Mutated p.4894 RyR1 function related to malignant hyperthermia and congenital neuromuscular disease with uniform type 1 fiber (CNMDU1).

Abstract

Ryanodine receptor 1 (RyR1) is a Ca(2+) release channel located in the sarcoplasmic reticulum membrane of skeletal muscle. More than 200 variants in RyR1 have been identified in DNA from patients with malignant hyperthermia (MH) and congenital myopathies; only 30 have been sufficiently studied so as to be identified as MH-causative mutations. The Ala4894Thr RyR1 variant was found in a Japanese patient with susceptibility to MH, and the Ala4894Pro variant in a rare case of myopathy: congenital neuromuscular disease with uniform type 1 fiber (CNMDU1). We hypothesized that different Ala4894 variants of RyR1 cause different pathophysiological changes that are identifiable by having differing pharmacological sensitivities to RYR1 agonists.
Expression vector with a mutation in RYR1 corresponding to the Ala4894Thr, Ala4894Pro, Ala4894Ser, or Ala 4894Gly variant of human RyR1 was transfected into human embryonic kidney 293 cells. At 72 hours after transfection, we determined the intracellular Ca(2+) changes induced by caffeine and 4-chloro-m-cresol (4CmC), in the presence or absence of dantrolene.
Ala4894Thr-transfected cells and Ala4894Ser-transfected cells were more sensitive to caffeine than the wild type, and Ala4894Thr-transfected cells were also more sensitive to 4CmC than the wild type, whereas Ala4894Pro-transfected cells had no response to caffeine or 4CmC. Ala4894Gly-transfected cells were significantly less sensitive to caffeine than the wild type. In addition, the responses of Ala4894Thr-transfected cells and Ala4894Ser-transfected cells to caffeine were suppressed by dantrolene.
We concluded that different Ala4894 variants of RyR1 lead to different agonist/antagonist sensitivities, which may predict differing RYR1 functionality during excitation-contraction coupling and sensitivity to MH. The hypersensitive Ala4894Thr-RyR1 is associated with MH and the poorly functional Ala4894Pro-RyR1 with CNMDU1.

Full text

Page 1

Society for Pediatric Anesthesia
Section Editor: Peter J. Davis
Mutated p.4894 RyR1 Function Related to Malignant
Hyperthermia and Congenital Neuromuscular Disease
with Uniform Type 1 Fiber (CNMDU1)
Toshiaki Haraki, MD,* Toshimichi Yasuda, MD, PhD,* Keiko Mukaida, MD, PhD,†
Takako Migita, MD, PhD,* Hiroshi Hamada, MD, PhD,* and Masashi Kawamoto, MD, PhD*
BACKGROUND: Ryanodine receptor 1 (RyR1) is a Ca2?release channel located in the
sarcoplasmic reticulum membrane of skeletal muscle. More than 200 variants in RyR1 have
been identified in DNA from patients with malignant hyperthermia (MH) and congenital
myopathies; only 30 have been sufficiently studied so as to be identified as MH-causative
mutations. The Ala4894Thr RyR1 variant was found in a Japanese patient with susceptibility to
MH, and the Ala4894Pro variant in a rare case of myopathy: congenital neuromuscular disease
with uniform type 1 fiber (CNMDU1). We hypothesized that different Ala4894 variants of RyR1
cause different pathophysiological changes that are identifiable by having differing pharmaco-
logical sensitivities to RYR1 agonists.
METHODS: Expression vector with a mutation in RYR1 corresponding to the Ala4894Thr,
Ala4894Pro, Ala4894Ser, or Ala 4894Gly variant of human RyR1 was transfected into human
embryonic kidney 293 cells. At 72 hours after transfection, we determined the intracellular Ca2?
changes induced by caffeine and 4-chloro-m-cresol (4CmC), in the presence or absence of
dantrolene.
RESULTS: Ala4894Thr-transfected cells and Ala4894Ser-transfected cells were more sensitive
to caffeine than the wild type, and Ala4894Thr-transfected cells were also more sensitive to
4CmC than the wild type, whereas Ala4894Pro-transfected cells had no response to caffeine or
4CmC. Ala4894Gly-transfected cells were significantly less sensitive to caffeine than the wild
type. In addition, the responses of Ala4894Thr-transfected cells and Ala4894Ser-transfected
cells to caffeine were suppressed by dantrolene.
CONCLUSION: We concluded that different Ala4894 variants of RyR1 lead to different
agonist/antagonist sensitivities, which may predict differing RYR1 functionality during excitation-
contraction coupling and sensitivity to MH. The hypersensitive Ala4894Thr-RyR1 is associated with
MH and the poorly functional Ala4894Pro-RyR1 with CNMDU1. (Anesth Analg 2011;113:1461–7)
M
Major MH symptoms are manifested as abnormal hyper-
thermia, muscle rigidity, acidosis, and hyperkalemia. If not
treated adequately, a patient with MH can develop a
life-threatening condition. Since the Ala614Cys ryanodine
receptor 1 (RyR1) mutation was first reported in 1991,1a
large number of RyR1 mutations associated with MH have
been reported. For example, the Ala4894Thr RyR1 variant
in the C-terminal domain, which has been reported to be
alignant hyperthermia (MH) is an autosomal
dominant, pharmacogenetic disorder triggered
by volatile anesthetics and/or succinylcholine.
responsible for MH, was found in a Japanese MH patient,2
but the function of the mutated RyR1 was not evaluated.
Ryanodine receptors are large homotetrameric channel
proteins, with each subunit consisting of approximately
5000 amino acids. These receptors are located in the mem-
brane of the sarcoplasmic reticulum (SR) and regulate
intracellular Ca2?concentrations by releasing Ca2?from
the SR into the cytoplasm.3RyR1 is predominantly ex-
pressed in skeletal muscle and has an important role in
excitation-contraction (EC) coupling. More than 200 RyR1
variants have been reported.4–7It has been reported that
most of the variants are located within 3 hotspots (N-
terminal, central, and C-terminal domains).8However, a
number of mutations have been found outside the hot-
spots2,9,10; therefore, the possibility exists that the hotspots
result from screening bias.4,5,11Some RyR1 variants have
been implicated in MH and congenital myopathies, includ-
ing central core disease (CCD), multi-minicore disease, and
congenital neuromuscular disease with uniform type 1
fiber (CNMDU1).12–14
CNMDU1, a rare congenital myopathy first reported in
1983,15is pathologically characterized by the exclusive
presence of type 1 muscle fibers (?99%) with no muscle
structure abnormalities. It is clinically characterized by
From the *Department of Anesthesiology and Critical Care, Hiroshima
University, Hiroshima; and †Division of Anesthesia, Hiroshima Prefectural
Rehabilitation Center, Hiroshima, Japan.
Accepted for publication July 26, 2011.
Supported in part by the Tsuchiya Foundation.
The authors declare no conflicts of interest.
Reprints will not be available from the authors.
Address correspondence to Toshiaki Haraki, MD, Department of Anesthe-
siology and Critical Care, Division of Clinical Medical Science, Graduate
School of Biomedical Sciences, Hiroshima University, 1-2-3 Kasumi,
Minami-ku, Hiroshima 734-8551, Japan. Address e-mail to tsakharaki@
gmail.com.
Copyright © 2011 International Anesthesia Research Society
DOI: 10.1213/ANE.0b013e318232053e
December 2011 • Volume 113 • Number 6www.anesthesia-analgesia.org
1461

