Beneficial effect of melatonin treatment on inflammation, apoptosis and oxidative stress on pancreas of a senescence accelerated mice model.

Abstract

This study has investigated the effect of aging on parameters of inflammation, oxidative stress and apoptosis in pancreas obtained from two types of male mice models: senescence-accelerated prone (SAMP8) and resistant mice (SAMR1). Animals of 2 (young) and 10 months of age (old) were used (n = 64). The influence of the administration of melatonin in the drinking water for one month at two different dosages (1 and 10mg/(kg day) on old SAMP8 mice on these parameters was also studied. SAMP8 mice showed with age a significant increase in the relative expression of pancreatic genes involved in inflammation, oxidative stress and apoptosis. Furthermore the protein expression of several NFκB subunits was also enhanced. On the contrary aged SAMR1 mice did not show significant increases in these parameters. Melatonin administration to SAMP8 mice was able to reduce these age related alterations at the two used dosages.

Full text

Page 1

Beneficial effect of melatonin treatment on inflammation, apoptosis and oxidative
stress on pancreas of a senescence accelerated mice model
Sara Cuestaa, Roman Kireeva, Cruz Garcı ´ab, Katherine Formana, Germaine Escamesc, Elena Varab,
Jesu ´s A.F. Tresguerresa,*
aDepartment of Physiology, Medical School, University Complutense of Madrid, Complutense s/n. 28040, Madrid, Spain
bDepartment of Biochemistry and Molecular Biology, Medical School, University Complutense of Madrid, Complutense s/n. 28040, Madrid, Spain
cDepartment of Physiology, Institute of Biotechnology, University of Granada, Granada, Spain
1. Introduction
Aging is the time associated progressive accumulation of
changes related with or responsible for the ever-increasing
susceptibility to disease and death. Enhanced oxidative stress,
inflammation and apoptosis are the most common aging
associated alterations that can be used as markers of the process
(Harman, 1981). Progressive and irreversible physiological decline
is a characteristic of all organisms late in life. Aging can affect gene
regulation (Helenius et al., 2001) and is accompanied by evident
activation of inflammatory pathways and enhanced apoptosis
(Zhang and Herman, 2002; Tresguerres et al., 2008).
Elderly humans have altered cellular redox levels and
suppressed regenerative responses, both of which are key events
underlying the progression of chronic degenerative diseases of
aging, such as diabetes mellitus. Poorly maintained cellular redox
levels lead to elevated activation of nuclear transcription factors
such as NFkB (nuclear factor kappa beta) and AP-1. These factors
are coordinately responsible for a huge range of extracellular
signalling molecules responsible for inflammation, tissue remo-
delling, oncogenesis and apoptosis progresses that orchestrate
many of the degenerative processes associated with aging (Hu
et al., 2000).
Aging is usually associated with decreasing glucose tolerance
and to increase susceptibility to diabetes (De Fronzo, 1984). It was
also shown that insulin secretion in rabbits was reduced with age
(Reaven and Reaven, 1981). The decreased ability to maintain
carbohydrate homeostasis may be a major factor in the pathogen-
esis of age-induced diabetes (Meites et al., 1987). Increasing
evidence suggests that pancreatic islet dysfunction in type 2
diabetes can be promoted by an inflammatory process. Indeed,
pancreas of patients with type 2 diabetes are characterized by the
enhancement of cytokines, immune cells, NFkB activation, beta
cell apoptosis, amyloid deposits, and fibrosis (Donath et al., 2008).
Melatonin is an endogenous chemical mediator, which
regulates the circadian rhythm and it has also a number of other
important functions, like powerful anti-inflammatory and antioxi-
dant activities which have been tested in several experimental
studies. For example melatonin was shown to modulate the
inflammatory process associated with pancreatitis and also to
Mechanisms of Ageing and Development 132 (2011) 573–582
A R T I C L E
I N F O
Article history:
Received 16 March 2011
Received in revised form 4 October 2011
Accepted 8 October 2011
Available online 17 October 2011
Keywords:
Pancreas
Aging
Inflammation
Cytokines
Senescence accelerated mouse
Melatonin
A B S T R A C T
This study has investigated the effect of aging on parameters of inflammation, oxidative stress and
apoptosis in pancreas obtained from two types of male mice models: senescence-accelerated prone
(SAMP8) and resistant mice (SAMR1). Animals of 2 (young) and 10 months of age (old) were used
(n = 64). The influence of the administration of melatonin in the drinking water for one month at two
different dosages (1 and 10 mg/(kg day) on old SAMP8 mice on these parameters was also studied.
SAMP8 mice showed with age a significant increase in the relative expression of pancreatic genes
involved in inflammation, oxidative stress and apoptosis. Furthermore the protein expression of several
NFkB subunits was also enhanced. On the contrary aged SAMR1 mice did not show significant increases
in these parameters. Melatonin administration to SAMP8 mice was able to reduce these age related
alterations at the two used dosages.
? 2011 Published by Elsevier Ireland Ltd.
Abbreviations: SAMP, senescence-accelerated prone mouse; SAMR, senescence
accelerated-resistant mouse; Mel, melatonin; RT-PCR, reverse transcription
polymerase chain reaction; RNA, ribonucleic acid; cDNA, complementary DNA;
SG, SYBR-Green; HOMA-IR, homeostatic model assessment-insulin resistance;
XIAP, X-inhibitor apoptosis.
* Corresponding author at: Laboratory of Experimental Endocrinology, Depart-
ment of Physiology, School of Medicine, Complutense University, Avda, Complu-
tense s/n. 28040, Madrid, Spain. Tel.: +34 91 3941484; fax: +34 91 3941628.
E-mail address: guerres@med.ucm.es (Jesu ´s A.F. Tresguerres).
Contents lists available at SciVerse ScienceDirect
Mechanisms of Ageing and Development
jo ur n al ho mep ag e: www .elsevier .c om /lo cate/m ec hag ed ev
0047-6374/$ – see front matter ? 2011 Published by Elsevier Ireland Ltd.
doi:10.1016/j.mad.2011.10.005

