The Candida Genome Database incorporates multiple Candida species: multispecies search and analysis tools with curated gene and protein information for Candida albicans and Candida glabrata

Department of Genetics, Stanford University Medical School, Stanford, CA 94305-5120, USA.
Nucleic Acids Research (Impact Factor: 9.11). 11/2011; 40(Database issue):D667-74. DOI: 10.1093/nar/gkr945
Source: PubMed


The Candida Genome Database (CGD, http://www is an internet-based resource that provides centralized access to genomic sequence data and manually curated functional information about genes and proteins of the fungal pathogen Candida albicans and other Candida species. As the scope of Candida research, and the number of sequenced strains and related species, has grown in recent years, the need for expanded genomic resources has also grown. To answer this need, CGD has expanded beyond storing data solely for C. albicans, now integrating data from multiple species. Herein we describe the incorporation of this multispecies information, which includes curated gene information and the reference sequence for C. glabrata, as well as orthology relationships that interconnect Locus Summary pages, allowing easy navigation between genes of C. albicans and C. glabrata. These orthology relationships are also used to predict GO annotations of their products. We have also added protein information pages that display domains, structural information and physicochemical properties; bibliographic pages highlighting important topic areas in Candida biology; and a laboratory strain lineage page that describes the lineage of commonly used laboratory strains. All of these data are freely available at http://www We welcome feedback from the research community at [email protected]
/* */

Download full-text


Available from: Gavin Sherlock,

Click to see the full-text of:

Article: The Candida Genome Database incorporates multiple Candida species: multispecies search and analysis tools with curated gene and protein information for Candida albicans and Candida glabrata

