Identification of meats from red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus) using polymerase chain reaction targeting specific sequences from the mitochondrial 12S rRNA gene

Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria, Universidad Complutense de Madrid, 28040 Madrid, Spain.
Meat Science (Impact Factor: 2.62). 06/2007; 76(2):234-40. DOI: 10.1016/j.meatsci.2006.11.004
Source: PubMed


Polymerase chain reaction (PCR) based on oligonucleotide primers targeting the mitochondrial 12S rRNA gene was applied to the specific identification of meats from red deer (Cervus elaphus), fallow deer (Dama dama), and roe deer (Capreolus capreolus). The use of a common reverse primer, together with forward specific primers for red deer, fallow deer, and roe deer, allowed the selective amplification of the desired cervid sequences. The specificity of each primer pair was verified by PCR analysis of DNA from various game and domestic meats. The assay can be useful for the accurate identification of meats from cervid species, avoiding mislabeling or fraudulent species substitution in meat products.

1 Follower
253 Reads
    • "It suffers, however, from limited applicability to meat mixtures and is difficult to standardize. The same research group also published conventional PCR methods based on the use of species specific primers for the identification of red deer, fallow deer and roe deer (Fajardo et al., 2007b), the identification of chamois, pyrenean ibex and mouflon (Fajardo et al., 2007a) or the differentiation of European wild boar and domestic swine (Fajardo et al., 2008a). Zha et al. presented multiplex PCR assays for the detection of beef, sheep, pork and chicken in deer products (Zha, Xing, & Yang, 2010) or the rapid identification of sika deer, wapiti, red deer and reindeer (Zha, Xing, & Yang, 2011). "
    [Show abstract] [Hide abstract]
    ABSTRACT: In order to protect the consumer from meat adulteration it is necessary to identify and quantify the meat content in foodstuffs. Game meat is particularly susceptible for fraudulent labeling since it is more valuable than meat from domestic animals. The paper presents a TaqMan real-time PCR assay for the quantitative determination of roe deer in meat products. The assay developed does not show cross-reactivity with 23 animal and 43 plant species tested and is therefore specific for roe deer. The amplification efficiency determined by analyzing serially diluted roe deer DNA extracts was found to be 93.9%. For quantifying the roe deer content in % (w/w), a reference system based on the myostatin gene was used. The quantification strategy was validated by determining the roe deer content in model meat mixtures and a model sausage. In addition, the real-time PCR assay was applied to the analysis of commercially available meat products. Copyright © 2015 Elsevier Ltd. All rights reserved.
    Food Chemistry 07/2015; 178. DOI:10.1016/j.foodchem.2015.01.003 · 3.39 Impact Factor
  • Source
    • "Complete D-loop mtDNA of the hunting game animals by species-specific multilevel PCR has not yet been provided. It was at the multiplexes hoofed, so only a maximum of three species within one PCR reaction-red deer, fallow deer and roe deer, or chamois, Pyrenean ibex and mouflon, respectively (Fajardo et al., 2007a, 2007b). Tobe and Linacre (2008) identified 18 common European mammalian species by species-specific multiplex, but with one hunting game animal-red deer, only. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The control region of mtDNA (D-loop) was used for hair samples of the five hunting game species identification: red deer (Cervus elaphus), roe deer (Capreolus capreolus), fallow deer (Dama dama), mouflon (Ovis aries musimon), wild boar (Sus scrofa). For D-loop multilevel PCR detection scheme were applied six primers (CE CVZV 1 = 5’- GATCACGAGCTTGATCACCA-3’; CE CVZV 2 = 5’- AGGAGTGGGCGATTTTAGGT- 3’ ; DD CVZV 3 = 5’- CGCGTGAAACCAACAACCCGC - 3’; DD CVZV 4 = 5’- CCGGGTCGGGGCCTTAGACG - 3’; SSW CVZV 5 = 5’- ACACGTGCGTACACGCGCATA - 3’; SSW CVZV 6 = 5’- GGTGCCTGCT T TCGTAGCACG - 3’) designed to identify an unknown biological samples of the hunting game animals. The PCR reaction volume was 25µl at conditions 95°C for 2 minutes, 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles, with last extension at 72°C for 10 min. D-loop mtDNA amplicons of the game animals are characterized with specific PCR product sizes depend on species: red deer = 163bp and 140bp, fallow deer = 280bp and 138bp, roe deer = 303bp, 280bp, 160bp and 138bp, mouflon = 299bp and 178bp, wild boar = 137bp and 229bp. Keywords: Mitochondrial DNA typing, D-loop, multilevel PCR, red deer, fallow deer, roe deer, mouflon, wild boar, hair samples, DNA barcoding
    Applied and Translational Genomics 03/2014; 3(1):1-7. DOI:10.1016/j.atg.2013.03.001
  • Source
    • "Satisfactory results were obtained also in these cases confirming the possibility of DNA amplification which underwent strong damage (only relatively short DNA segments, i.e. 175 bp were amplified). The obtained results confirmed species specificity of the designed primers indicating that they will find application in routine investigations [Fajardo et al. 2007]. PCR makes it possible to distinguish meat species derived from closely related animals whose nucleotide sequences exhibit considerable degree of homology, e.g. "
    [Show abstract] [Hide abstract]
    ABSTRACT: In the times of industrial food production, regional and traditional food articles provide an attractive alternative for people looking for unforgettable sensory impressions. Regional or traditional food, commonly recognized as palatable and healthy, is also, for many consumers, a unique, sentimental journey back to tastes from childhood times. A gradual increase of demand for this type of food articles as well as relatively high prices of these products may generate among unscrupulous food manufacturers a number of improper production practices, e.g. replacement of a more expensive meat by a less expensive alternative. Species composition of meat products can be verified using chromatographic, immunological, electrophoretic, or genetic methods. One of the genetic methods applied in examining the authenticity of food composition, including meat and its products, is the polymerase chain reaction (PCR). This paper presents the most important techniques utilizing this technology to identify the origin of specific meat components constituting part of regional or traditional food articles. It was demonstrated that PCR techniques, in combination with species-specific primers, PCR- -RFLP, PCR-SSCP and real-time PCR, allow identification of meat species occurring independently or in mixtures with other meat species as well as meat subjected to thermal treatment or other technological processes in the course of industrial production. The only exception is the PCR-RAPD method that fails to identify meat species in the case of strong DNA degradation or in complex meat mixtures.
    Acta Scientiarum Polonorum, Technologia Alimentaria 01/2009; 8(2).
Show more