Page 2

delayed motor milestones, mild proximal weakness, hypo-
or nonreflexes, and a normal level of serum creatine kinase.
These symptoms appear within the first few years of
life.16,17The Ala4894Pro RyR1 mutation was found in a
CNMDU1 patient16; however, its function was not evalu-
ated and the pathogenesis of CNMDU1 remains uncertain.
We have investigated the functions of RyR1 mutants
associated with MH and congenital myopathy,18and
hypothesized that each of the different Ala4894 variants in
RyR1 causes different pathophysiological conditions. The
purpose of this study was to evaluate the function of
mutated RyR1 channels. Expression of the RyR1 gene in
human embryonic kidney (HEK)-293 cells and measure-
ment of intracellular Ca2?changes induced by caffeine and
4-chloro-m-cresol (4CmC) are methods frequently used to
evaluate RyR1functions.19,20
Ala4894Thr and Ala4894Pro RyR1 genes into HEK-293
cells, and evaluated the function of RyR1. In addition, we
transfectednewartificial
Ala4894Gly RyR1 genes) and examined their functions.
We transfectedthe
variants(Ala4894Serand
METHODS
Rabbit-RyR1/pcDNA was a generous gift from Professor
David H. MacLennan (University of Toronto). The HEK-293
Tet-off? Advanced Cell Line (HEK-293) was purchased from
Clontech Laboratories (Shiga, Japan). Restriction enzymes
were purchased from Takara Bio Inc. (Shiga, Japan). Caffeine,
4CmC, thapsigargin, and other chemicals were obtained from
Wako Pure Chemical Industries, Ltd. (Osaka, Japan).
Preparation of RyR1/pTRE-Tight-BI-AcGFP
To coexpress the RyR1 and Aequorea coerulescens green
fluorescent protein (AcGFP) genes, rabbit-RyR1 cDNA was
removed from rabbit-RyR1/pcDNA using the XbaI/HindIII
restriction enzymes. Rabbit-RyR1 cDNA was then ligated
into the NheI-HindIII site of pTRE-Tight-BI-AcGFP (pBI;
Clontech Laboratories) (RyR1/pBI). Ligation was performed
using a Takara DNA ligation kit LONG (Takara Bio Inc.).
Mutagenesis
C-terminal RyR1 was removed from RyR1/pBI using the
restriction enzymes. The fragment was inserted into a
pBluescript II KS(?) (Stratagene, La Jolla, CA) vector and
used as a template for mutagenesis. Mutagenesis was
performed using a QuickChange?II XL Site-Directed Mu-
tagenesis Kit (Stratagene). Primers for the Ala4894Thr and
Ala4894Pro mutations, obtained from MH and CNMDU1
patients, respectively, were custom designed, as were prim-
ers for the Ala4894Ser and Ala4894Gly variants. Serine is
classified as a polar amino acid because of the hydroxyl
group and its characteristics are similar to threonine. Gly-
cine has the simplest structure among amino acids, and its
molecular weight and polar characteristics are similar to
alanine. The primers used for mutagenesis were 5?-
cgtgggcgtccggactggcggaggc for Ala4894Thr, 5?-cgtgggcgtcc-
ggcctggcggaggc for Ala4894Pro, 5?-cgtgggcgtccggtctggcggaggc
for Ala4894Ser, and 5?-cgtgggcgtccgggctggcggaggc for
Ala4894Gly. Mutagenesis was performed according to the
methods described by the manufacturer. After mutagen-
esis, we confirmed that mutated pBluescript II KS(?)
plasmid contained the desired mutation by sequencing.
Analyses of the sequences were performed using an ABI
3100 DNA sequencer and a BigDye? Terminator v3.1 Cycle
Sequence Kit (Applied Biosystems, Tokyo, Japan). The
primers used for sequencing were T7, T3, and 5?-
aagttcggggtcatcttcacg. The mutated fragment was removed
from the pBluescript II KS(?) plasmid using the restriction
enzymes ClaI/HindIII and ligated into RyR1/pBI to make
the expression vectors inserted into the mutated RyR1 gene.
Transfection
HEK-293 cells were maintained in Dulbecco’s modified
Eagle medium (Invitrogen, Carlsbad, CA) supplemented
with 10% Tet System–Approved fetal bovine serum (Clon-
tech Laboratories), 100 U/mL penicillin (Sigma, St. Louis,
MO), and 100 mg/mL streptomycin (Sigma) at 37°C under
5% CO2. Next, 1 ? 105HEK-293 cells were subcultured on
35-mm poly-l-lysine–coated glass-bottomed dishes (Mat-
sunami, Osaka, Japan) for 24 hours. DNA transfection was
