Rapid detection of newly isolated Tembusu-related Flavivirus by reverse-transcription loop-mediated isothermal amplification assay.

Abstract

From April 2010 to January 2011, a severe new viral disease had devastated most duck-farming regions in China. This disease affected not only laying ducks but also meat ducks, causing huge economic losses for the poultry industry. The objective of this study is to develop a one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of the new virus related to Tembusu-related Flavivirus.
The RT-LAMP assay is very simple and rapid, and the amplification can be completed within 50 min under isothermal conditions at 63°C by a set of 6 primers targeting the E gene based on the sequences analysis of the newly isolated viruses and other closely related Flavivirus.The monitoring of gene amplification can also be visualized by using SYBR green I fluorescent dye. In addition, the RT-LAMP assay for newly isolated Tembusu-related Flavivirus showed higher sensitivity with an RNA detection-limit of 2 copies/μL compared with 190 copies/μL of the conventional RT-PCR method. The specificity was identified without cross reaction to other common avian pathogens. By screening a panel of clinical samples this method was more feasible in clinical settings and there was higher positive coincidence rate than conventional RT-PCR and virus isolation.
The RT-LAMP assay for newly isolated Tembusu-related Flavivirus is a valuable tool for the rapid and real-time detection not only in well-equipped laboratories but also in general conditions.

Full text

Page 1

RESEARCHOpen Access
Rapid detection of newly isolated Tembusu-
related Flavivirus by reverse-transcription loop-
mediated isothermal amplification assay
Youling Wang1,2, Xiaoyuan Yuan2, Yufeng Li2, Kexiang Yu2, Jinxing Yang2, Huaiying Xu2, Yuxia Zhang2,
Kangzhen Yu3, Ming Liao1*and Zhuoming Qin2*
Abstract
Background: From April 2010 to January 2011, a severe new viral disease had devastated most duck-farming
regions in China. This disease affected not only laying ducks but also meat ducks, causing huge economic losses
for the poultry industry. The objective of this study is to develop a one-step reverse transcription loop-mediated
isothermal amplification (RT-LAMP) assay for the detection of the new virus related to Tembusu-related Flavivirus.
Results: The RT-LAMP assay is very simple and rapid, and the amplification can be completed within 50 min under
isothermal conditions at 63°C by a set of 6 primers targeting the E gene based on the sequences analysis of the
newly isolated viruses and other closely related Flavivirus.The monitoring of gene amplification can also be
visualized by using SYBR green I fluorescent dye. In addition, the RT-LAMP assay for newly isolated Tembusu-
related Flavivirus showed higher sensitivity with an RNA detection-limit of 2 copies/μL compared with 190 copies/
μL of the conventional RT-PCR method. The specificity was identified without cross reaction to other common
avian pathogens. By screening a panel of clinical samples this method was more feasible in clinical settings and
there was higher positive coincidence rate than conventional RT-PCR and virus isolation.
Conclusion: The RT-LAMP assay for newly isolated Tembusu-related Flavivirus is a valuable tool for the rapid and
real-time detection not only in well-equipped laboratories but also in general conditions.
Keywords: Tembusu-related Flavivirus, newly-isolated virus, RT-PCR, RT-LAMP
Introduction
In April 2010, a severe viral disease spread out in most
duck-farming regions in China including Zhejiang,
Jiangsu, Hebei and Shandong provinces. The disease
affected both meat ducks and laying ducks. The affected
layer ducks showed clinical symptom of heavy egg-lay-
ing decrease ranging from 20% to 60%, even 90% [1].
During the course of disease, some ducks developed
neurological signs including unsteady standing, falling
and quivering to death. In some young-duck farms, the
disease developed as early as in 10-day-old ducklings,
with a peak in 20-40 days old ducklings. The main
symptoms were unable to stand steadily and falling. The
death rate was normally within 10-30%, and could be as
high as 80%, causing huge economic losses in duck-
farming. We isolated some apparently new flavivirus
from duck incubated in 10-day-old SPF chicken
embryos and duck embryos, and found that the isolates
belonged to the genus flavivirus based on sequence ana-
lysis. The virus had lower nucleotide homology with
other genus of flavivirus.
In consideration of biological characters and clinical
symptoms, we suggested Duck Encephalitis virus (DEV)
was named for this newly virus. DEV infection can
cause duck encephalitis with severe central nervous sys-
tem disorders and egg laying decrease. Diagnosis of
DEV infection is mainly based on viral culture and
molecular approaches [2]. Virus isolation is a definitive
diagnosis for DEV infection, however, this assay is
* Correspondence: mliao@scau.edu.cn; qinzm1997@163.com
1College of Veterinary Medicine, South China Agricultural University,
Guangzhou 510642, PR China
2Institute of Poultry Science, Shandong Academy of Agricultural Science,
Jinan 250023, PR China
Full list of author information is available at the end of the article
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
© 2011 Wang et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.