Page 2

reduce lipid peroxidation. It has also been shown to be helpful in
wound healing and tissue regeneration in other experimental
models. Melatonin has also been found to be a free radical
scavenger (Tan et al., 1994, 1998; Matuszek et al., 1997) and
antioxidant (Reiter, 1995, 1998; Reiter et al., 1981). Since pineal
melatonin production is diminished as rodents age (Reiter et al.,
1981, 1998), it has been speculated that the loss of activity of this
antioxidant could contribute to the accumulation of free radical
damage that occurs in the later stages of life of different species
(Reiter, 1997, 1998).
The senescence-accelerated prone strain of mice (SAMP) has
already demonstrated senescence acceleration so that at 10
months of age, animals show a hyper oxidative stress status that
has been proposed as one of the responsibles for its deterioration,
in contrast with the accelerated senescence-resistant mice (SAMR)
(Ames et al., 1993; Takeda et al., 1997; Mori et al., 1998; Takeda,
1999; Hosokawa, 2002) that are not so severely affected and can be
used as there controls.
This paper investigates the effect of aging on parameters related
to inflammation, oxidative stress and apoptosis in pancreas
obtained from SAMP8 and SAMR1 mice as models of aging. The
study also analyzed the possible beneficial effects on these
parameters of a chronic treatment with melatonin, at two different
doses.
2. Materials and methods
2.1. Chemicals
Melatonin was obtained from Sigma Chemicals (USA). Other reagents were of the
highest quality available and obtained from different commercial companies.
2.2. Animals and treatment
Male senescence-accelerated mice (SAMP8) and resistant mice (SAMR1) of 2
(young) and 10 months (old) of age were used (total n = 64). Animals were divided
into eight experimental groups (8 animals per group), four from each strain: two old
untreated control groups, two young control groups and four old melatonin-treated
groups. They were all housed and maintained in a room at 22 ? 2 8C, with automatic
light cycles (12-h light/darkness) and standard diet ad libitum. All the animals received
humane care according to the Guidelines for Ethical Care of Experimental Animals of
the European Union.
Melatonin was provided at two different dosages (1 and 10 mg/(kg day). It was
dissolved in absolute ethanol and added to the drinking water in a final ethanol
concentration of 0.066%. The real dosage of melatonin was calculated taking into
account its dilution in the drinking water, the amount of water consumed daily
and the weight of the animals. The water consumption per day was approximately
8–10 ml. In the drinking water, melatonin concentration was different depending
on the two groups of treated animals. In group one was 33.3 mg/ml and in the other
group was 333 mg/ml. Melatonin was given over 24 h, but we need to take into
account that during the day these animals were sleeping, so, normally more than
80% of the water was drunk during there activity phase, in the night. Water bottles
were covered with aluminium foil to be protected from light, and the drinking
fluid was changed three times a week, depending on the water consumption and
the weight of the animals. Untreated animals received 0.1% alcohol in tap water.
After 30 days of treatment, animals were killed by cervical dislocation followed by
decapitation and pancreas were collected and immediately frozen in liquid
nitrogen.
2.3. RNA isolation and RT-PCR quantification
RNA was isolated from pancreas samples of male mice using the kit RNeasy total
rna kit ref. 50974104 (Qiagen) and following the manufacturer’s protocol. The
purity of the RNA was estimated by 1.5% agarose gel electrophoresis, and RNA
concentration was determined by spectrophotometry. Reverse transcription of
2 mg RNA for cDNA synthesis was performed using the Reverse Transcription
System, (Promega, Madison, WI, USA) and a pd (N) 6 random hexamer. RT-PCR was
performed in an Applied Biosystems 7300 apparatus using the SYBR Green PCR
Master Mix (Applied Biosystems, Warrington, UK) and 300 nM concentrations of
specific primers (Table 1). The thermo cycling profile conditions used were: 50 8C
for 2 m, 95 8C for 10 m (followed by 40 cycles), 95 8C for 15 s, 60 8C for 1 m, 95 8C for
15 s, 60 8C for 30 s and 95 8C for 15 s. For the normalization of cDNA loading in the
PCR, the amplification of 18S rRNA for every sample was used. Relative changes in
gene expression were calculated using the 2-DDCT method (Livak and Schmittgen,
2001).
2.4. Preparation of pancreas homogenates and determinations of cytokines
Pancreas were quickly dissected and frozen in dry ice. Frozen organ samples
were weighed and transferred to 50 ml polypropylene tubes (Falcon; Becton
Dickinson, Lincoln Park, NJ) containing lysis buffer (4 8C) at a ratio of 10 ml buffer/
1 g of wet tissue. Lysis buffer consisted of 1 mM phenylmethylsulfonyl fluoride
(PMSF; Sigma Chemical Company), 1 mg/ml pepstatin A (Sigma Chemical
Company), aprotinin (Sigma Chemical Company) and leupeptin (Sigma Chemical
Company) in 1? phosphate buffered saline solution of pH 7.2 (Biofluids, Rockville,
MD) containing 0.05% sodium azide (Sigma Chemical Company). Samples were
homogenized for 30 s with an electrical homogenizer (Polytron; Brinkmann
Instruments, Westminster, NY) at maximum speed, and the tubes were
immediately frozen in liquid nitrogen. The samples were homogenized three
times for optimal processing. The homogenates were later thawed in 37 8C water
bath and centrifuged at 119,000 ? g (1 h, 4 8C) to separate cellular organelles. The
supernatants were frozen at ?80 8C to allow the formation of macromolecular
aggregates. After thawing at 4 8C, the aggregates were pelleted at 3000 ? g (4 8C),
and the final organ homogenate volume was measured with a graduated pipette.
The homogenates were stored at ?80 8C until assayed for the quantitative presence
of cytokines. TNF-a, IL-1b, IL-6, IL-2, MCP1, IL-4 and IL-10 were measured in
pancreas homogenates collected from all groups of mice with an ELISA kit according
to the manufacturer’s instructions (BioNOVA Cientifica Ltd., Madrid, Spain).
Table 1
Primers used in real-time PCR experiments.
Primers
Sequence (50–30)
18S
Forward
Reverse
GGTGCATGGCCGTTCTTA
TCGTTCGTTATCGGAATTAACC
TNF-a
Forward
Reverse
ATGAGAAGTTCCCAAATGGC
CTCCACTTGGTGGTTTGCTA
IL-1b
Forward
Reverse
TGTGATGAAAGACGGCACAC
CTTCTTCTTTGGGTATTGTTTGG
iNOS
Forward
Reverse
CTTTGCCACGGACGAGAC
TCATTGTACTCTGAGGGCTGAC
Bcl-2
Forward
Reverse
CAGGTATGCACCCAGAGTGA
GTCTCTGAAGACGCTGCTCA
BAD
Forward
Reverse
GCCCTAGGCTTGAGGAAGTC
CAAACTCTGGGATCTGGAACA
XIAP
Forward
Reverse
GCTTGCAAGAGCTGGATTTT
TGGCTTCCAATCCGTGAG
18S was used as a housekeeping gene to compare the samples.
Table 2
Multifactorial ANOVA to deal the effect of aging, melatonin dose and strain.
Multifactorial ANOVA p value
Age
Melatonin dose
Strain
mRNA expression
IL-1b
TNF-a
iNOS
BAD
Bcl-2
XIAP
0.009
0.01
0.1
0.08
0.12
0.003
0.07
0.009
0.1
0.04
0.002
0.001
0.002
0.007
0.06
0.006
0.001
0.01
Concentration (pg/ml)
IL-1b
TNF-a
IL-10
IL-6
0.2
0.044
0.07
0.004
0.043
0.001
0.07
0.001
0.001
0.003
0.1
0.001
Protein expression
IL-1b
TNF-a
IL-10
HO-1
NFkB p65
NFkB p50
NFkB p52
IkB alpha
IkB beta
0.2
0.002
0.6
0.001
0.11
0.02
0.001
0.06
0.002
0.01
0.001
0.6
0.001
0.003
0.9
0.001
0.001
0.04
0.01
0.8
0.1
0.001
0.01
0.08
0.02
0.001
0.001
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
574

