Article

Roles of Interleukin-17 in an Experimental Legionella pneumophila Pneumonia Model

Department of Microbiology and Infectious Disease, Toho University School of Medicine, Tokyo, Japan.
Infection and immunity (Impact Factor: 4.16). 12/2011; 80(3):1121-7. DOI: 10.1128/IAI.05544-11
Source: PubMed

ABSTRACT Interleukin-17 (IL-17) is a key factor in T helper type 17 (Th17) lineage host responses and plays critical roles in immunological control of a variety of infectious diseases. Although Legionella pneumophila, an intracellular bacterium found widely in the environment, often causes a serious and life-threatening pneumonia in humans, the contribution of IL-17 to immune function during Legionella pneumonia is unknown. In the present study, we used an experimental Legionella pneumonia infection to clarify the role of IL-17 in the resulting immune response. We observed robust production of pulmonary IL-17A and IL-17F (IL-17A/F), peaking on day 1 and declining thereafter. Upregulated production of tumor necrosis factor alpha (TNF-α), IL-6, and IL-1β, but not monocyte chemotactic protein 1 (MCP-1), was observed in Legionella-infected bone marrow-derived macrophages from BALB/c mice that had been stimulated with IL-17A or IL-17F. A significant decrease in the production of proinflammatory cytokines IL-6 and TNF-α was observed in IL-17A/F-deficient mice (BALB/c background) infected with L. pneumophila. Moreover, we found impaired neutrophil migration and lower numbers of chemokines (KC, LIX, and MIP-2) in IL-17A/F-deficient mice. IL-17A/F-deficient mice also eliminated L. pneumophila more slowly and were less likely to survive a lethal challenge. These results demonstrate that IL-17A/F plays a critical role in L. pneumophila pneumonia, probably through induction of proinflammatory cytokines and accumulation of neutrophils at the infection site.