Page 2

usually unfeasible owing to less sensitive and time-con-
suming. RT-PCR assays for detection of specific geno-
mic sequence of DEV have shown high sensitivity and
specificity. However, these assays are time-consuming
and require expensive and sophisticated equipments [3].
DEV often occur in rural areas where routine RT-PCR
diagnostic facilities are limited. Therefore, it is necessary
for us to develop a rapid, simple, sensitive, and specific
diagnostic method for DEV infection and surveillance.
LAMP is a novel PCR method and its most important
advantage is amplification of nucleic acids under iso-
thermal conditions at a temperature range between 60
and 65°C within 1 h [4-6]. Another advantage of the
method is that the amplification can lead to the accu-
mulation of large amounts of products of various
lengths, making detection of amplified nucleic acids
much easier[7]. Recently, LAMP technology has been
successfully applied for rapid detection of various patho-
gens [8-12]. A RT-LAMP assay for detecting JEV was
firstly reported by Toriniwa and Komiya and the sensi-
tivity was similar to conventional RT-PCR [13]. Later,
Parida used the application of RT-LAMP assay to detect
JEV in the cerebrospinal fluid samples from patients
with clinical diagnosis of acute encephalitis [14].
So far, there has been no report on using the RT-
LAMP to rapidly diagnose and identify DEV. In this
study, we established the RT-LAMP method to rapidly
diagnose and identify DEV. The assay can be a new
standard for the virus identification.
Methods
Design of DEV specific RT- LAMP primers
Based on the sequence of newly isolated Tembusu-
related Flavivirus BYD-1 published in GenBank (Gen-
bank accession no.JF312912.1) and other unpublished
sequences that we collected, a highly conserved region
of the E gene was chosen to design the RT-LAMP pri-
mers. A set of 6 primers was designed comprising two
outer (F3, B3), two inner (FIP, BIP) and two loop pri-
mers (FLP, BLP), which could recognize eight distinct
regions on the target sequence by software program
(http://primerexplorer). FIP and BIP were high
performance liquid chromatography-purified primers.
FLP and BLP primers were composed of the sequences
that were complementary to the sequence between F1
and F2, and between B1 and B2 regions, respectively.
All primers were composed by Shanghai BGI Company.
The details of the primers with regard to their positions
in the genomic sequences were shown in Table 1.
Clinical samples
Three new DEV were isolated from layer ducks with
typical eggs-laying decrease symptoms and young duck
with neurological signs from 2010 to 2011 by using 10-
day-old SPF chicken(duck) embryonated eggs, which
were confirmed as DEV by sequencing. All of the iso-
lates were stored at -80°C until further investigation.
Their alignment analysis of nucleotide homology
showed that the new isolates belonged to the genus fla-
vivirus, Ntaya virus group. In addition, the control
viruses included duck plague virus(DPV) isolate NJ,
duck hepatitis virus (DHV), low-pathogenicity avian
influenza virus (LP-AIV) H9N2 and swine encephalitis
vaccine virus SA-14, all were obtained from the Poultry
Institute of Shandong.
RNA extraction
The genomic viral RNA was extracted from the cultures
obtained from embryo by using the MiniBEST viral
RNA Extraction kit (TaKaRa, Japan) according to the
manufacturer’s protocol. The RNA was eluted in a final
volume of 50 μL of elution buffer and stored at -80°C
until further use.
RT-PCR
In order to compare the sensitivity and specificity of the
RT-LAMP assay, one-step RT-PCR was performed with
DEV-specific primers designed from the E gene (Gen-
bank accession no.JF312912.1). E-F: 5,CCACGGAAT-
TAGCGGTTGT3,(position no.149 to 167), and E-R: 5,
TAAGTTGCCTTGGGATTATGAG 3,(position no. 261
to 279), targeting 112 bp. The amplification was done in
a reaction volume of 50 μL by using the TaKaRa One-
Step RT-PCR kit with 50 pmol of forward and reverse
Table 1 Details of RT-LAMP primers
Primer name and
component
PositionSequence
F3
B3
(1039-1058)
(1259-1241)
AATGACATGACACCAGTTGGGCA ACCATCCTTTGTGCTC
ATGGAGGTTCCACTTCCACCT
TTTACAGTCAACCCATACGTGT GGTAGGAAGTGGAAAAGGACTTTT
TAAAAGCTTTTCCAATTGT
GGCACCCGTGGAGGAGGTCG AGATCAGGTACCAGTGGCATAG
FIP(F1c+TTTT+F2)(1135-1120+TTTT+1069-
1087)
(1155-1174+TTTT+1225-
1207)
(1106-1088)
(1175-1196)
BIP(B1c+TTTT+B2)
FLP
BLP
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 2 of 7