Page 3

2.5. Western blotting analysis
Western blots were used to measure the protein expression of TNF-a, IL-1b, IL-
10, HO-1, HO-2, as well as NFkB p50 (and its precursor p105), NFkB p52 (and its
precursor p100), NFkB p65 and IkBa and b. Briefly, pancreas samples (50–60 mg)
after homogenization with lysis buffer were boiled with gel-loading buffer
(0.100 M Tris–Cl; 4% SDS; 20% glycerol; 0.1% bromophenol blue) in the ratio 1:1,
samples were sonicated and protein concentrations were determined by the
Bradford methods. Total protein equivalents (30 mg) for each sample were
separated by SDS-PAGE by using 10% acrylamide gels and were transferred onto
nitrocellulose membrane in a semi-dry transfer system. The membrane was
immediately placed into blocking buffer containing 5% nonfat milk in 20 mM Tris,
pH 7.5; 150 mM NaCl; and 0.01% Tween-20. The blot was allowed to block at 37 8C
for 1 h. The membrane was incubated with rabbit polyclonal TNF-a, IL-1b and IL-
10 (1:4000) for all night at 4 8C, followed by incubation in an anti-rabbit IgG-
horseradish peroxidase conjugated antibody (1:2000). Western blotting with
rabbit polyclonal HO-1, HO-2, NFkB p50 (and its precursor p105), NFkB p52 (and
its precursor p100), and NFkB p65 (1:1000) were also performed. After washing
with T-TBS, the membranes were incubated with ECL Plus detection reagents
(Amersham Life Science Inc., Buckinghamshire, UK) and exposed to X-ray film. The
films were scanned with a densitometer (BioRad GS 800) to determine the relative
optical densities. Pre-stained protein markers were used for molecular weight
determinations.
2.6. NOxdetermination
Nitric oxide metabolites (NOx) level in pancreas homogenate were measured by
the Griess reaction as NO2?concentration after NO3reduction to NO2?. Briefly, after
incubation of the supernatants with Escherichia coli NO3reductase and NADPH+
(37 8C, 30 min), 1 ml of Griess reagent (0.5% naphthylenediamine dihydrochloride,
5% sulfonylamide, 25% H3PO4) was added. The reaction was performed at 22 8C for
20 min, and the absorbance at 546 nm was measured, using NaNO2solution as
standard. Protein determination was performed by the Bradford method. The basis
of this method is the addition of Coomassie brilliant blue dye to proteins. This union
induces a shift in maximum dye absorbance from 465 to 595 nm. Absorbance is
measured at 595 nm and compared with a known standard curve.
2.7. Statistical analysis
Results are expressed as the mean ? S.E.M. Data were analyzed by a multifactorial
ANOVA, using the Statgraphics program (StatPoint Technologies, Inc., Warrenton, VA,
USA) and adding a Fisher test when significant differences were detected. In these tests,
Fig. 1. Effect of aging and melatonin administration on (a) protein expression, (b) mRNA expression and (c and d) protein levels of IL-1b in pancreas from male young and old
SAMR1/SAMP8 mice. N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
575