performed using FuGENE HD Transfection Reagent
(Roche Applied Science, Indianapolis, IN). An expression
vector (pBI) was transfected as the control.
Ca2?Fluorescence Measurements
Seventy-two hours after transfection, the HEK-293 cells
were washed twice with HEPES-buffered salt solution
(HBSS) containing 130 mM NaCl, 5.4 mM KCl, 20 mM
HEPES, 2.5 mM CaCl2, 1 mM MgCl2, and 5.5 mM glucose
at pH 7.4. The cells were then loaded with 5.0 ?M Fura-2
AM (Dojindo, Tokyo, Japan) in HBSS for 1 hour at 37°C.
Measurements were performed after perfusion with HBSS
for 15 minutes at a rate of 1.2 mL/min at 37°C.
Next, the cells were excited at 490 nm and fluorescence
emissions of AcGFP were observed at 510 nm to identify
AcGFP-positive cells, which were regarded as successfully
transfected cells. The AcGFP-positive cells were excited
alternately at 340 and 380 nm, and the fluorescence emis-
sions of Fura-2 AM were observed at 510 nm using a
fluorescence microscope (Nikon, Tokyo, Japan) at 5-second
intervals to evaluate the intracellular Ca2?changes. Images
were acquired using a cooled high-speed digital video
camera (ORCA-AG; Hamamatsu Photonics, Hamamatsu,
Japan). The 340/380-nm signal ratio was calculated using a
Ca2?imaging system (Aquacosmos 2.5; Hamamatsu Pho-
tonics), and Fura-2 photobleaching was minimized by
Aquacosmos 2.5 software.
HBSS containing incremental levels of caffeine or 4CmC
was added to 1 side of the culture dish and aspirated on the
opposite side for 2 minutes at a rate of 1.2 mL/min at 37°C.
Each solution was washed out a few minutes before
addition of the next incremental levels of caffeine or 4CmC.
At the end of experiments, the cells were perfused with HBSS
containing500nM thapsigargin,
sarco/endoplasmic reticulum Ca2?-ATPase, to confirm that
Ca2?stores in the endoplasmic reticulum (ER) were replete.
aninhibitorof
Data Analysis
To trace dose-response curves for caffeine and 4CmC, the
data were normalized to the maximal response of each cell.
Concentrations of caffeine and 4CmC required to reach
half-maximal activation were calculated from the acquired
dose-response curves. All data analyses were performed
Mutated p.4894 RyR1 Function Related to MH and CNMDU1
1462
www.anesthesia-analgesia.org
ANESTHESIA & ANALGESIA

Page 3

using PRISM 4.0 software (GraphPad Software, San Diego,
CA). A P value of ?0.05 was considered to be statistically
significant.
RESULTS
The proportions of AcGFP-positive cells were 50% to 70%.
There was no obvious difference in transfection efficiency
between wild-type (WT)- or mutated-RyR1–transfected
cells, and 2 to 5 cells followed per experiment.
Figure 1 shows representative data for WT- or mutated-
RyR1 cDNA transfected into HEK-293 cells with caffeine.
WT-RyR1–transfected cells and Ala4894Thr-RyR1–transfected
cellswere sensitive to caffeine, whereas Ala4894Pro-RyR1 and
vector alone (control)–transfected cells showed no reaction.
Figure 1. Representative Ca2?release traces and resultant caffeine responsiveness of wild-type and mutated ryanodine receptor 1 (RyR1)
cDNA-transfected human embryonic kidney–293 cells. A, Wild-type-RyR1–transfected cell. B, RyR1-Ala4894Thr–transfected cell. C,
Ala4894Pro-RyR1–transfected cell. D, pTRE-Tight-BI-AcGFP vector–transfected cell as control. Ala4894Thr-RyR1–transfected cells were more
sensitive than wild type. Ala4894Pro-RyR1–transfected cells and control cells had no reaction to caffeine.
Figure 2. Dose response of sensitivity of
Ca2?release to caffeine or 4-chloro-
m-cresol (4CmC) in human embryonic
kidney–293 cells transfected with ryano-
dine receptor 1 (RyR1) variants. A, Re-
sponse of wild-type (WT)-RyR1– and
Ala4894Thr-RyR1–transfected
caffeine. B, Response of WT-RyR1– and
Ala4894Thr-RyR1–transfected
4CmC. C, Response of WT-RyR1– and
Ala4894Ser-RyR1–transfected cells to caf-
feine. D, Response of WT-RyR1– and
Ala4894Gly-RyR1–transfected cells to caf-
feine. Data represent the mean ? SD.
cellsto
cellsto
December 2011 • Volume 113 • Number 6www.anesthesia-analgesia.org
1463

