Development and inter-laboratory validation of unlabeled probe melting curve analysis for detection of JAK2 V617F mutation in polycythemia vera.

Abstract

JAK2 V617F, a somatic point mutation that leads to constitutive JAK2 phosphorylation and kinase activation, has been incorporated into the WHO classification and diagnostic criteria of myeloid neoplasms. Although various approaches such as restriction fragment length polymorphism, amplification refractory mutation system and real-time PCR have been developed for its detection, a generic rapid closed-tube method, which can be utilized on routine genetic testing instruments with stability and cost-efficiency, has not been described.
Asymmetric PCR for detection of JAK2 V617F with a 3'-blocked unlabeled probe, saturate dye and subsequent melting curve analysis was performed on a Rotor-Gene® Q real-time cycler to establish the methodology. We compared this method to the existing amplification refractory mutation systems and direct sequencing. Hereafter, the broad applicability of this unlabeled probe melting method was also validated on three diverse real-time systems (Roche LightCycler® 480, Applied Biosystems ABI® 7500 and Eppendorf Mastercycler® ep realplex) in two different laboratories. The unlabeled probe melting analysis could genotype JAK2 V617F mutation explicitly with a 3% mutation load detecting sensitivity. At level of 5% mutation load, the intra- and inter-assay CVs of probe-DNA heteroduplex (mutation/wild type) covered 3.14%/3.55% and 1.72%/1.29% respectively. The method could equally discriminate mutant from wild type samples on the other three real-time instruments.
With a high detecting sensitivity, unlabeled probe melting curve analysis is more applicable to disclose JAK2 V617F mutation than conventional methodologies. Verified with the favorable inter- and intra-assay reproducibility, unlabeled probe melting analysis provided a generic mutation detecting alternative for real-time instruments.