8.21 MB

See full-text
  • Source
    • "Thereisalsosubstantialevidencetosuggestthatfungican synthesizeandreleaseACh(Horiuchietal.,2003;Kawashima andFujii,2008).Indeed,sequencingoftheC.albicansgenome revealedthisorganismtopossessputativegenesfortheenzymes responsibleforAChsynthesis;cholineacetyltransferase(ChAT) andcarnitineacetyltransferase(CrAT;Inglisetal.,2012). However,theAChsynthesismachineryofC.albicansremainsto becharacterized.Furthermore,thebiologicalfunctionsoffungal derivedAChremaintobeelucidated. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Fungal infections have dramatically increased in the last decades in parallel with an increase of populations with impaired immunity, resulting from medical conditions such as cancer, transplantation, or other chronic diseases. Such opportunistic infections result from a complex relationship between fungi and host, and can range from self-limiting to chronic or life-threatening infections. Modern medicine, characterized by a wide use of biomedical devices, offers new niches for fungi to colonize and form biofilm communities. The capability of fungi to form biofilms is well documented and associated with increased drug tolerance and resistance. In addition, biofilm formation facilitates persistence in the host promoting a persistent inflammatory condition. With a limited availability of antifungals within our arsenal, new therapeutic approaches able to address both host and pathogenic factors that promote fungal disease progression, i.e., chronic inflammation and biofilm formation, could represent an advantage in the clinical setting. In this paper we discuss the antifungal properties of myriocin, fulvic acid, and acetylcholine in light of their already known anti-inflammatory activity and as candidate dual action therapeutics to treat opportunistic fungal infections.
    Frontiers in Microbiology 10/2015; 6. DOI:10.3389/fmicb.2015.01077 · 3.99 Impact Factor
    • "was used as the normalizing housekeeping gene (Bader et al., 2012). The primers for the target gene SNF3 [SNF3_F, 5′–3′: ACGACGCATCTCTGCTTTTT (forward ) and SNF3_R 5′–3′: CGTGAATCCAACGTGATTTG (reverse)] were designed based on the gene sequences retrieved from the Candida Genome Database (Inglis et al., 2012). The PCR efficiency of both primers were tested in two independent experiments by running a series of 5-fold dilution of C. glabrata DNA in MiniOpticon™ Real time PCR (Bio-Rad, USA) and the acceptable amplification efficiency with 94.7% (SNF3) and 102.4% (ACT1) was achieved. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Glucose is an important fuel source to support many living organisms. Its importance in the physiological fitness and pathogenicity of Candida glabrata, an emerging human fungal pathogen has not been extensively studied. Present study aimed to investigate the effects of glucose on the growth, biofilm formation, antifungal susceptibility and oxidative stress resistance of C. glabrata. In addition, its effect on the expression of a putative high affinity glucose sensor gene, SNF3 was also investigated. Glucose concentrations were found to exert effects on the physiological responses of C. glabrata. The growth rate of the species correlated positively to the amount of glucose. In addition, low glucose environments were found to induce C. glabrata to form biofilm and resist amphotericin B. Conversely, high glucose environments promoted oxidative stress resistance of C. glabrata. The expression of CgSNF3 was found to be significantly up-regulated in low glucose environments. The expression of SNF3 gene in clinical isolates was found to be higher compared to ATCC laboratory strains in low glucose concentrations, which may explain the better survivability of clinical isolates in the low glucose environment. These observations demonstrated the impact of glucose in directing the physiology and virulence fitness of C. glabrata through the possible modulation by SNF3 as a glucose sensor, which in turn aids the species to adapt, survive and thrive in hostile host environment.
    Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases 09/2015; DOI:10.1016/j.meegid.2015.09.004 · 3.02 Impact Factor
  • Source
    • "S. pombe genome information (Assembly 16) was taken from the PomBase database (Wood et al. 2012); BS locations were calculated based on the position specific scoring matrix (PSSM) information extracted from the Sanger Institute, which is based on the original full genome sequencing from (Wood et al. 2002). A. nidulans (FGSC A4) and C. albicans (SC5314 Assembly 21) genome information was taken from the Aspergillus Genome Database (AspGD) (Arnaud et al. 2012) and Candida Genome Database (CGD) (Inglis et al. 2012), respectively ; BS locations were calculated based on the fungal BS consensus sequence (CURAY). We used only introns taken from coding sequence genes and excluded 5 ′ UTR and 3 ′ UTR introns. "
    [Show abstract] [Hide abstract]
    ABSTRACT: RNA splicing is the central process of intron removal in eukaryotes known to regulate various cellular functions such as growth, development, and response to external signals. The canonical sequences indicating the splicing sites needed for intronic boundary recognition are well known. However, the roles and evolution of the local folding of intronic and exonic sequence features adjacent to splice sites has yet to be thoroughly studied. Here, focusing on four fungi (Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus nidulans, and Candida albicans), we performed for the first time a comprehensive high-resolution study aimed at characterizing the encoding of intronic splicing efficiency in pre-mRNA transcripts and its effect on intron evolution. Our analysis supports the conjecture that pre-mRNA local folding strength at intronic boundaries is under selective pressure, as it significantly affects splicing efficiency. Specifically, we show that in the immediate region of 12-30 nucleotides (nt) surrounding the intronic donor site there is a preference for weak pre-mRNA folding; similarly, in the region of 15-33 nt surrounding the acceptor and branch sites there is a preference for weak pre-mRNA folding. We also show that in most cases there is a preference for strong pre-mRNA folding further away from intronic splice sites. In addition, we demonstrate that these signals are not associated with gene-specific functions, and they correlate with splicing efficiency measurements (r = 0.77, P = 2.98 × 10(-21)) and with expression levels of the corresponding genes (P = 1.24 × 10(-19)). We suggest that pre-mRNA folding strength in the above-mentioned regions has a direct effect on splicing efficiency by improving the recognition of intronic boundaries. These new discoveries are contributory steps toward a broader understanding of splicing regulation and intronic/transcript evolution.
    RNA 08/2015; 21(10). DOI:10.1261/rna.051268.115 · 4.94 Impact Factor
Show more