Page 4

Likewise,
RyR1–transfected cells were sensitive to 4CmC, whereas
Ala4894Pro-RyR1–transfected cells were not (data not
shown). We plotted the dose-response curves of WT-
RyR1–transfected cells and Ala4894Thr-RyR1–transfected
cells to caffeine (Fig. 2A). The dose-response curves of
Ala4894Thr-RyR1–transfected cells were shifted to the left as
WT-RyR1–transfectedcells andAla4894Thr-
compared with WT-transfected cells, with the 50% effective
concentration of WT-RyR1–transfected cells and Ala4894Thr-
RyR1–transfected cells for caffeine 1.38 ? 0.10 and 0.52 ? 0.04
mM, respectively (Table 1). We also plotted the dose-response
curves of WT-RyR1–transfected cells and Ala4894Thr-
RyR1–transfected cells for 4CmC (Fig. 2B). The dose-response
curves of the Ala4894Thr-RyR1–transfected cells were shifted
to the left as compared with the WT-RyR1–transfected cells,
andthe50% effectiveconcentration
RyR1–transfected cells and Ala4894Thr-RyR1–transfected
cells for 4CmC were 176.6 ? 9.0 and 77.9 ? 8.6 ?M, respec-
tively (Table 2). The Ala4894Ser-RyR1–transfected cells and
Ala4894Gly-RyR1–transfected cells were exposed to increas-
ing concentration of caffeine, and we plotted the dose-
response curves (Fig. 2, C and D), respectively. The 50%
effective concentration value
transfected cells was 0.79 ? 0.05 mM, which was significantly
lower than that for WT-RyR1–transfected cells, whereas that
for Ala4894Gly-RyR1–transfected cells was significantly
greater at 11.57 ? 1.34 mM (Table 1).
Dantrolene is a skeletal muscle relaxant and the only
clinically available drug for treatment of MH.21We exam-
ined the effects of dantrolene on WT-RyR1–transfected
cells, Ala4894Thr-RyR1–transfected cells, and Ala4894Ser-
RyR1–transfected cells. Cells were perfused with 10 ?M
dantrolene in HBSS for 15 minutes, then loaded with
increasing concentrations of caffeine solutions containing
10 ?M dantrolene for 2 minutes. We plotted the dose-
response curves of WT-RyR1–transfected cells, Ala4894Thr-
RyR1–transfected cells, and Ala4894Ser-RyR1–transfected
cells to caffeine with dantrolene and found that the curves
were shifted to the right as compared with those without
dantrolene (Fig. 3). The 50% effective concentration values of
WT-RyR1–transfectedcells,
valuesof WT-
for Ala4894Ser-RyR1–
Ala4894Thr-RyR1–transfected
Figure 3. Dose response of sensitivity of
Ca2?release to caffeine with or without
dantrolene in human embryonic kidney–
293 cells transfected with ryanodine re-
ceptor 1 (RyR1) variants. A, Responses of
wild-type-RyR1–transfected cells. B, Re-
sponses of Ala4894Thr-RyR1–transfected
cells. C, Responses of Ala4894Ser-RyR1–
transfected cells. Data represent the
mean ? SD.
Table 1. Fifty Percent Effective Concentration
for Caffeine
50% effective
concentration for
caffeine (mM)
1.38 ? 0.10
3.18 ? 0.31*
0.52 ? 0.04*
2.03 ? 0.54†
0.79 ? 0.05*
1.21 ? 0.03‡
11.57 ? 1.34*
n
Wild type
Wild type with dantrolene 10 ?M
Ala4894Thr
Ala4894Thr with dantrolene 10 ?M
Ala4894Ser
Ala4894Ser with dantrolene 10 ?M
Ala4894Gly
25
25
25
25
25
25
25
Values are means ? SEM.
n ? number of the cells examined.
*P ? 0.001 versus wild type.
†P ? 0.001 versus Ala4894Thr.
‡P ? 0.001 versus Ala4894Ser.
Table 2. Fifty Percent Effective Concentration
for 4CmC
50% effective concentration
for 4CmC (?M)
Wild type
Ala4894Thr
n
176.6 ? 9.0
77.9 ? 8.6*
15
15
Values are means ? SEM.
4CmC ? 4-chloro-m-cresol; n ? number of the cells examined.
*P ? 0.01 versus wild type.
Mutated p.4894 RyR1 Function Related to MH and CNMDU1
1464
www.anesthesia-analgesia.org
ANESTHESIA & ANALGESIA