Page 3

primers and 2 μL of RNA according to the manufac-
turer’s protocol. The thermal profile of RT-PCR was 50°
C for 40 min and 94°C for 2 min, followed by 32 cycles
of 94°C for 30 s, 52°C for 30 s, 72°C for 30 s, and a final
extension cycle of 72°C for 10 min.
RT-LAMP
The RT-LAMP reaction was done in a reaction volume
of 25 μL containing 40 pmol each of the primers FIP
and BIP, 5 pmol each of the outer primers F3 and B3,
20 pmol each of the loop primers FLP and BLP, 1.0
mM deoxynucleoside triphosphate (Promega), 0.8 M
betaine (Ferments), 8 U of Bsm DNA polymerase (Fer-
ments), 10 U of the avian myeloblastosis virus reverse
transcriptase (TaKaRa), and 2 μL of the target RNA.
The reaction mixture was incubated at 63°C for 50 min
in a heating block and followed by heating at 85°C for 2
min to terminate the reaction. Negative and positive
controls were done in each run, and all precautions
were adopted to prevent cross-contamination.
Sensitivity and specificity of RT-LAMP and RT-PCR
The specificity of RT-LAMP reaction was done for the
three isolated strains. DPV isolate NJ, DHV, H9N2 and
SA-14 were used as contrastive specimens. The sensitiv-
ity of the RT-LAMP assay for the detection of DEV
RNA was determined by testing serial 10-fold dilutions
of RNA and compared with that of conventional RT-
PCR. In order to evaluate the detection limit of the
assays, the amount of DEV RNA was determined by
spectrophotometer and converted to molecular copies
by using the following computational formula [15].
Y(molecules/ul) =
X(g/ul)RNA
transcriptlength(bp) × 340× 6.02 × 1023
Y is molecular copies, X is optical density ratio.
RT-LAMP visualization
The monitoring of RT-LAMP amplification was visually
observed under UV light (302 nm) following the addi-
tion of 1 μL of SYBR green I (1:1000) dye to the tube.
Agarose gel analysis
After incubation at 63°C for 50 min, 10 μL RT-LAMP
product was electrophoresed on a 2% agarose gel in
TAE buffer, followed by staining with ethidium bromide
and observed in image-forming system.
RT-LAMP assay with virus-attacked samples
15-day-old ducks were randomly divided into 2 groups:
the first group of 10 as drug group with an attacking
agent volume of 105TCID50ml-1by calculating with the
Reed-Muench cumulative method. The second group
was the control group, attacked by the same volume of
saline injection. Mortality was recorded daily for 10
days. After 10 days, dead ducks (7), ill ducks (3) and the
control ducks were killed and some organs (liver, kid-
ney, spleen, brain, follicle membrane) were processed as
samples for RT-LAMP.
RT-LAMP assay with clinical samples
The applicability of the RT-LAMP assay for clinical
diagnosis of DEV was validated with possible samples
collected from China between 2010 and 2011, and the
results were compared with those of conventional RT-
PCR and virus isolation. A total of 88 clinical samples
after clinic examination and serological testing were
used in this study for comparison.
Results
Following RT-LAMP amplification, white turbidity was
visually observed in the bottom of the tube. The inspec-
tion for amplification was also performed through the
observation of colour change following the addition of 1
μL of SYBR green I (1:1000) dye to the tube. For posi-
tive amplification, the original orange colour of the dye
changed to green that can be judged under UV light
(302 nm) (Figure 1).
As observed on agarose gel electrophoresis, the RT-
LAMP assay could amplify the target sequence of the E
gene of DEV at 63°C in 50 min. The amplification was
observed as a ladder-like pattern on the gel due to the
formation of a mixture of stem-loop DNAs with various
stem lengths (Figure 2). The RT-PCR could amplify the
target sequence on agarose gel electrophoresis (Figure 3).
Sensitivity and specificity of RT-LAMP and RT-PCR
The DEV-specific RT-LAMP primers demonstrated a
high degree of specificity for DEV only and failed to
Figure 1 The inspection of the RT-LAMP reaction stained with
SYBR Green I under UV light. Tubes 1: DEV SD isolate showed
green color; Tube 2: JEV SA14 did not show green color.
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 3 of 7