Page 4

data were considered to be significant, when p value was <0.05. To deal the effects of
aging, melatonin dose and strain a multifactorial ANOVA was performed (Table 2).
3. Results
The protein (Fig. 1a) and mRNA (Fig. 1b) expressions in
pancreas of IL-1b were significantly elevated in old SAMP8 mice as
compared with young animals (p < 0.05). Similar results were
observed using ELISA (Fig. 1c) measurements, higher levels of IL-
1b found in old SAMP8 mice (p < 0.001) as compared to young
ones. Melatonin treatments showed a significant decrease in
mRNA expressions (p < 0.05) at the two doses used. However no
significant differences were observed in protein expression of IL-
1b, although the levels of this cytokine showed a dose dependent
decrease after melatonin treatments.
In SAMR1 mice, no significant differences were observed
between young and old animals. After melatonin treatments a
tendency to the reduction of protein expression and levels of IL-1b
was observed but without statistical significance (Fig. 1d).
The protein (Fig. 2a) and mRNA (Fig. 2b) expressions of TNF-a
were significantly elevated in pancreas of old SAMP8 mice as
compared with young animals (p < 0.05). ELISA measurements
confirm these enhancements in old SAMP8 mice (Fig. 2c).
Significantly higher TNF-a mRNA expression were observed in
old SAMP8 mice as compared with old SAMR1 animals. Melatonin
treatments showed a significant TNF-a decrease both in protein
and mRNA expressions (p < 0.05) with the two doses of the
hormone. The treatments were also able to decrease the levels of
TNF-a in pancreas of old SAMP8 mice. No significant differences
were observed in SAMR1 mice, neither with aging nor with
melatonin treatments.
The level of anti-inflammatory IL-10 was decreased during
aging in SAMP8 mice (p < 0.05) (Fig. 3b). However protein
expression of this cytokine was only slightly decreased but
Fig. 2. Effect of aging and melatonin administration on (a) protein expression, (b) mRNA expression and (c and d) protein levels of TNF-a in pancreas from male young and old
SAMR1/SAMP8 mice. N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
576

Page 5

without statistical significance (Fig. 3a). Melatonin treatments
were able to increase the protein expression and the levels of IL-10
in a dose dependent manner (p < 0.05). In SAMR1 mice, levels of IL-
10 showed an increase with age (p < 0.05). Furthermore a decrease
in the levels of IL-10 in SAMR1 mice (p < 0.05) was observed with
the melatonin treatments (Fig. 3c).
Levels of pro-inflammatory cytokine IL-6 were also increased with
aging in both SAMP8 (p < 0.001) (Fig. 4a) and SAMR1 mice (p < 0.05)
(Fig. 4b). Melatonin was able to decrease the levels of IL-6 in both mice
strains: SAMP8 (p < 0.001) and SAMR1 (p < 0.05) (Fig. 4).
Protein expression of HO-1 was increased in old male SAMP8
mice as compared to young animals of the same strain (p < 0.05).
No differences were observed in protein expression of HO-1 with
the lowest melatonin dose, but when treated with 10 mg protein
expression of HO-1 was decreased (p < 0.05). No significant
differences were observed in SAMR1 mice neither with age nor
with the treatments. Higher protein expression of HO-1 was
observed in young SAMR1 mice as compared with young SAMP8
animals (p < 0.05) (Fig. 5a).
The mRNA expression of iNOS was also elevated with aging in
male SAMP8 mice and showed a significant decrease with
melatonin treatments (p < 0.01). Old SAMP8 animals showed a
significant increase of iNOS as compared to old SAMR1 mice
(p < 0.01) (Fig. 5b). No significant differences were observed
between young and old SAMR1 mice.
The levels of NOxshowed a significant enhancement with age in
SAMP8 mice (p < 0.05) as compared with young animals of the
same strain. No significant differences were observed with the
lowest dose of melatonin, but treatment with 10 mg of the
hormone was able to decrease NOxlevels (p < 0.05) (Fig. 6a). No
statistical differences were observed in SAMR1 mice (Fig. 6b)
neither with age nor with the treatments.
The mRNA expression of pro-apoptotic gene BAD was
significantly elevated with aging (p < 0.05) in SAMP8 mice.
Fig. 3. Effect of aging and melatonin administration on (a) protein expression and (b and c) protein levels of IL-10 in pancreas from male young and old SAMR1/SAMP8 mice.
N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
577