Page 5

cells, and Ala4894Ser-RyR1–transfected cells for caffeine with
dantrolene were 3.18 ? 0.31, 2.03 ? 0.54, and 1.21 ? 0.03 mM,
respectively (Table 1).
Thapsigargin inhibits the uptake of Ca2?into the SR and
induces leakage from the SR into cytoplasm.22Changes in
the 340/380-nm signal ratio induced by thapsigargin allow
us to estimate the amount of Ca2?in the SR.23We calcu-
lated the 340/380-nm signal ratios in a resting condition
and maximal response induced by 500 nM thapsigargin
in HBSS. The 340/380-nm signal ratios in the resting
condition for WT-RyR1–transfected cells, Ala4894Thr-
RyR1–transfected cells, and Ala4894Pro–transfected cells
were 0.99 ? 0.10, 0.95 ? 0.08, and 0.94 ? 0.07, respectively,
which are not statistically different (Table 3). The WT-
RyR1–transfected cells, Ala4894Thr-RyR1–transfected cells,
and Ala4894Pro-RyR1–transfected cells responded to 500
nM thapsigargin, with maximal 340/380-nm signal ratios of
2.71 ? 0.72, 2.79 ? 0.83, and 2.98 ? 0.68, respectively, which
are not statistically different (Table 3).
DISCUSSION
The present study revealed that MH-associated, Ala4894Thr-
RyR1–transfected cells are more sensitive to caffeine and
4CmC than WT-RyR1 cells, whereas those responses were
inhibited by dantrolene. In addition, CNMDU1-associated,
Ala4894Pro-RyR1–transfected cells were found to be insensi-
tive to caffeine and 4CmC, whereas cells transfected with
Ala4894Ser, a new artificial variant, were also more sensitive
to caffeine than WT cells. Our findings also showed that cells
transfected with Ala4894Gly, another new artificial variant,
were less sensitive to caffeine than WT cells. Together, these
results indicate that different RyR1 mutations at Ala4894 lead
to different physiological responses, which may represent
clinically relevant findings.
Most mutations reported in studies of MH patients are
located in the N-terminal or central domains. Ala4894Thr,
found in a Japanese MH patient, is a mutation located in the
C-terminal domain. That patient was clinically diagnosed
with MH and examined with the calcium-induced calcium
release (CICR) rate test.2In Japan, a CICR rate test using
skinned muscle fibers was performed to diagnose suscep-
tibility to MH24–26and the patient had a significantly
accelerated CICR rate (Table 4). The present results indicate
that the Ala4894Thr-RyR1 mutation is consistent with
known responses of the MH-causal RyR1 mutation.
We found that dantrolene suppressed the response of
Ala4894Thr-transfected cells to caffeine. Dantrolene shows
clinical efficacy in many MH cases; however, the scientific
evidence that dantrolene is effective for any mutations of
RyR1 that cause MH has not been obtained, and it is
difficult to solve the problem. Therefore, it is important to
show the effect of dantrolene for each variant reported
from MH. Our results indicate that dantrolene may be
effective for MH associated with Ala4894Thr.
We also found that Ala4894Pro-transfected cells, as a
homozygous model, were completely insensitive to caffeine
and 4CmC. Because humans are heterozygous for nearly all
RyR1 mutations, and because such patients survive, albeit
with modified skeletal muscle function, these patients are
presumably heterozygous as well. We therefore hypoth-
esize that this mutation would bestow a relative insensitiv-
ity of RyR1 to normal agonist stimuli during normal
physiological function in these individuals, resulting in a
decrement of excitation-coupled Ca2?release and de-
creased contractile function. This is in line with the recent
classification of mutated RyR1 into 3 types: leaky channels,
EC uncoupling, and overactive channels. Leaky channels,
which remain in an open state and leak Ca2?from the SR,
cause depletion of Ca2?in the SR and increase of intracel-
lular Ca2?in a resting state. As a result, there is a decrease
in Ca2?release in an excited state, which causes muscle
weakness.27The Tyr523Ser CCD mutant was reported as
leaky channels.28EC uncoupling is a dysfunction of the
timing of the open states of 2 receptors, dihydropyridine
receptor (DHPR) and RYR1, disabling their coupling.
DHPR is an l-type Ca2?channel and known as a voltage
sensor of skeletal muscle. The interaction of DHPR with
RYR1 regulates the release of Ca2?from SR. Consequently,
EC uncoupling leads to lack of Ca2?release from the SR.29
The Ile4897Thr CCD mutant was reported as EC uncou-
pling.30Overactive channels are hypersensitive channels
associated with MH. In our experiments, there was
no difference in intracellular Ca2?between WT- and
Ala4894Pro-transfected cells in a resting state and maximal
response. These results indicate that the amount of Ca2?in
the ER of Ala4894Pro-transfected cells is not different
from that of WT-transfected cells, which leads us to con-
clude that the Ala4894Pro mutant is not the leaky channels
type. EC uncoupling is insensitive to caffeine loading.27
Therefore, our results may indicate that Ala4894Pro-RyR1
is the EC uncoupling type. However, it is necessary to
evaluate the coupling functions of DHPR and RyR1 before
making a final conclusion. There are no data yet to link this
RyR1 mutation and perturbations in Ca2?release fluxes to
Table 3. Fura-2 Ratio (340/380 nm) of
Responses to Thapsigargin
Resting
condition
Wild type0.99 ? 0.10
Ala4894Thr0.95 ? 0.08
Ala4894Pro0.94 ? 0.07
Maximal
response
2.71 ? 0.72
2.79 ? 0.83
2.98 ? 0.68
n
15
15
15
Values are means ? SEM.
n ? number of the cells examined.
Table 4. CICR Rate in the Malignant
Hyperthermia Patient (Ala4894Thr)
Ca2?
concentration (?M)
0
0.3
1
3
10
CICR rate (/min)
The patient
(Ala4894Thr)
0.057
0.237a
1.245a
4.755a
8.233a
Control
0.067 ? 0.035
0.085 ? 0.036
0.363 ? 0.196
1.778 ? 0.934
2.489 ? 1.372
Values are means ? SD.
CICR ? calcium-induced calcium release.
aThe CICR rate of the patient exceeded 2 SDs above the average of control
rate, which was diagnosed “accelerated.”
The data courtesy of Dr. Hirosato Kikuchi, Saitama Medical University, Japan,
with permission.
December 2011 • Volume 113 • Number 6www.anesthesia-analgesia.org
1465

