Roles of Interleukin-17 in an Experimental Legionella pneumophila Pneumonia Model

Department of Microbiology and Infectious Disease, Toho University School of Medicine, Tokyo, Japan.
Infection and immunity (Impact Factor: 3.73). 12/2011; 80(3):1121-7. DOI: 10.1128/IAI.05544-11
Source: PubMed


Interleukin-17 (IL-17) is a key factor in T helper type 17 (Th17) lineage host responses and plays critical roles in immunological
control of a variety of infectious diseases. Although Legionella pneumophila, an intracellular bacterium found widely in the environment, often causes a serious and life-threatening pneumonia in humans,
the contribution of IL-17 to immune function during Legionella pneumonia is unknown. In the present study, we used an experimental Legionella pneumonia infection to clarify the role of IL-17 in the resulting immune response. We observed robust production of pulmonary
IL-17A and IL-17F (IL-17A/F), peaking on day 1 and declining thereafter. Upregulated production of tumor necrosis factor alpha
(TNF-α), IL-6, and IL-1β, but not monocyte chemotactic protein 1 (MCP-1), was observed in Legionella-infected bone marrow-derived macrophages from BALB/c mice that had been stimulated with IL-17A or IL-17F. A significant decrease
in the production of proinflammatory cytokines IL-6 and TNF-α was observed in IL-17A/F-deficient mice (BALB/c background)
infected with L. pneumophila. Moreover, we found impaired neutrophil migration and lower numbers of chemokines (KC, LIX, and MIP-2) in IL-17A/F-deficient
mice. IL-17A/F-deficient mice also eliminated L. pneumophila more slowly and were less likely to survive a lethal challenge. These results demonstrate that IL-17A/F plays a critical
role in L. pneumophila pneumonia, probably through induction of proinflammatory cytokines and accumulation of neutrophils at the infection site.

Download full-text


Available from: Makoto Ishii,
  • Source
    • "Data analysis utilizing real-time (RT)-PCR (QuantiTect SYBR green PCR Kit, Qiagen GmbH) technique was performed on Chromo 4 real-time PCR system (MJ research, Japan BIO-RAD). The primer sequences were as follows: TLR2 (forward: CCCAGGAAAGCTCCCAGGAG; reverse: GGAACCTAGGACTTTATCGCAGCTC), TLR1 (forward: TCTG- GTACACGCATGGTC; reverse: ATGGGTGGGAAACTGAAT), and TLR6 (forward: CTTCCATTTTGTTTGCCTTAT; reverse: AGCGGTAGGTCTTTTGGAAC), interleukin (IL)-1␤ (forward: CTCCATGAGCTTTGTACAAGG; reverse: TGCTGATG- TACCAGTTGGGG) (Ramesh et al., 2007), IL-6 (forward: TCCAGTTGCCTTCTTGGGAC; reverse: GTACTCCAGAA- GACCAGAGG) (Kawane et al., 2010), IL-12p35 (forward: CACCCTTGCCCTCCTAAACC; reverse: CACCTGGCAGGTCCA- GAGA) (Kimizuka et al., 2012), tumor necrosis factor (TNF)-␣ (forward: GCATGATCCGCGACGTGGAA; reverse: AGATCCATGCCGTTGGCCAG) (Ramesh et al., 2007), keratinocyte-derived chemokine (KC) (forward: GCTGGGATTCACCTCAAGAA; reverse: TCTCCGT- TACTTGGGGACAC), macrophage inflammatory protein (MIP)2 (forward: CGCCCAGACAGAAGTCATAG; reverse: TCCTCCTTTCCAGGTCAGTTA), LPS-induced CXC chemokine (LIX) (forward: GGTCCACAGTGCCCTACG; reverse: GCGAGTGCATTCCGCTTA) (Kimizuka et al., 2012 "
    [Show abstract] [Hide abstract]
    ABSTRACT: Ureaplasma spp. are members of the family Mycoplasmataceae and have been considered to be associated with chorioamnionitis and preterm delivery. However, it is unclear whether Ureaplasma spp. have virulence factors related to these manifestations. The purpose of the present study was to determine whether the immunogenic protein multiple-banded antigen (MBA) from Ureaplasma parvum is a virulence factor for preterm delivery. We partially purified MBA from a type strain and clinical isolates of U. parvum, and also synthesized a diacylated lipopeptide derived from U. parvum, UPM-1. Using luciferase assays, both MBA-rich fraction MRF and UPM-1 activated the NF-κB pathway via TLR2. UPM-1 upregulated IL-1β, IL-6, IL-12p35, TNF-α, MIP2, LIX, and iNOS in mouse peritoneal macrophage. MRF or UPM-1 was injected into uteri on day 15 of gestation on pregnant C3H/HeN mice. The intrauterine MRF injection group had a significantly higher incidence of intrauterine fetal death (IUFD; 38.5%) than the control group (14.0%). Interestingly, intrauterine injection of UPM-1 caused preterm deliveries at high concentration (80.0%). In contrast, a low concentration of UPM-1 induced a significantly higher rate of fetal deaths (55.2%) than the control group (14.0%). The placentas of the UPM-1 injection group showed neutrophil infiltration and increased iNOS protein expression. Our data indicate that MBA from the clinical isolate of U. parvum is a potential virulence factor for IUFD and preterm delivery in mice and that the N-terminal diacylated lipopeptide is essential for the initiation of inflammation.
    Journal of Reproductive Immunology 10/2013; 100(2). DOI:10.1016/j.jri.2013.10.001 · 2.82 Impact Factor
  • Source
    • "For instance, differences in the activation status, cytokine production or expression of functionally important markers between infected and uninfected immune cells can be determined. However, it is known that various host and pathogen factors can affect neutrophil recruitment and function in the lungs [12-15]. Therefore, validation of the flow cytometry method for bacterial load determination in other experimental models of L. pneumophila infection must be considered. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Background Pulmonary load of Legionella pneumophila in mice is normally determined by counting serial dilutions of bacterial colony forming units (CFU) on agar plates. This process is often tedious and time consuming. We describe a novel, rapid and versatile flow cytometric method that detects bacteria phagocytosed by neutrophils. Findings Mice were infected with L. pneumophila via intratracheal or intranasal administration. At various times after bacteria inoculation, mouse lungs were harvested and analysed concurrently for bacterial load by colony counting and flow cytometry analysis. The number of L. pneumophila-containing neutrophils correlated strongly with CFU obtained by bacteriological culture. Conclusions This technique can be utilised to determine pulmonary bacterial load and may be used in conjunction with other flow cytometric based analyses of the resulting immune response.
    BMC Research Notes 08/2012; 5(1):448. DOI:10.1186/1756-0500-5-448
  • [Show abstract] [Hide abstract]
    ABSTRACT: Multiple sclerosis (MS) is a disease of the central nervous system (CNS) characterized by inflammatory, demyelinating lesions localized in the brain and spinal cord. Experimental autoimmune encephalomyelitis (EAE) is an animal model of MS that is induced by activating myelin-specific T cells and exhibits immune cell infiltrates in the CNS similar to those seen in MS. Both MS and EAE exhibit disease heterogeneity, reflecting variations in clinical course and localization of lesions within the CNS. Collectively, the differences seen in MS and EAE suggest that the brain and spinal cord function as unique microenvironments that respond differently to infiltrating immune cells. This review addresses the roles of the cytokines interferon-γ and interleukin-17 in determining the localization of inflammation to the brain or spinal cord in EAE.
    Immunological Reviews 07/2012; 248(1):205-15. DOI:10.1111/j.1600-065X.2012.01126.x · 10.12 Impact Factor
Show more