the levels of IFNa/bR1 and EGFR
correlated with the CysLT2R pattern in a colon cancer patient
array. The TMA contains material from 78 colon cancer patients
and has previously been thoroughly described [16]. Representative
stainings from the array for IFNa/bR1 and EGFR are shown in
Fig. 5A. We have previously shown that CysLT2R is down-
regulated in colon tumor tissue in patients from this array and that
more aggressive tumors expressed less of the CysLT2R [17]. We
observed that patients with more aggressive tumors generally had
less expression of IFNa/bR1 while patients with less aggressive
tumors generally exhibited a higher expression of IFNa/bR1. A
more distinct trend was visualized when the patients were divided
into subgroups with high (++, +++) or low (+/2, +) IFNa/bR1
staining. Duke’s A patients had a higher percentage of increased
IFNa/bR1 staining than Duke’s B and Duke’s C patients (Fig. 5B).
The expression of the EGFR was generally up-regulated in colon
cancer patients in this study, which is coherent with earlier
published studies [42] (Fig. 5C). Representative pictures from a
Figure 1. There is an IRF-7 binding site and four E-boxes
present in the CysLT2R putative promoter region. (A) Schematic
visualization of the CysLT2R promoter. Construct I contains the wildtype
promoter region (1012 bp) and constructs II–V are various deletion
constructs. Representative Western blots from three different experi-
ments with the intestinal epithelial cell line Int 407 and the colon cancer
cell lines Caco-2 and SW 480 were analyzed as follows. (B) The blot
shows the levels of IFNaR1, and A431 cells were used as a negative
control while HCT116 cells were used as a positive control. (C) The blot
shows the levels of EGFR protein expression, A431 cells were used as a
positive control and MCF7 cells were used as a negative control, and (D)
the blot shows the levels of CysLT2R protein expression.
doi:10.1371/journal.pone.0029060.g001
Regulation of Cysteinyl Leukotriene Receptor 2
PLoS ONE | www.plosone.org5 December 2011 | Volume 6 | Issue 12 | e29060