Page 6

the lack of development of type 2 fibers in CNMDU1,
which also must contribute to the myopathy seen in these
patients.
We also noted that Ala4894Ser-RyR1–transfected cells
were more sensitive to caffeine. Because both serine and
threonine contain a hydroxyl group, the hydroxyl group of
amino acids at Ala4894 may enhance RyR1 function.
Amino acids 4895 to 4901 correspond to pore-forming
regions,31–33and Ala4894 is the amino acid adjacent to the
beginning of this region. Mutations in the pore-forming
region have been reported to change channel conductance
and ion selectivity.31Similarly, replacement of Ala4894
with an amino acid that contains a hydroxyl group may
change channel gating and/or Ca2?conductance in such a
manner as to enhance RyR1 function and make it more
sensitive to trigger MH.
Ala4894Gly-transfected cells were less sensitive to caf-
feine. The characteristics of glycine are similar to alanine.
However, the function of Ala4894Gly was found to be
different from that of the WT. Most mutations in the
C-terminal domain have been reported in patients with
congenital myopathy,34–37and various artificial variations
in the pore-forming region are reported to lead to RyR1
dysfunction.30Additional studies of variants in the pore-
forming region may provide useful knowledge regarding
RyR1 function.
The raw Ca2?release traces of both WT and Ala4894Thr
cells (Fig. 1, A and B) had 2 phases: the first phase was the
peak of the response and the second phase was the decay of
the Ca2?transient. Our results may correspond to not only
pure release of Ca2?but also to store-operated Ca2?entry
(SOCE), a mechanism of an external Ca2?entry into cells to
replenish the ER/SR store.38–40Our experiments were not
able to exclude the influence of SOCE on the development
of the cellular Ca2?transient, but SOCE in these cells is
likely coupled to the degree of RyR1 functioning.40In any
case, because the only difference between these cells is the
nature of the RyR1 expressed, the results lead us to believe
that the differences in 50% effective concentration to RyR1
agonists reflect mutation-induced changes in RyR1 func-
tion as it relates to those aspects of cellular Ca2?homeo-
stasis that are under its control.
The present study was a cell culture–based, functional
evaluation of transfected transgene-RyR1, both WT and
specifically mutated. Although it is preferable to use tissue-
specific biological models, such as murine models, with
a specific knock-in transgene in appropriate tissue, i.e.,
skeletal muscle, our results in cell culture correspond well
with patient clinical episodes. We suggest, therefore, that
Ala4894Thr and Ala4894Pro are associated with MH and
CNMDU1, respectively.
In conclusion, we evaluated RyR1 function after trans-
fection of Ala4894-mutated RyR1 into HEK-293 cells. The
Ala4894Thr-transfected cells were more sensitive to caf-
feine and 4CmC than the WT. In contrast, Ala4894Pro-
transfected cells had no response to caffeine or 4CmC. Our
results indicate that hypersensitive Ala4894Thr-RyR1 is
associated with MH, whereas the poorly functional
Ala4894Pro-RyR1 is associated with CNMDU1.
DISCLOSURES
Name: Toshiaki Haraki, MD.
Attestation: Conduct of study, data analysis, manuscript
preparation.
Name: Toshimichi Yasuda, MD, PhD.
Attestation: Study design, conduct of study, manuscript
preparation.
Name: Keiko Mukaida, MD, PhD.
Attestation: Study design, manuscript preparation.
Name: Takako Migita, MD, PhD.
Attestation: Manuscript preparation.
Name: Hiroshi Hamada, MD, PhD.
Attestation: Manuscript preparation.
Name: Masashi Kawamoto, MD, PhD.
Attestation: Manuscript preparation.
This manuscript was handled by: Peter J. Davis, MD.
ACKNOWLEDGMENTS
We thank Professor David H. MacLennan for the generous gift
of Rabbit-RyR1/pcDNA. We also thank Professor Ichizo
Nishino (Department of Neuromuscular Research, National
Institute of Neuroscience, National Center of Neurology and
Psychiatry, Kodaira, Japan) for his kind advice. This study
was performed at the Analysis Center of Life Science,
Hiroshima University, and was supported in part by the
Tsuchiya Foundation.
REFERENCES
1. Gillard E, Otsu K, Fujii J, Khanna V, de Leon S, Derdemezi J,
Britt B, Duff C, Worton R, MacLennan D. A substitution of
cysteine for arginine 614 in the ryanodine receptor is poten-
tially causative of human malignant hyperthermia. Genomics
1991;11:751–5
2. Ibarra MC, Wu S, Murayama K, Minami N, Ichihara Y, Kikuchi
H, Noguchi S, Hayashi Y, Ochiai R, Nishino I. Malignant
hyperthermia in Japan: mutation screening of the entire ryan-
odine receptor type 1 gene coding region by direct sequencing.
Anesthesiology 2006;104:1146–54
3. Hamilton S. Ryanodine receptors. Cell Calcium 2005;38:253–60
4. Stowell K. Malignant hyperthermia: a pharmacogenetic disor-
der. Pharmacogenomics 2008;9:1657–72
5. Robinson R, Carpenter D, Shaw M, Halsall J, Hopkins P.
Mutations in RYR1 in malignant hyperthermia and central core
disease. Hum Mutat 2006;27:977–89
6. Lanner J, Georgiou D, Joshi A, Hamilton S. Ryanodine
receptors: structure, expression, molecular details, and func-
tion in calcium release. Cold Spring Harb Perspect Biol
2010;2:a003996
7. Vukcevic M, Broman M, Islander G, Bodelsson M, Ranklev-
Twetman E, Mu ¨ller C, Treves S. Functional properties of RYR1
mutations identified in Swedish patients with malignant hy-
perthermia and central core disease. Anesth Analg 2010;111:
185–90
8. McCarthy T, Quane K, Lynch P. Ryanodine receptor mutations
in malignant hyperthermia and central core disease. Hum
Mutat 2000;15:410–7
9. Galli L, Orrico A, Lorenzini S, Censini S, Falciani M, Covacci A,
Tegazzin V, Sorrentino V. Frequency and localization of mu-
tations in the 106 exons of the RYR1 gene in 50 individuals
with malignant hyperthermia. Hum Mutat 2006;27:830
10. Sambuughin N, Holley H, Muldoon S, Brandom B, de Bantel
A, Tobin J, Nelson T, Goldfarb L. Screening of the entire
ryanodine receptor type 1 coding region for sequence vari-
ants associated with malignant hyperthermia susceptibility
in the North American population. Anesthesiology 2005;
102:515–21
11. Levano S, Vukcevic M, Singer M, Matter A, Treves S, Urwyler
A, Girard T. Increasing the number of diagnostic mutations in
malignant hyperthermia. Hum Mutat 2009;30:590–8
Mutated p.4894 RyR1 Function Related to MH and CNMDU1
1466
www.anesthesia-analgesia.org
ANESTHESIA & ANALGESIA