Full text

Page 1

Development and Inter-Laboratory Validation of
Unlabeled Probe Melting Curve Analysis for Detection of
JAK2 V617F Mutation in Polycythemia Vera
Zhiyuan Wu1., Hong Yuan2., Xinju Zhang3, Weiwei Liu1, Jinhua Xu4, Wei Zhang5, Ming Guan1,3,4*
1Department of Laboratory Medicine, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, People’s Republic of China, 2Department of Clinical
Laboratory, The First Affiliated Hospital of Dalian Medical University, Dalian, People’s Republic of China, 3Central Laboratory, Huashan Hospital, Shanghai Medical College,
Fudan University, Shanghai, People’s Republic of China, 4Department of Dermatology, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai, People’s
Republic of China, 5Shenzhen Key Laboratory for Translational Medicine of Dermatology, Shenzhen-PKU-HKUST Medical Center, Shenzhen, People’s Republic of China
Abstract
Background: JAK2 V617F, a somatic point mutation that leads to constitutive JAK2 phosphorylation and kinase activation,
has been incorporated into the WHO classification and diagnostic criteria of myeloid neoplasms. Although various
approaches such as restriction fragment length polymorphism, amplification refractory mutation system and real-time PCR
have been developed for its detection, a generic rapid closed-tube method, which can be utilized on routine genetic testing
instruments with stability and cost-efficiency, has not been described.
Methodology/Principal Findings: Asymmetric PCR for detection of JAK2 V617F with a 39-blocked unlabeled probe, saturate
dye and subsequent melting curve analysis was performed on a Rotor-GeneH Q real-time cycler to establish the
methodology. We compared this method to the existing amplification refractory mutation systems and direct sequencing.
Hereafter, the broad applicability of this unlabeled probe melting method was also validated on three diverse real-time
systems (Roche LightCyclerH 480, Applied Biosystems ABIH 7500 and Eppendorf MastercyclerH ep realplex) in two different
laboratories. The unlabeled probe melting analysis could genotype JAK2 V617F mutation explicitly with a 3% mutation load
detecting sensitivity. At level of 5% mutation load, the intra- and inter-assay CVs of probe-DNA heteroduplex (mutation/wild
type) covered 3.14%/3.55% and 1.72%/1.29% respectively. The method could equally discriminate mutant from wild type
samples on the other three real-time instruments.
Conclusions: With a high detecting sensitivity, unlabeled probe melting curve analysis is more applicable to disclose JAK2
V617F mutation than conventional methodologies. Verified with the favorable inter- and intra-assay reproducibility,
unlabeled probe melting analysis provided a generic mutation detecting alternative for real-time instruments.
Citation: Wu Z, Yuan H, Zhang X, Liu W, Xu J, et al. (2011) Development and Inter-Laboratory Validation of Unlabeled Probe Melting Curve Analysis for Detection
of JAK2 V617F Mutation in Polycythemia Vera. PLoS ONE 6(10): e26534. doi:10.1371/journal.pone.0026534
Editor: Richard C. Willson, University of Houston, United States of America
Received June 20, 2011; Accepted September 28, 2011; Published October 20, 2011
Copyright: ? 2011 Wu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study is funded by the Biomedical Key Project of Shanghai Science and Technology Committee (10411950200). The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: guanming88@yahoo.com
. These authors contributed equally to this work.
Introduction
Somatic mutations of the JAK2 gene at V617F, which leads to
constitutive JAK2 phosphorylation and kinase activation, occurs in
almost all cases of polycythemia vera and approximately 50% of
cases of chronic idiopathic myelofibrosis [1–4]. Furthermore,
diagnostic criteria for polythemia vera (PV), essential thrombocy-
tosis, and primary myelofibrosis were revised by incorporating this
recently described molecular marker [5,6]. Because identification
of the V617F mutation will be of potential use in the diagnosis,
prognosis, and perhaps selection of treatment for myeloprolifer-
ative neoplasmas, many tools have been developed to genotype
JAK2 V617F, including techniques such as restriction fragment
length polymorphism (RFLP) [2], amplification refractory muta-
tion system (ARMS) [7], real-time PCR [8,9] and direct
sequencing [10,11]. However, some of these methods have
limitations in sensitivity or in cost. Furthermore, screening assays
for the JAK2 mutation are not standardized and the possibility of
false negative or false positives can be real especially when low
mutant allele burden in the peripheral blood need to be detected
[12,13]. There is now an urgent need for a quick, cost-efficient and
reliable assay to identify the mutation.
Recently, unlabeled probe melting curve assay (MCA) with
saturating DNA dye for genotyping has been described [14–16].
Unlabeled probe MCA is a closed-tube, homogeneous method for
genotyping without fluorescently labeled probes or allele specific
PCR. The method combines both saturate dyes and unlabeled
oligonucleotide probes in an asymmetric PCR, leading to
simultaneous production of probe-target and whole amplicon
double-stranded DNA duplexes that can be analyzed from the
same PCR run and would be suitable for genotyping. Melting
curve methods have now been adapted to real-time PCR
PLoS ONE | www.plosone.org1 October 2011 | Volume 6 | Issue 10 | e26534