Page 4

detect all the control viruses. Further confirmation of
the structures of the amplified products was also done
by sequencing. The obtained sequences perfectly
matched with the expected nucleotide sequences.
The sensitivity of the RT-LAMP assay for the detec-
tion of DEV RNA was determined by testing serial 10-
fold dilutions of viral RNA and compared with that of
conventional RT-PCR.
The RT-LAMP assay was able to amplify the 10-5
fold RNA, and the comparative sensitivity of RT-PCR
revealed that it was 10-2fold with the same original
RNA. RNA initial concentration was converted to
1.9×105copies/μL according to above calculation for-
mula. So the detection limit of the RT-LAMP assay
was 2 copies/μL whereas the detection limit of the RT-
PCR assay was 190 copies/μL under UV light with
dying (Figure 4). Therefore, RT-LAMP assay was more
sensitive than RT-PCR. Furthermore, RT-LAMP can
complete within 1 h, much faster than that of RT-PCR
(3 h).
RT-LAMP assay with virus-attacked samples
The organs from the dead ducks (7), ill ducks (3)
showed special LAMP light through RT-LAMP assay.
Samples such as liver, kidney, spleen, brain and follicle
membrane were all confirmed by DEV attacking. There
were no reactions observed for the control ducks.
Evaluation of DEV RT-LAMP assay with clinical samples
A total of 88 clinical samples (including liver, kidney,
spleen, brain and follicle membrane) after clinic exami-
nation were used in this study. The comparative evalua-
tion of RT-LAMP and one-step RT-PCR revealed that
RT-LAMP had higher positive coincidence rate. As
summarized in Table 2, percentage of positive samples
detected by conventional RT-PCR, virus isolation and
RT-LAMP were 81/88, 74/88 and 85/88, respectively.
The RT-LAMP assay was evaluated to detect four
additional positive cases, whereas one-step RT-PCR
failed to detect. The sequencing of these 4 additional
cases matched with the expected nucleotide sequences,
Figure 2 Amplified products of the RT-LAMP assay were observed on a 2% agarose gel electrophoresis under UV. Three DEV positive
amplifications showed a ladder-like pattern (lane 1,2,5). M: marker DL2000; 1:BZ isolate;2:LC isolate; 3: DPV NJ; 4: JEV SA14;5: SD isolate.
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 4 of 7

Page 5

Figure 3 Amplified products of the RT-PCR assay are observed on a 2% agarose gel electrophoresis under UV. Three DEV positive
amplifications showed 112bp band (lane 1,2,3). M: marker DL2000;1:BZ isolate; 2:LC isolate;3:SD isolate; 4: DPV NJ; 5: JEV SA14.
Figure 4 Amplified products of the RT-LAMP and RT-PCR assay were observed on a 2% agarose gel electrophoresis under UV in the
sensitivity of the RT-LAMP assay. M: marker DL2000;1-5: Amplified products of serial 10-fold dilutions of virus in RT-LAMP: 1.9 × 105, 1.9 × 104,
1.9 × 103, 1.9 × 102, 1.9 × 101copies of RNA, respectively; 6-9: Amplified products of serial 10-fold dilutions of virus in RT-PCR 1.9 × 105, 1.9 ×
104, 1.9 × 103, 1.9 × 102copies of RNA, respectively.
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 5 of 7