Page 6

Melatonin treatment with 1 mg was able to significantly decrease
its expression. No differences were observed when animals were
treated with 10 mg of the compound. The mRNA expression of BAD
was elevated in old SAMP8 mice as compared with old SAMR1
animals (p < 0.05) (Fig. 7a). In contrast, mRNA expression of anti-
apoptotic Bcl-2 were significantly decreased in old SAMP8 mice
(p < 0.05) and no differences were observed with melatonin
treatments. Bcl-2 mRNA expression were lower in young and old
SAMR1 animals as compared with age matched SAMP8 mice
(Fig. 7b).
XIAP mRNA expression was decreased with age in SAMP8 mice
(p < 0.05) and only the highest dose of melatonin was able to
increase its expression (p < 0.05). In SAMR1 mice no statistical
differences between young and old animals were found. XIAP
mRNA was also lower in SAMR1 young mice as compared with age
matched SAMP8 animals (p < 0.05) (Fig. 7c).
The relationship between anti and pro-apoptotic markers (Bcl-
2/BAD) was decreased in old SAMP8 animals as compared with
young mice (p < 0.05) thus indicating the preponderance of the
later. This ratio was increased only with 10 mg melatonin
treatment (p < 0.05). No statistical differences between young
and old animals were found in SAMR1 mice. A significant increase
in young SAMP8 was observed as compared to SAMR1 mice
(Fig. 7d).
Protein expression of NFkB p65 was increased in old SAMP8
mice as compared with young animals (p < 0.05) but no
differences were observed when treated with both melatonin
dosages (Fig. 8a). Protein expression was also lower in SAMP8
young mice as compared with SAMR1 animals (p < 0.05). No
significant differences in protein expression of NFkB p50 were
observed neither in old SAMP8 mice as compared with young
(Fig. 8b) nor in old animals after melatonin treatments. In young
SAMP8 mice, lower protein expression of NFkB p50 was observed
as compared with young SAMR1 mice. Protein expression of NFkB
p52 was increased with aging in SAMP8 mice (p < 0.05) and only
the treatment with 10 mg melatonin was able to reduce its
expression (Fig. 8c). In SAMR1 mice, NFkB p52 was increased with
aging (p < 0.05), but no differences were observed with melatonin
treatments. No significant differences were observed in other NFkB
subunits in SAMR1 mice (Fig. 8).
Protein expression of IkB alpha was decreased with aging in
SAMP8 mice (p < 0.05). Both doses of melatonin treatment were
able to increase its expression (p < 0.05). No significant differences
were observed in SAMR1 mice. Furthermore, an increase in protein
Fig. 4. IL-6 levels in pancreas of SAMP8 and SAMR1 mice. N = 8 animals per group.
Fig. 5. Protein expression of (a) HO-1 and mRNA expression of (b) iNOS in pancreas
of SAMP8 and SAMR1 mice. N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
578

Page 7

expression in young SAMP8 animals as compared with young
SAMR1 mice was observed (Fig. 9a). IkB beta subunit was
increased in old SAMP8 mice (p < 0.05), and only the highest
dose of melatonin was able to decrease its expression (Fig. 9b). No
significant differences in protein expression of these subunits were
observed in SAMR1 mice.
4. Discussion
In our present paper, an increase in the protein and mRNA
expressions of cytokines such as TNF-a, IL-1b, IL-6 and oxidative
stress markers such as HO-1, iNOS together with a decrease in the
expression of IL-10 levels, and an increase in protein expression of
NFkB, have been observed during aging in the pancreas specially in
SAMP8 mice. Old SAMR1 mice have been shown to be less affected
by aging when compared with age matched SAMP8 animals.
HO is a mediator of cellular and systemic defences that plays a
role in the regulation of leukocyte function and inhibits the
expression of proinflammatory cytokines (Seta et al., 2006). HO-1
is an inducible isoform, whereas HO-2 is constitutive but with an
unknown role (Seta et al., 2006; Abraham and Kappas, 2005). The
anti-inflammatory function is linked to HO-1, that has been also
shown to display anti-apoptotic and anti-proliferative effects
(Morse and Choi, 2002). It is strongly induced in response to
changes in cellular redox status or oxidative insults, to confer
cytoprotection (Ito et al., 2009; Michel and Feron, 1997). The
induction of HO-1 observed in old SAMP8 mice in our study might
mean that this defence mechanism has been activated in the
pancreas of those animals to compensate the increased oxidative
stress associated with aging.
It has been demonstrated that iNOS expression is increased in
several tissues of aged subjects (Li et al., 2009; Song et al., 2009).
Previous studies of our group have demonstrated that iNOS
expression was increased in liver and heart of old male SAMP8
mice and old female rats (Cuesta et al., 2010; Forman et al., 2010;
Kireev et al., 2008). Our recent results in the pancreas are in
accordance with previous data, since mRNA expression of iNOS in
old SAMP8 mice was also increased in liver and heart (Cuesta et al.,
2010; Forman et al., 2010), whereas no differences were observed
in age matched SAMR1 mice. NOx content was analyzed by
spectrophotometry in the pancreas and an increase was observed
in old SAMP8 animals as compared with young ones. This
substance has been implicated in a wide range of diverse
pathophysiological processes (Stoclet et al., 1999) that maybe
due to an increase in NO expression and superoxide production
(O2?) which leads to peroxynitrite accumulation and cell death
(Beckmann et al., 1994).
NFkB is a pleiotropic mediator in the control of several
inducible and tissue-specific genes (Lenardo and Baltimore,
1989) and is one of the key regulators of the cellular responses
to oxidative stress in mammalian cells (Helenius et al., 2001; Valen
et al., 2001). Other researchers have shown that NFkB-binding
activity in the nucleus increased significantly with age in mice and
rat tissues and might have profound effects on the efficiency of
gene expression during stress and on the maintenance of normal
cellular homeostasis in aging tissues (Helenius et al., 2001). In our
data, the increase observed in NFkB p65 and p52 protein levels
with age might lead to the interpretation that this activation is
intimately related with the increase in oxidative stress and
cytokine expressions observed, which indicated also a tendency to
inflammation. NFkB, probably, is activating, pro-inflammatory
cytokines and different enzymes – at nuclear level a fact that has
been demonstrated by other groups (Chung et al., 2002). Our
results supported this idea with the observed increase in IL-1b, IL-
6 and TNF-a together with HO-1 and iNOS expressions and
decreased levels of IL-10. Previous studies of our group have shown
a similar situation in the liver of old female rats, where the levels of
HO-1, iNOS, TNF-a, IL-1, IL-6, LPO and NOxwere elevated in old
intact and specially in old ovariectomized animals (Kireev et al.,
2008, 2010). Furthermore, the protein levels and the mRNA
expression of IL-1b, TNF-a have been also shown to be elevated in
liver (Cuesta et al., 2010) and heart (Forman et al., 2010) of old
SAMP8 male mice, when compared with SAMR1 animals. Other
groups, have also shown that protein levels of IL-1b, TNF-a and IL-
6 and the mRNA expression of IL-1b were elevated in the
hippocampus of 10 months old SAMP8 male mice, when compared
with age-matched SAMR1 animals (Tha et al., 2000).
The most important regulators of mammalian NFkB are the IkB
family (Arenzana-Seisdedos et al., 1997). In our actual study
protein expression of IkBa was decreased, whereas the protein
expression of IkBb was increased in old SAMP8 mice as compared
with young animals. IkBa acts as a ‘‘control mechanism’’ and can
induce the re-exportation of NFkB to the cytoplasm since in our old
animals this expression was decreased and NFkB in the nucleus
could easily activate genes of inflammation and apoptosis.
During aging the mRNA expression of Bcl-2 was decreased
significantly in SAMP8 mice and an increase was detected in mRNA
expression of BAD. The increase in BAD together with the decrease
Fig. 6. NOxlevels in pancreas of (a) SAMP8 and (b) SAMR1 mice. N = 8 animals per
group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
579