Page 2

instruments, and compared to sequencing or allele-specific PCR,
represent high throughput and cost saving methods with the
further advantage of reducing post-PCR handling of PCR
products [17,18].
Unlabeled probe MCA technology has been used for human
single nucleotide polymorphism (SNP) genotyping [19,20],
mutation detection [21] and bacterial species identification [22].
However, instruments vary widely in their ability to genotype
variants for melting analysis [23,24] in clinical laboratories. The
ability to differentiate complex melting species depends on the
quality of the melting curve generated. Understanding the melting
capabilities of these instruments will guide the appropriate use of
this technology.
Since unlabeled probe technology could be a rapid and
convenient tool for detecting the various JAK2 V617F mutations,
we decided to establish one such method with the prerequisite that
it should be reliable enough to give similar results on common
instruments. We first develop a simple and sensitive method for
detecting the V617F mutation in the JAK2 gene via unlabeled
probe MCA in Rotor-GeneH Q (Qiagen, Valencia, CA) and
validate the method on three other real-time instruments at two
different sites.
Materials and Methods
Patients
Forty blood samples were obtained from polycythemia vera
patients seen in the Huashan Hospital of Fudan University and the
First Affiliated Hospital of Dalian Medical University. Written
informed consents were received from all participants. DNA was
extracted from blood samples collected in ethylenediamine
tetraacetic acid anticoagulant with the QiaAmpH DNA Blood
Mini kit according to manufacturer’s directions (Qiagen, Valencia,
CA). Homozygous mutant (JAK2 V617F/JAK2 V617F) human
erythroleukemia (HEL) and homozygous wild type multiple
myeloma (RPMI8226) cell lines were purchased from the cell
bank of type culture collection of Chinese Academy of Sciences
and used as positive and negative controls, respectively. In
compliance with Helsinki Declaration of 1975 as revised in
1996, this study was approved by the Institutional Review Board
of Huashan Hospital.
Genotyping with unlabeled probe melting curve assay
Genotyping of JAK2 V617F was developed by unlabeled probe
high resolution melting assay in the Rotor-GeneH Q real-time
PCR system. Primer and probe sequences used for PCR are listed
in Table 1. To prevent the extension of the probe during PCR, a
39- carbon based C3 blockage was introduced. Unlabeled probe
melting analysis is developed on the basis of asymmetric PCR.
After asymmetric PCR, a large number of superfluous single
strands will hybridize with the unlabeled probe. So with the
increasing in temperature, it will produce two types of melting
curve. The part of curve in low melting temperature represents the
region of probe and product.
Asymmetric PCR was performed in a 20 ml of reaction volume.
The master mix contained: 10 ml Premix TaqH Hot Start Version
(26) (TaKaRa BIO, Shiga, Japan), 1 ml forward primer (0.5 mM),
1 ml reverse primer (5 mM), 1 ml unlabeled probe (5 mM), 1 ml
SYTOH 9 dye (30 mM) (Invitrogen, Carlsbad, CA), 5 ml deionized
distilled water (dd H2O) and 1 ml DNA template (15–25 ng/ml).
The PCR mix was subjected to PCR in a Rotor-GeneH Q real-
time platform (Qiagen, Valencia, CA). An initial denaturation was
performed at 95uC for 2 min, followed by 50 cycles of 95uC for
30 sec, 58uC for 30 sec, and 72uC for 30 sec. After PCR, the
products were heated to denaturation at 98uC for 2 min, followed
by cooling down to 40uC for 2 min to facilitate the heteroduplex
formation then melting slowly at 0.2uC/s from 50uC to 95uC.
High resolution melting (HRM)-curve analysis was performed
using Rotor-GeneH Q 1.7 software. For each assay we always
include positive and negative controls (homozygous wild type,
heterozygous, and homozygous mutant).
Analytical sensitivity and reproducibility
The assay method was evaluated for sensitivity by running a
serial dilution panel of homozygous HEL cell line DNA in wild
type RPMI8226 cell line DNA at concentrations of 50%, 25%,
10%, 5%, 3% and 1% in order to evaluate the sensitivity of the
methodology. HEL cell line DNA (homozygous mutant) and
RPMI8226 cell line DNA(homozygous wild type) were analyzed
repetitively by unlabeled probe MCA to confirm whether the
melting curve was reproducible using both normalized and
temperature-shifted difference plots.
ARMS method
The allele-specific PCR testing for the JAK2 V617F mutation
was performed as described previously [7]. This method used 2
primer pairs (Table 1) to specifically amplify the normal and
mutant sequences with a positive control band in a single run.
Amplifications were performed for 35 cycles with HotStar TaqH
polymerase (Qiagen, Valencia, CA), an annealing temperature of
60uC, and standard amplification condition. Products were
resolved on 3% agarose gels and visualized after staining with
ethidium bromide.
Sequencing
To verify the outcome by the MCA assay, we amplified ten
samples as determined by unlabeled probe melting using the same
primer pairs of MCA for sequencing analysis, in comparison with
the JAK2 reference DNA sequence (GenBank accession number
NT_008413.18). Amplicons were gel purified using the QIA-
quickH gel purification kit (Qiagen, Valencia, CA). DNA
sequencing analysis was performed in PRISMH 310 genetic
analyzer (Applied Biosystems, Foster City, CA). Given the limited
sensitivity of sequencing, the purified products were cloned into
the T-vector pMD-18T (TaKaRa BIO, Shiga, Japan) for the
samples with discrepant results for sequencing of cloned insert.
Validation of the method in three additional instruments
at two cities
It has been reported that important discrepancies could be
observed when one melting curve assay was used on different
Table 1. Sequences of primers and unlabeled probe for MCA
and ARMS.
Primer/probeSequence (59-39)
MCAForwardAGCTTTCTCACAAGCATTTGG
ReverseTGACACCTAGCTGTGATCCTG
ProbeAAATTATGGAGTATGTTTCTGTGGAGACGAGA
ARMS Outer primersForward TCCTCAGAACGTTGATGGCAG
ReverseATTGCTTTCCTTTTTCACAAGAT
Specific primers Wild type GCATTTGGTTTTAAATTATGGAGTATATG
Mutant GTTTTACTTACTCTCGTCTCCACAAAA
doi:10.1371/journal.pone.0026534.t001
Unlabeled Probe Melting Analysis of JAK2 V617F
PLoS ONE | www.plosone.org2 October 2011 | Volume 6 | Issue 10 | e26534