Page 7

12. Quane K, Healy J, Keating K, Manning B, Couch F, Palmucci L,
Doriguzzi C, Fagerlund T, Berg K, Ording H. Mutations in the
ryanodine receptor gene in central core disease and malignant
hyperthermia. Nat Genet 1993;5:51–5
13. Zhang Y, Chen H, Khanna V, De Leon S, Phillips M, Schappert
K, Britt B, Browell A, MacLennan D. A mutation in the human
ryanodine receptor gene associated with central core disease.
Nat Genet 1993;5:46–50
14. Monnier N, Kozak-Ribbens G, Krivosic-Horber R, Nivoche Y,
Qi D, Kraev N, Loke J, Sharma P, Tegazzin V, Figarella-
Branger D, Rome ´ro N, Mezin P, Bendahan D, Payen J, Depret
T, Maclennan D, Lunardi J. Correlations between genotype
and pharmacological, histological, functional, and clinical phe-
notypes in malignant hyperthermia susceptibility. Hum Mutat
2005;26:413–25
15. Oh S, Danon M. Nonprogressive congenital neuromuscular
disease with uniform type 1 fiber. Arch Neurol 1983;40:147–50
16. Sato I, Wu S, Ibarra M, Hayashi Y, Fujita H, Tojo M, Oh S,
Nonaka I, Noguchi S, Nishino I. Congenital neuromuscular
disease with uniform type 1 fiber and RYR1 mutation. Neu-
rology 2008;70:114–22
17. Tojo M, Ozawa M, Nonaka I. Central core disease and con-
genital neuromuscular disease with uniform type 1 fibers in
one family. Brain Dev 2000;22:262–4
18. Migita T, Mukaida K, Hamada H, Yasuda T, Haraki T, Nishino
I, Murakami N, Kawamoto M. Functional analysis of ryano-
dine receptor type 1 p.R2508C mutation in exon 47. J Anesth
2009;23:341–6
19. Tong J, Oyamada H, Demaurex N, Grinstein S, McCarthy T,
MacLennan D. Caffeine and halothane sensitivity of intracel-
lular Ca2?release is altered by 15 calcium release channel
(ryanodine receptor) mutations associated with malignant
hyperthermia and/or central core disease. J Biol Chem
1997;272:26332–9
20. Chen S, Leong P, Imredy J, Bartlett C, Zhang L, MacLennan D.
Single-channel properties of the recombinant skeletal muscle
Ca2?
releasechannel (ryanodine
1997;73:1904–12
21. Krause T, Gerbershagen M, Fiege M, Weisshorn R, Wappler F.
Dantrolene: a review of its pharmacology, therapeutic use and
new developments. Anaesthesia 2004;59:364–73
22. Treiman M, Caspersen C, Christensen S. A tool coming of age:
thapsigargin as an inhibitor of sarco-endoplasmic reticulum
Ca(2?)-ATPases. Trends Pharmacol Sci 1998;19:131–5
23. Tong J, McCarthy T, MacLennan D. Measurement of resting
cytosolic Ca2?concentrations and Ca2?store size in HEK-293
cells transfected with malignant hyperthermia or central core
disease mutant Ca2?release channels. J Biol Chem 1999;274:
693–702
24. Endo M, Tanaka M, Ogawa Y. Calcium induced release of
calcium from the sarcoplasmic reticulum of skinned skeletal
muscle fibres. Nature 1970;228:34–6
25. Endo M. Calcium-induced calcium release in skeletal muscle.
Physiol Rev 2009;89:1153–76
26. Oku S, Mukaida K, Nosaka S, Sai Y, Maehara Y, Yuge O.
Comparison of the in vitro caffeine-halothane contracture test
with the Ca-induced Ca release rate test in patients suspected
of having malignant hyperthermia susceptibility. J Anesth