Page 8

in Bcl-2 indicates the existence of a proapoptotic situation in
SAMP8 mice. No differences were observed in SAMR1 animals.
XIAP inhibits the caspases that lead to the initiation of the
apoptosis cascade (e.g. caspase-9) as well as those that participate
in the final events (e.g. caspase-3). Extensive data from both in
vitro and in vivo systems have demonstrated that increasing XIAP
can suppress apoptosis triggered by diverse stimuli (Deveraux
et al., 1997, 1998). In our results a decrease in XIAP mRNA
expression in old SAMP8 mice has been observed. In SAMR1 mice
no differences were detected with age. This should indicate that
old SAMP8 animals have a less protective effect of anti-apoptotic
genes and thus a higher degree of apoptosis.
Melatonin is involved in many physiological functions and has
also been shown to display oncostatic, anti-aging and inmuno-
modulatory properties (Baeza et al., 2009; Rodrı ´guez et al., 2007;
Cos et al., 1998). Administration of exogenous melatonin to old
animals was able to significantly lower the levels, protein and
mRNA expression of TNF-a, to decrease mRNA expression and
levels of IL-1b and to increased the protein levels of IL-10 as
measured by ELISA in SAMP8 mice. In this mice strain, melatonin
was also able to increase the levels of this anti-inflammatory
cytokine in a dose dependent manner. On the contrary, in SAMR1
mice, melatonin administration decreased its levels. Melatonin
was also able to reduce the levels of the pro-inflammatory cytokine
Fig. 7. mRNA expression of (a) BAD, (b) Bcl-2 and (c) XIAP in pancreas of SAMP8 and SAMR1 mice. Furthermore we analyzed the ratio (d) Bcl-2/BAD. N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
580

Page 9

IL-6. So, according to our results, melatonin treatment was only
able to diminish the inflammatory status in old SAMP8 animals.
Furthermore protein expression of HO-1 was reduced with the
highest melatonin dose of 10 mg. In addition iNOS mRNA
expression showed a significant decrease with melatonin treat-
ment reaching values similar to those found in young SAMP8
animals. Melatonin 10 mg treatment was also able to reduce NOx
levels in old SAMP8 mice. These data indicate that melatonin
administration was able to reduce the increased oxidative stress
associated with age in these animals. In SAMR1 mice no statistical
differences between young and old animals were found in protein,
mRNA and ELISA measurements of all parameters analyzed.
The highest dose of melatonin was able to increase the anti-
apoptotic status in SAMP8 mice by also increasing mRNA
expressions of XIAP and Bcl-2.
The basis for the protective effects of antioxidants like
melatonin on all the models is consistent with its interference
with the NFkB transcriptional system, which drives the expression
of several genes that are activated during inflammation, apoptosis
and oxidative stress (Sasaki et al., 2002). Treatment with melatonin
was able to decrease protein expression of NFkB p52. However, no
significant differences were observed in protein expression of
NFkB p65 and p50. On the other hand, IkB alpha protein expression
was increased with melatonin and no significant differences were
observed with the treatments in the expression of IkB beta protein.
Other groups have also reported a significant age-related increase
Fig. 8. Protein expression of (a) NFkB p65, (b) NFkB p50 and (c) NFkB p52 in
pancreas of SAMP8 and SAMR1 mice. N = 8 animals per group.
Fig. 9. Protein expression of (a) IkB alpha and (b) IkB beta in pancreas of SAMP8 and
SAMR1 mice. N = 8 animals per group.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
581