Page 3

instruments [23,24]. In order to know that whether the method
can generate reliable and highly reproducible data on all
commonly used real-time PCR instruments, we validated it with
three additional routine real-time instruments. We thus compared
the diagnostic accuracy of our method by analyzing the ten
samples on three instruments, in two separate laboratories in
Huashan Hospital of Shanghai and the First Affiliated Hospital of
Dalian Medical University respectively. In both laboratories the
detection was performed in a completely blind manner. After the
amplification, melting analysis on the LightCyclerH 480 (Roche,
Mannheim, Germany) was performed in Dalian with high-
resolution melting from 50uC to 85uC, 25 acquisitions/uC. The
results were analyzed in the Gene Scanning mode of the
LightCyclerH 480 software package. ABIH 7500 (Applied Biosys-
tems, Foster City, CA) and MastercyclerH ep realplex (Eppendorf,
Hamburg, Germany) were used in Shanghai. Melting curve
analysis was performed with the default settings on the ABIH 7500
System SDS 1.4 and Eppendorf MastercyclerH ep realplex 1.5
from 50uC to 85uC.
Results
Detection of the JAK2 V617F missense mutation
detection in patients with PV using unlabeled probe
MCA
After asymmetric PCR, the use of one primer in excess during
asymmetric PCR leads to the overproduction of the single target
strand and the probes anneal to these single-stranded products.
Melting curves can be divided into two regions, representing the
melting of probe/product and product/product strands, respec-
tively. Different alleles result in different probe/product melting
transitions based on the stability of the mismatches present. It is
preferable to see these transitions by plotting the negative
derivative (dF/dT) of fluorescence (F) versus temperature (T).
Probe-target melting for JAK2 V617F was observed between
50uC and 70uC. A perfectly matched probe-target hybrid has a
characteristic melting temperature that is higher than a mis-
matched hybrid. A closer examination of the region of probe
melting showed that samples with the T allele had a derivative
melting peak at 57.3uC, whereas samples harboring the G allele
showed a melting peak at 63.6uC (Figure 1). The heterozygous
samples showed two peaks, one at each temperature representing
the combination of both alleles. Therefore, a single probe was able
to recognize all three genotypes within the given sample set.
Cytogenetically, patients with polycythemia vera may be hetero-
zygous or homozygous for the JAK2 V617F mutation. It would be
difficult to distinguish a ‘‘true’’ heterozygous state at the single-cell
level for a clonal population of somatically mutated cells in a
background of wild type cells from peripheral blood, so none of the
current assays performed would be appropriate for reliably
establishing true heterozygosity or homozygosity for the mutation.
Thirty-seven out of 40 patients (92.5%) were positive for the
presence of JAK2 V617F mutation.
Analytical Sensitivity
In order to evaluate the sensitivity of our method, we mixed
wild type DNA with different concentrations (1%, 3%, 5%, 10%,
25%, and 50%) of mutant DNA. In this study, up to 3% of the
JAK2 V617F mutation was successfully detected in patients with
PV using unlabeled probe MCA (Figure 2).
To test intra- and inter-assay CV of the assay, we compared the
Tm of derivative melting peaks for T and G alleles obtained from
20 results of the same assay and 4 independent assays carried out
on different days. At the level of 5%, intra- and inter-assay CVs