Page 6

thereby indicating the superior sensitivity of RT-LAMP
assay.
Discussions
The LAMP method does not rely on expensive and
sophisticated facilities such as thermal cyclers. The
amplified products of the reaction are shown as a lad-
der-like pattern by agarose gel electrophoresis. The pro-
ducts could be visually observed under UV light or
normal light by adding fluorescent dye. A by-product of
the LAMP reaction, magnesium pyrophosphate, can be
directly inspected by naked eye. The ordinary PCR
methods require either high-precision instruments for
the amplification or elaborate methods for the detection
of the amplified products [16]. In addition, these meth-
ods are often cumbersome to adapt for routine clinical
use, especially in peripheral health care settings and pri-
vate clinics [17].
Here, we described the establishment of a one-step,
single tube RT-LAMP assay for rapid detection of the
envelope gene of DEV genome and compared its sensi-
tivity and specificity with conventional RT-PCR. The
RT-LAMP assay for DEV showed excel specificity in
positive viruses and contrastive strains. As already
shown in the results, the estimated detection limit (2
copies/μL) of the DEV RT-LAMP assay was more sensi-
tive than conventional RT-PCR with the estimated
detection limit of 190 copies/μL.
Conclusions
In conclusion, this study presented a simple, sensitive
and specific RT-LAMP assay for detection of specific
nucleic acid sequence of DEV E gene. Considering these
advantages, the RT-LAMP assay can be applied as a
practical molecular diagnostic tool for DEV infection
and surveillance in laboratory or general conditions.
Acknowledgements
The study was partly supported by funds from Shandong Provincial Natural
Science Foundation (ZR2010CQ044, ZR2009DM047, ZR2010CQ003),
Shandong Provincial Scientific and Technological Planning Project
(2009GG10009006), Guangdong Provincial Scientific and Technological
Planning Project (2009A201006).
Author details
1College of Veterinary Medicine, South China Agricultural University,
Guangzhou 510642, PR China.2Institute of Poultry Science, Shandong
Academy of Agricultural Science, Jinan 250023, PR China.3Ministry of
Agriculture of the People’s Republic of China, Beijing 100026, PR China.
Authors’ contributions
YW,XY,YL,KY,JY,HX,YZ carried out the experiments and wrote the manuscript.
XY performed the statistical analysis. KY,ML,ZQ participated in experimental
design and coordination. All authors read and approved the final
manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 1 July 2011 Accepted: 21 December 2011
Published: 21 December 2011
References
1. Jingliang Su, Shuang Li, Xudong Hu, Xiuling Yu, Wang Yongyue, Peipei Liu,
Xishan Lu, Zhang Guozhong, Xueying Hu, Di Liu, Xiaoxia Li, Wenliang Su,
Hao Lu, Shing Mok Ngai, Wang Peiyi, Wang Ming, Tian Kegong, George F:
Gao: Duck Egg-Drop Syndrome Caused by BYD Virus, a New Tembusu-
Related Flavivirus. PLoS ONE .
2. Yufeng Li, Xiuli Ma, Kexiang Yu, Youling Wang, Gao Wei, Bing Huang,
Huangying Xu, Jing Wu, Shengyu Wang, Lili Wang, Zhuoming Qin: A brief
report of flaviviruses newly isolated from duck. Acta Veterinaria et
Zootechnica Sinica 2011, 6:885-891.
3. Burke DS, Nisalak A, Ussery MA: Antibody capture immunoassay detection
of Japanese encephalitis virusimmunoglobulin M and Gantibodies in
cerebrospinal fluid. J Clin Microbio 2002, 16:1034-1042.
4.Chen HT, Zhang J, Sun DH, Ma LN, Liu XT, Cai XP, Liu YS: Development of
reverse transcription loop-mediated isothermal amplification for rapid
detection of H9 avian influenza virus. J Virol Methods 2008, 151:200-203.