Page 10

in the protein levels of the p52 subunit together with increased
nuclear NFkB-binding activity in the liver of old rats (Helenius
et al., 2001). On the contrary, the protein level of p50 did not show
changes with age in the liver from old rats (Helenius et al., 1996).
So, according to our results the most important NFkB member in
the aging process seems to be NFkB p52. Our group also analyzed
these NFkB components in heart (Forman et al., 2010) and
pancreas of old SAMP8 mice and observed similar results (Cuesta
et al., 2011 Rejuvenation Research [Epub ahead of print]).
5. Conclusion
Pancreas of old SAMP8 mice showed a significant increase in
oxidative stress, inflammatory situation and pro-apoptotic status
that was not present in SAMR1 animals.
Melatonin treatment was able to improve pancreatic function
in the former by reducing not only the age associated inflammatory
status but also by reducing apoptotic and oxidative stress markers
and NFkB activity in old SAMP8 animals.
Acknowledgements
This work has been possible through grants from Instituto de
Salud Carlos III (RETICEF RD06/0013 RD06/0013/0008), Consejerı ´a
de Innovacio ´n, Ciencia y Empresa, Junta de Andalucı ´a (P07-CTS-
03135), PI081644 (ISCIII) and SAF 2007 66878-C02-01. Thanks are
given to D. Campon for his technical support.
References
Abraham, N.G., Kappas, A., 2005. Heme oxygenase and the cardiovascular–renal
system. Free Radic. Biol. Med. 39, 1–25.
Ames, B.N., Shigenaga, M.K., Hagen, T.M., 1993. Oxidants, antioxidants, and the
degenerative diseases of aging. PNAS 90, 7915–7922.
Arenzana-Seisdedos, F., Turpin, P., Rodriguez, M., Thomas, D., Hay, R.T., Virelizier,
J.L., Dargemont, C., 1997. Nuclear localization of IkBa promotes active transport
of NF-kB from the nucleus to the cytoplasm. J. Cell Sci. 110, 369–378.
Baeza, I., Alvarado, C., Alvarez, P., 2009. Improvement of leucocyte functions in
ovariectomised aged rats after treatment with growth hormone, melatonin,
oestrogens or phyto-oestrogens. J. Reprod. Immunol. 80, 70–79.
Beckmann, J.S., Ye, Y.Z., Anderson, P.G., Chen, J., Accavitti, M.A., Tarpey, M.M., White,
C.R., 1994. Extensive nitration of protein tyrosines in human atherosclerosis
detected by immunohistochemistry. Biol. Chem. Hoppe Seyler 375, 81–88.
Chung, H.Y., Kim, H.J., Kim, K.W., 2002. Molecular inflammation hypothesis of aging
based on the anti-aging mechanism of calorie restriction. Microsc. Res. Technol.
59, 264–272.
Cos, S., Ferna ´ndez, R., Guezmes, A., 1998. Influence of melatonin on invasive and
metastatic properties of MCF-7 human breast cancer cells. Cancer Res. 58,
4383–4390.
Cuesta, S., Kireev, R., Forman, K., Garcı ´a, C., Escames, G., Ariznavarreta, C., Vara, E.,
Tresguerres, J.A., 2010. Melatonin improves inflammation processes in liver
of senescence-accelerated prone male mice (SAMP8). Exp. Gerontol. 45 (12),
950–956.
Cuesta, S., Kireev, R., Forman, K., Garcı ´a, C., Ariznavarreta, C., Vara, E., Tresguerres,
J.A.F., 2011. Effect of GH treatment on pancreas inflammation, oxidative stress
and apoptosis related to aging in SAMP8 mice. Rejuvenation Res. September 29
(Epub ahead of print).
De Fronzo, R.A., 1984. Glucose intolerance of aging. Diabetes Care 4, 493–513.
Deveraux, Q.L., Roy, N., Stennicke, H.R., Van Arsdale, T., Zhou, Q., Srinivasula, S.M.,
1998. IAPs block apoptotic events induced by caspase-8 and cytochrome c by
direct inhibition of distinct caspases. EMBO J. 17, 2215–2223.
Deveraux, Q.L., Takahashi, R., Salvesen, G.S., Reed, J.C., 1997. X-linked IAP is a direct
inhibitor of cell-death proteases. Nature 388, 300–304.
Donath, M.Y., Storling, J., Berchtold, L.A., Billestrup, N., Mandrup-Poulsen, T., 2008.
Cytokines and beta-cell biology: from concept to clinical translation. Endocr.
Rev. 29 (3), 334–350.
Forman, K., Vara, E., Garcı ´a, C., Kireev, R., Cuesta, S., Acun ˜a-Castroviejo, D., Tres-
guerres, J.A., 2010. Beneficial effects of melatonin on cardiological alterations in
a murine model of accelerated aging. J. Pineal Res. 49 (3), 312–320.
Harman, D., 1981. The aging process. Medical sciences. Proc. Natl. Acad. Sci. U.S.A.
78 (11), 7124–7128.
Helenius, M., Ha ¨nninen, M., Lehtinen, S.K., 1996. Aging-induced up-regulation of
nuclear binding activities of oxidative stress responsive NF-kB transcription
factor in mouse cardiac muscle. J. Mol. Cell Cardiol. 28, 487–498.
Helenius, M., Kyrylenko, S., Vehvila ¨inen, P., 2001. Characterization of aging-associ-
ated up-regulation of constitutive nuclear factor-kappa B binding activity.
Antioxid. Redox Signal. 3, 147–156.
Hosokawa, M., 2002. A higher oxidative status accelerates senescence and aggra-
vates age-dependent disorders in SAMP strains of mice. Mech. Ageing Dev. 123,
1553–1561.
Hu, H., Forsey, R.J., Blades, T.J., Barratt, M.E.J., Parmar, P., Powell, J.R., 2000. Anti-
oxidants may contribute in the fight against aging: an in vitro model. Mech.
Ageing Dev. 121, 217–230.
Ito, Y., Betsuyaku, T., Moriyama, C., 2009. Aging affects lipopolysaccharide-induced
upregulation of heme oxygenase-1 in the lungs and alveolar macrophages.
Biogerontology 10, 173–180.