ranged from 3.14%/3.55% and 1.72%/1.29%, respectively.
Detection of the JAK2 V617F missense mutation
detection in patients with PV using the ARMS assay and
sequencing
In the ARMS assay, outer primers flank the mutation region
and create a 463-bp control product. A wild type-specific forward
primer pairs with the reverse control primer to form a 229-bp
product; if JAK2 V617F is present, the mutation-specific reverse
primer will form a 279-bp product with the forward control primer
(Figure 3). Samples tested by the ARMS method revealed the
exact same results, indicating that our MCA achieves 100%
accuracy. Twenty randomly selected samples including eighteen
JAK2 V617F positive samples and two JAK2 V617F negative
samples identified by MCA were subject to direct sequencing.
There were two discrepant results, negative in the sequencing but
positive in the unlabeled probe MCA. After T-A cloning,
sequences of cloned PCR products revealed the mutation in the
two samples, suggesting the better detection sensitivity and
diagnostic efficiency of the unlabeled probe MCA.
Validation of the method in three additional instruments
The validation of the method was completed by analyzing ten
samples bearing different mutated sequences (8 JAK2 V617F
positive samples and 2 JAK2 V617F negative samples) in other
two different laboratories in Shanghai and Dalian, which had not
participated in the establishment of the unlabeled probe assay
methodology and were equipped with different real-time PCR
systems. Although shifting temperatures and shapes of curves were
somewhat different among the three instruments, results were
undoubtedly similar in their interpretation. Both laboratories
perfectly identified every mutated sample, without any change in
the experimental protocol confirming this unlabeled probe MCA
as a robust and efficient method even in an inter-laboratory
fashion. The sample with the G allele generated a melting peak of
63.8uC, 61.7uC and 63.4uC for LightCyclerH 480, ABIH 7500
real-time PCR system and MastercyclerH ep realplex respectively,
whereas sample with the T allele presented a melting peak of
57.9uC, 55.6uC and 57.5uC for LightCyclerH, ABIH 7500 and
MastercyclerH respectively (Figure 4).
Discussion
The JAK2 V617F mutation, first described in 2005, has become
an important diagnostic criterion in Philadelphia chromosome
negative myeloproliferative diseases, especially in polycythemia
vera (PV) [1–4]. In accordance with this, it has been recently
included in the World Health Organization (WHO) diagnostic
criteria for Philadelphia chromosome negative myeloid neoplasms
[5].Furthermore, pharmacological JAK2 inhibitors are a new type
of treatment for myelofibrosis and potentially other types of
myeloid neoplasms as well [25–27], reinforcing the need for a
convenient tool to detect this mutation.
In general, the PCR-RFLP [2], ARMS [7] and sequencing
[10,11] are common alterations for the detection of JAK2
mutation because they are suitable for small-scale diagnostic
procedures in individual hospital laboratories. However, both
ARMS and RFLP retain some technical challenges that must be
resolved, especially regarding the long turnaround time, low
throughput, poor sensitivity, and both methods are prone to DNA
contamination. Methods such as sequencing are also able to
identify SNPs, but require the purchase and setting up of special
sequencing facilities and additional sample preparation reagents
Unlabeled Probe Melting Analysis of JAK2 V617F
PLoS ONE | www.plosone.org3 October 2011 | Volume 6 | Issue 10 | e26534