2000;14:6–13
receptor).BiophysJ
27. Lynch P, Tong J, Lehane M, Mallet A, Giblin L, Heffron J,
Vaughan P, Zafra G, MacLennan D, McCarthy T. A mutation
in the transmembrane/luminal domain of the ryanodine re-
ceptor is associated with abnormal Ca2?release channel func-
tion and severe central core disease. Proc Natl Acad Sci USA
1999;96:4164–9
28. Avila G, Dirksen R. Functional effects of central core disease
mutations in the cytoplasmic region of the skeletal muscle
ryanodine receptor. J Gen Physiol 2001;118:277–90
29. Dirksen R, Avila G. Altered ryanodine receptor function in
central core disease: leaky or uncoupled Ca(2?) release chan-
nels? Trends Cardiovasc Med 2002;12:189–97
30. Avila G, O’Connell K, Dirksen R. The pore region of the
skeletal muscle ryanodine receptor is a primary locus for
excitation-contraction uncoupling in central core disease. J Gen
Physiol 2003;121:277–86
31. Ramachandran S, Serohijos A, Xu L, Meissner G, Dokholyan N.
A structural model of the pore-forming region of the skeletal
muscleryanodinereceptor
2009;5:e1000367
32. Gao L, Balshaw D, Xu L, Tripathy A, Xin C, Meissner G.
Evidence for a role of the lumenal M3–M4 loop in skeletal
muscle Ca(2?) release channel (ryanodine receptor) activity
and conductance. Biophys J 2000;79:828–40
33. Zhao M, Li P, Li X, Zhang L, Winkfein R, Chen S. Molecular
identification of the ryanodine receptor pore-forming segment.
J Biol Chem 1999;274:25971–4
34. Treves S, Jungbluth H, Muntoni F, Zorzato F. Congenital
muscle disorders with cores: the ryanodine receptor calcium
channel paradigm. Curr Opin Pharmacol 2008;8:319–26
35. Tilgen N, Zorzato F, Halliger-Keller B, Muntoni F, Sewry C,
Palmucci L, Schneider C, Hauser E, Lehmann-Horn F, Mu ¨ller
C, Treves S. Identification of four novel mutations in the
C-terminal membrane spanning domain of the ryanodine
receptor 1: association with central core disease and alteration
of calcium homeostasis. Hum Mol Genet 2001;10:2879–87
36. Davis M, Haan E, Jungbluth H, Sewry C, North K, Muntoni F,
Kuntzer T, Lamont P, Bankier A, Tomlinson P, Sa ´nchez A,
Walsh P, Nagarajan L, Oley C, Colley A, Gedeon A, Quinlivan
R, Dixon J, James D, Mu ¨ller C, Laing N. Principal mutation
hotspot for central core disease and related myopathies in the
C-terminal transmembrane region of the RYR1 gene. Neuro-
muscul Disord 2003;13:151–7
37. Shepherd S, Ellis F, Halsall J, Hopkins P, Robinson R. RYR1
mutations in UK central core disease patients: more than just
the C-terminal transmembrane region of the RYR1 gene. J Med
Genet 2004;41:e33
38. Ma J, Pan Z. Retrograde activation of store-operated calcium
channel. Cell Calcium 2003;33:375–84
39. Parekh AB, Putney JW. Store-operated calcium channels.
Physiol Rev 2005;85:757–810
40. Zhao X, Weisleder N, Han X, Pan Z, Parness J, Brotto M, Ma J.
Azumolene inhibits a component of store-operated calcium
entry coupled to the skeletal muscle ryanodine receptor. J Biol
Chem 2006;281:33477–86
(RyR1).PLoS ComputBiol
December 2011 • Volume 113 • Number 6www.anesthesia-analgesia.org
1467