Kireev, R.A., Tresguerres, A.C., Garcı ´a, C., Ariznavarreta, C., Vara, E., Tresguerres, J.A.,
2008. Melatonin is able to prevent the liver of old castrated female rats from
oxidative and pro-inflammatory damage. J. Pineal Res. 45, 394–402.
Kireev, R.A., Tresguerres, A.C., Garcia, C., Borras, C., Ariznavarreta, C., Vara, E., Vina, J.,
Tresguerres, J.A., 2010. Hormonal regulation of pro-inflammatory and lipid
peroxidation processes in liver of old ovariectomized female rats. Biogerontol-
ogy 11, 229–243.
Lenardo, M.J., Baltimore, D., 1989. NF-kappa B: a pleiotropic mediator of inducible
and tissue-specific gene control. Cell 58, 227–229.
Li, Q.X., Xiong, Z.Y., Hu, B.P., Tian, Z.J., Zhang, H.F., Gou, W.Y., Wang, H.C., Gao, F.,
Zhang, Q.J., 2009. Aging-associated insulin resistance predisposes to hyperten-
sion and its reversal by exercise: the role of vascular vasorelaxation to insulin.
Basic Res. Cardiol. 104, 269–284.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2-DDCT method. Methods 25, 402–408.
Matuszek, Z., Reszka, K.J., Chignell, C.F., 1997. Reaction of melatonin and related
indoles with hydroxyl radicals: ESR and spin trapping investigations. Free Radic.
Biol. Med. 23, 367–372.
Meites, J., Goya, R.G., Takahashi, S., 1987. Why the neuroendocrine system is
important in aging process. Exp. Gerontol. 22, 1–5.
Michel, T., Feron, O., 1997. Nitric oxide synthases: which, where, how, and why? J.
Clin. Invest. 100, 2146–2152.
Mori, A., Utsumi, K., Liu, J., Hosokawa, M., 1998. Oxidative damage in the senes-
cence-accelerated mouse. Ann. N. Y. Acad. Sci. 854, 239–250.
Morse, D., Choi, A.M., 2002. Heme oxygenase-1: the ‘‘emerging molecule’’ has
arrived. Am. J. Respir. Cell Mol. Biol. 27, 8–16.
Reaven, E.P., Reaven, G.N., 1981. Structure and function changes in the endocrine
pancreas of aging rabbits with reference to the modulating effects of exercise
and caloric restriction. J. Clin. Invest. 68, 75–84.
Reiter, R.J., 1995. Oxidative processes and antioxidative defense mechanisms in the
aging brain. FASEB J. 9, 526–533.
Reiter, R.J., 1997. Aging and oxygen toxicity: relation to changes in melatonin. Age
20, 201–213.
Reiter, R.J., 1998. Oxidative damage in the central nervous system: protection by
melatonin. Prog. Neurobiol. 56, 359–384.
Reiter, R.J., Craft, C.M., Johnson Jr., J.E., King, T.S., Richardson, B.A., Vaughan, G.M.,
Vaughan, M.K., 1981. Age-associated reduction in nocturnal melatonin levels in
female rats. Endocrinology 109, 1295–1297.
Reiter, R.J., Guerrero, J.M., Garcia, J.J., Acun ˜a-Castroviejo, D., 1998. Reactive oxygen
intermediates, molecular damage and aging: relation to melatonin. Ann. N. Y.
Acad. Sci. 854, 410.
Rodrı ´guez, M.I., Escames, G., Lo ´pez, L.C., 2007. Chronic melatonin treatment reduces
the age-dependent inflammatory process in senescence-accelerated mice. J.
Pineal Res. 42, 272–279.
Sasaki, M., Jordan, P., Joh, T., Itoh, M., Jenkins, M., Pavlick, K., Minagar, A., Alexander,
S.J., 2002. Melatonin reduces TNF-a induced expression of MAdCAM-1 via
inhibition of NF-kappaB. BMC Gastroenterol. 24, 2–9.
Seta, F., Bellner, L., Rezzani, R., 2006. Heme oxygenase-2 is a critical determinant for
execution of an acute inflammatory and reparative response. Am. J. Pathol. 169,
1612–1623.
Song, W., Kwak, H.B., Kim, J.H., Lawler, J.M., 2009. Exercise training modulates the
nitric oxide synthase profile in skeletal muscle from old rats. J. Gerontol. A Biol.
Sci. Med. Sci. 64, 540–549.
Stoclet, J.C., Muller, B., Gyorgy, 1999. The inducible nitric oxide synthase in vascular
and cardiac tissue. Eur. J. Pharmacol. 375, 139–155.
Takeda, T., 1999. Senescence-accelerated mouse (SAM): a biogerontological re-
source in aging research. Neurobiol. Aging 20, 105–110.
Takeda, T., Hosokawa, M., Higuchi, K., 1997. Senescence-accelerated mouse (SAM):
a novel murine model of senescence. Exp. Gerontol. 32, 105–109.
Tan, D.X., Manchester, L.C., Reiter, R.J., Plummer, B.F., Hardies, L.J., Weintraub, S.T.,
Vijayalaxmi, Shepherd, A.M., 1998. A novel melatonin metabolite, cyclic 3-
hydroxymelatonin: a biomarker of in vivo hydroxyl radical generation. Bio-
chem. Biophys. Res. Commun. 253, 614–620.
Tan, D.X., Reiter, R.J., Chen, L.D., Poeggeler, B., Manchester, L.C., Barlow-Walden,
L.R., 1994. Both physiological and pharmacological levels of melatonin reduce
DNA adduct formation induced by the carcinogen safrole. Carcinogenesis 15,
215–218.
Tha, K.K., Okuma, Y., Miyazaki, H., 2000. Changes in expressions of proinflammatory
cytokines IL-1beta, TNF-alpha and IL-6 in the brain of senescence accelerated
mouse (SAM) P8. Brain Res. 885, 25–31.
Tresguerres, J.A.F., Kireev, R.A., Tresguerres, A.C.F., Borras, C., Vara, E., Ariznavarreta,
C., 2008. Molecular mechanisms involved in the hormonal prevention of aging
in the rat. J. Steroid Biochem. Mol. Biol. 108, 318–326.
Valen, G., Yan, Z.Q., Hansson, G.K., 2001. Nuclear factor kappa-B and the heart. J. Am.
Coll. Cardiol. 38, 307–314.
Zhang, Y., Herman, B., 2002. Apoptosis and successful aging. Mech. Ageing Dev. 123,
563–565.
S. Cuesta et al. / Mechanisms of Ageing and Development 132 (2011) 573–582
582