5.Kiatpathomchai W, Jareonram W, Jitrapakdee S, Flegel TW: Rapid and
sensitive detection of taura syndrome virus by reverse transcription
loop-mediated isothermal amplification. J Virol Methods 2007,
146:125-128.
6. Le Roux CA, Kubo T, Grobbelaar AA, Jansen van Vuren P, Weyer J, Nel LH,
Swanepoel R, Morita K, Paweska JT: Development and evaluation of a
real-time reverse transcription-loop-mediated isothermal amplification
assay for rapid detection of rift valley fever virus in clinical specimens. J
Clin Microbiol 2009, 47:645-651.
7. Li Q, Zhou QF, Xue CY, Ma JY, Zhu DZ, Cao YC: Rapid detection of porcine
reproductive and respiratory syndrome virus by reverse transcription
loop-mediated isothermal amplification assay. J Virol Methods 2009,
155:55-60.
8.Peyrefitte CN, Boubis L, Coudrier D, Bouloy M, Grandadam M, Tolou HJ,
Plumet S: Real-time reverse-transcription loop-mediated isothermal
amplification for rapid detection of rift valley fever virus. J Clin Microbiol
2008, 46:3653-3659.
9. Dukes JP, King DP, Alexandersen S: Novel reverse transcription loop-
mediated isothermal amplification for rapid detection of foot-and-
mouth disease virus. Arch Virol 2006, 151:1093-1106.
10.Chen C, Cui S, Zhang C, Li J, Wang J: Development and validation of
reverse transcription loop-mediated isothermal amplification for
detection of PRRSV. Virus Genes 2010, 40:76-83.
11. Xu JT, Zhang ZM, Yin YB, Cui SJ, Xu SZ, Guo YY, Li JD, Wang JL, Liu XC,
Han LM: Development of reverse-transcription loop-mediated isothermal
amplification for the detection of infectious bursal disease virus. J Virol
Methods 2009, 162:267-271.
12. Xue CY, Zhang Y, Zhou QF, Xu C, Li XM, Cao YC: Rapid detection of
Infectious bursal disease virus by reverse transcription loop-mediated
isothermal amplification assay. J Vet Diagn Invest 2009, 21:841-843.
13. Toriniwa H, Komiya T: Rapid detection and quantification of Japanese
encephalitis virus by real-time reverse transcription loop-mediated
isothermal amplification. Microbiol Immunol 2006, 50:379-387.
14.Parida MM, Santhosh SR, Dash PK, Tripathi NK, Saxena P, Ambuj S, Sahni AK,
Lakshmana Rao PV, Morita K: Development and evaluation of reverse
transcription-loop-mediated isothermal amplification assay for rapid and
Table 2 Detection positive rates of clinical specimens by
RT-PCR, RT-LAMP and virus isolation
Source(N0) \ AssayRT-PCRRT-LAMPVirus isolation
Liver(20)90.0% 95.0%80.0%
Kidney(18)75.0%94.4%77.8%
Spleen(18)94.4% 100%94.4%
Brain(16)93.8%93.8%81.3%
Follicle membrane(16)
Positive rate(%)
100%
92.0%
100%
96.6%
87.5%
84.1%
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 6 of 7

Page 7

real-time detection of Japanese encephalitis virus. J Clin Microbiol 2006,
44:4172-4178.
Russell Sambrook: Molecular cloning. Cold Spring Harbor Lab Press;, 3
2002, 1695-1697.
Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T: Loop-mediated
isothermal amplification reaction using a nondenatured template.
Clinical Chemistry 2001, 47:1742-1743.
Kaneko H, Kawana T, Fukushima E, Suzutani T: Tolerance of loop-mediated
isothermal amplification to a culture medium and biological substances.
Journal of Biochem and Biophys Methods 2007, 70:499-501.
15.
16.
17.
doi:10.1186/1743-422X-8-553
Cite this article as: Wang et al.: Rapid detection of newly isolated
Tembusu-related Flavivirus by reverse-transcription loop-mediated
isothermal amplification assay. Virology Journal 2011 8:553.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Wang et al. Virology Journal 2011, 8:553
http://www.virologyj.com/content/8/1/553
Page 7 of 7