Download full-text

Full-text

Available from: Makoto Ishii, Aug 15, 2015
0 Followers
 · 
179 Views
  • Source
    • "Data analysis utilizing real-time (RT)-PCR (QuantiTect SYBR green PCR Kit, Qiagen GmbH) technique was performed on Chromo 4 real-time PCR system (MJ research, Japan BIO-RAD). The primer sequences were as follows: TLR2 (forward: CCCAGGAAAGCTCCCAGGAG; reverse: GGAACCTAGGACTTTATCGCAGCTC), TLR1 (forward: TCTG- GTACACGCATGGTC; reverse: ATGGGTGGGAAACTGAAT), and TLR6 (forward: CTTCCATTTTGTTTGCCTTAT; reverse: AGCGGTAGGTCTTTTGGAAC), interleukin (IL)-1␤ (forward: CTCCATGAGCTTTGTACAAGG; reverse: TGCTGATG- TACCAGTTGGGG) (Ramesh et al., 2007), IL-6 (forward: TCCAGTTGCCTTCTTGGGAC; reverse: GTACTCCAGAA- GACCAGAGG) (Kawane et al., 2010), IL-12p35 (forward: CACCCTTGCCCTCCTAAACC; reverse: CACCTGGCAGGTCCA- GAGA) (Kimizuka et al., 2012), tumor necrosis factor (TNF)-␣ (forward: GCATGATCCGCGACGTGGAA; reverse: AGATCCATGCCGTTGGCCAG) (Ramesh et al., 2007), keratinocyte-derived chemokine (KC) (forward: GCTGGGATTCACCTCAAGAA; reverse: TCTCCGT- TACTTGGGGACAC), macrophage inflammatory protein (MIP)2 (forward: CGCCCAGACAGAAGTCATAG; reverse: TCCTCCTTTCCAGGTCAGTTA), LPS-induced CXC chemokine (LIX) (forward: GGTCCACAGTGCCCTACG; reverse: GCGAGTGCATTCCGCTTA) (Kimizuka et al., 2012 "
    [Show abstract] [Hide abstract]
    ABSTRACT: Ureaplasma spp. are members of the family Mycoplasmataceae and have been considered to be associated with chorioamnionitis and preterm delivery. However, it is unclear whether Ureaplasma spp. have virulence factors related to these manifestations. The purpose of the present study was to determine whether the immunogenic protein multiple-banded antigen (MBA) from Ureaplasma parvum is a virulence factor for preterm delivery. We partially purified MBA from a type strain and clinical isolates of U. parvum, and also synthesized a diacylated lipopeptide derived from U. parvum, UPM-1. Using luciferase assays, both MBA-rich fraction MRF and UPM-1 activated the NF-κB pathway via TLR2. UPM-1 upregulated IL-1β, IL-6, IL-12p35, TNF-α, MIP2, LIX, and iNOS in mouse peritoneal macrophage. MRF or UPM-1 was injected into uteri on day 15 of gestation on pregnant C3H/HeN mice. The intrauterine MRF injection group had a significantly higher incidence of intrauterine fetal death (IUFD; 38.5%) than the control group (14.0%). Interestingly, intrauterine injection of UPM-1 caused preterm deliveries at high concentration (80.0%). In contrast, a low concentration of UPM-1 induced a significantly higher rate of fetal deaths (55.2%) than the control group (14.0%). The placentas of the UPM-1 injection group showed neutrophil infiltration and increased iNOS protein expression. Our data indicate that MBA from the clinical isolate of U. parvum is a potential virulence factor for IUFD and preterm delivery in mice and that the N-terminal diacylated lipopeptide is essential for the initiation of inflammation.
    Journal of Reproductive Immunology 10/2013; 100(2). DOI:10.1016/j.jri.2013.10.001 · 2.37 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Multiple sclerosis (MS) is a disease of the central nervous system (CNS) characterized by inflammatory, demyelinating lesions localized in the brain and spinal cord. Experimental autoimmune encephalomyelitis (EAE) is an animal model of MS that is induced by activating myelin-specific T cells and exhibits immune cell infiltrates in the CNS similar to those seen in MS. Both MS and EAE exhibit disease heterogeneity, reflecting variations in clinical course and localization of lesions within the CNS. Collectively, the differences seen in MS and EAE suggest that the brain and spinal cord function as unique microenvironments that respond differently to infiltrating immune cells. This review addresses the roles of the cytokines interferon-γ and interleukin-17 in determining the localization of inflammation to the brain or spinal cord in EAE.
    Immunological Reviews 07/2012; 248(1):205-15. DOI:10.1111/j.1600-065X.2012.01126.x · 12.91 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Central nervous system catheter infections are a serious complication in the treatment of hydrocephalus. These infections are commonly caused by Staphylococcus epidermidis and Staphylococcus aureus, both known to form biofilms on the catheter surface. Our objective was to generate a novel murine model of central nervous system catheter-associated biofilm infection using a clinical S. aureus isolate and characterize the nature of the inflammatory response during biofilm growth. Silicone catheters were precoated with S. aureus to facilitate bacterial attachment, whereupon infected or sterile catheters were stereotactically inserted into the lateral ventricle of the brain in C57BL/6 mice and evaluated at regular intervals through day 21 postinsertion. Animals tolerated the procedure well, with no clinical signs of illness or bacterial growth seen in the control group. Bacterial titers associated with central nervous system catheters were significantly elevated compared to those from the surrounding parenchyma, consistent with biofilm formation and minimal planktonic spread of infection. Catheter-associated bacterial burdens progressively increased, with maximal colonization achieved at day 7 postinfection. Analysis of inflammatory infiltrates by fluorescence-activated cell sorting (FACS) revealed significant macrophage and neutrophil influx, which peaked at days 3 and 5 to 7, respectively. In contrast, there were no detectable immune infiltrates associated with tissues surrounding sterile catheters. Biofilm infection led to significant increases in chemokine (CXCL1 and CCL2) and proinflammatory cytokine (interleukin 17 [IL-17]) expression in tissues surrounding infected central nervous system catheters. Based on these results, we propose this approach is a valid animal model for further investigations of catheter-associated central nervous system shunt infections.
    Infection and immunity 07/2012; 80(9):3206-14. DOI:10.1128/IAI.00645-12 · 4.16 Impact Factor
Show more