Page 4

and steps. Furthermore, sequencing was unable to detect
mutations below an approximately 20% clonal load [28]. For this
reason, several kinds of different methodologies to analyze the
amplicons have been developed. Lay et al. [9], Ochsenreither et al.
[29] and Olsen et al. [30] described rapid PCR with fluorescently
labeled oligonucleotide hybridization probes as a molecular
diagnostic method to detect the JAK2 V617F missense mutation.
However, these studies used expensive reagents such as the
flurorophores, resulting in an increase in cost compared with any
other analysis.
High-resolution melting was recently introduced as a new
technique to genotype SNPs within small amplicons [31–33],
which was enabled by novel saturation dyes and high-resolution
instruments. Rapado et al. [34] developed the HRM analysis for
screening JAK2 V617F mutation in patients with myeloid
neoplasms. Although HRM analysis is sensitive, accurate and
elegant, it requires expensive instrumentation. Because of their
cost and complexity, these techniques might not be used routinely
by all laboratories.
Recently, an unlabeled probe assay with saturation dye for
genotyping was described [14–16]. This approach uses asymmet-
ric PCR in the presence of the DNA intercalating dye LC GreenH
with an unlabeled probe specific to the SNP of interest. Although
this method is superior to conventional HRM analysis in the
identification of many small insertions or deletions and some class
3 and 4 SNPs (,4% of human SNPs), differentiating between the
two possible homozygotes can be problematic when probes are not
used [35].
In this study, we developed a melting assay with unlabeled
probe for detection of the JAK2 V617F point mutation for use in a
routine diagnostic setting on Rotor-GeneH Q. Unlabeled probes
are usually approximately 30–40 bps in length and are blocked at
their 39-end to prevent extension [22,23], so a high sensitivity rate
can be obtained. By introducing an unlabeled probe covering the
SNP, the different genotypes can be clearly distinguished. This
method achieved 100% accuracy compared with ARMS results.
Each assay method was evaluated for sensitivity by running a serial
dilution panel of homozygous V617F HEL cell line DNA in wild
type DNA at concentrations of 1%, 3%, 5%, 10%, 25% and 50%.
Our laboratory defined a melting peak at 3% as a weak positive
result, although the threshold for a weak positive with this assay
may vary between laboratories.
Previous authors utilizing Real-time PCR analysis for JAK2
V617F detection have published assays showing variable sensitiv-
ity. Lay et al. [9] and Olsen et al. [30] used real-time PCR
methods and produced tests with analytical sensitivities of 5%.
According to the study of Qian et al. [36], up to 5% of the JAK2
V617F mutation was also successfully detected in patients with
myeloid neoplasms using HRM analysis. The analytic sensitivity of
our assay (3%) is at least equivalent to thet currently documented
qualitative real-time PCR test for JAK2 V617F. The method had
melting curves with robustly reproducible discernible differences
(within-run and between- run) down to the 5% level.
According to the literature [20–22], closed-tube genotyping
with unlabeled oligonucleotide probes can be performed on
several types of instruments. We validated the method as
Figure 1. Unlabeled probe MCA on Rotor-GeneH Q. Deivative (dF/dT) plot of melting curve consists of two melting regions. The probe-target
melting region lies in left side. Samples with the T allele (green) had a lower Tm of 57.3uC, while samples harboring the G allele (red) showed a Tm of
63.6uC. Therefore, the G/T heterozygous samples (blue) manifested both melting peaks of these alleles. Each genotype followed a unique path that
distinguished itself from the others.
doi:10.1371/journal.pone.0026534.g001
Unlabeled Probe Melting Analysis of JAK2 V617F
PLoS ONE | www.plosone.org4 October 2011 | Volume 6 | Issue 10 | e26534

Page 5

reproducible and transferable on three different instruments with
varied thermal melt resolution. We have shown that unlabeled
probes can be used to accurately determine genotype from
standard melting curves even on low resolution machines (ABIH
7500 and MastercyclerH ep realplex). In addtion, overcoming the
drawbacks of SYBR Green I, we employed the saturate interacting
dye SYTOH 9 [37] to support PCR amplification in a high
concentration of dye and produce robust DNA melting curves that
are not affected by DNA concentration [38,39], thus improving
the precision of melting temperature of the dissociation peak and
its signal strength.
In summary, we developed a novel unlabeled probe MCA that
utilizes asymmetric PCR followed by melting curve analysis to
detect the JAK2 V617F mutation. Either conventional real-time
Figure 2. Detecting sensitivity of unlabeled probe MCA on Rotor-GeneH Q. For standard heterozygous samples containing over 3% (blue) T
allele (mutation), there was a shape melting peak at Tm of the probe-mutation intermediates, which could be easily distinguishable from that of the
wild type melting transition.
doi:10.1371/journal.pone.0026534.g002
Figure 3. ARMS assay for JAK2 V617F. Of tracks for each sample, bands in 229-bp suggested the existence of the wild type allele, while a mutant
allele was indicated by the presence of a band in 279-bp. The 463-bp product served as a control of amplification. M, 2000 bp DNA ladder; 1, dd H2O
water control; 2, HEL cell line DNA as JAK2 V617F homozygous control; 3, RPMI82264 cell line DNA as wild type homozygous control; 4, Patient
sample with no JAK2 V617F mutation; 5, Patient sample harboring wild type/JAK2 V617F positive heterozygote.
doi:10.1371/journal.pone.0026534.g003
Unlabeled Probe Melting Analysis of JAK2 V617F
PLoS ONE | www.plosone.org5 October 2011 | Volume 6 | Issue 10 | e26534