Generalized Schemes for High-Throughput Manipulation of the Desulfovibrio vulgaris Genome

Physical Biosciences Division, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Mail Stop 978R412, Berkeley, CA 94720, USA.
Applied and Environmental Microbiology (Impact Factor: 3.67). 09/2011; 77(21):7595-604. DOI: 10.1128/AEM.05495-11
Source: PubMed


The ability to conduct advanced functional genomic studies of the thousands of sequenced bacteria has been hampered by the
lack of available tools for making high-throughput chromosomal manipulations in a systematic manner that can be applied across
diverse species. In this work, we highlight the use of synthetic biological tools to assemble custom suicide vectors with
reusable and interchangeable DNA “parts” to facilitate chromosomal modification at designated loci. These constructs enable
an array of downstream applications, including gene replacement and the creation of gene fusions with affinity purification
or localization tags. We employed this approach to engineer chromosomal modifications in a bacterium that has previously proven
difficult to manipulate genetically, Desulfovibrio vulgaris Hildenborough, to generate a library of over 700 strains. Furthermore, we demonstrate how these modifications can be used
for examining metabolic pathways, protein-protein interactions, and protein localization. The ubiquity of suicide constructs
in gene replacement throughout biology suggests that this approach can be applied to engineer a broad range of species for
a diverse array of systems biological applications and is amenable to high-throughput implementation.

Download full-text


Available from: Terry C Hazen,
  • Source
    • "Primary sequence comparison of DVU0396 and DVUA0004 with IHFα from E. coli revealed only 31% and 21% identity, respectively (Figure 6). More recently, results obtained from pull-down experiments using DVU1864 as bait identified DVU0396 as the preferential prey [37]. It should also be noted that DVUA0004 is located on the endogenous plasmid of DvH, which is lost in our growth conditions. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Transcriptional activation of σ(54)-dependent promoters is usually tightly regulated in response to environmental cues. The high abundance of potential σ(54)-dependent promoters in the anaerobe bacteria, Desulfovibrio vulgaris Hildenborough, reflects the high versatility of this bacteria suggesting that σ(54) factor is the nexus of a large regulatory network. Understanding the key players of σ(54)-regulation in this organism is therefore essential to gain insights into the adaptation to anaerobiosis. Recently, the D. vulgaris orp genes, specifically found in anaerobe bacteria, have been shown to be transcribed by the RNA polymerase coupled to the σ(54) alternative sigma factor. In this study, using in vitro binding experiments and in vivo reporter fusion assays in the Escherichia coli heterologous host, we showed that the expression of the divergent orp promoters is strongly dependent on the integration host factor IHF. Bioinformatic and mutational analysis coupled to reporter fusion activities and mobility shift assays identified two functional IHF binding site sequences located between the orp1 and orp2 promoters. We further determined that the D. vulgaris DVU0396 (IHFα) and DVU1864 (IHFβ) subunits are required to control the expression of the orp operons suggesting that they form a functionally active IHF heterodimer. Interestingly results obtained from the in vivo inactivation of DVU0396, which is required for orp operons transcription, suggest that several functionally IHF active homodimer or heterodimer are present in D. vulgaris.
    PLoS ONE 01/2014; 9(1):e86507. DOI:10.1371/journal.pone.0086507 · 3.23 Impact Factor
  • Source
    • "A complementation plasmid pMOIP05 was produced also by SLIC encoding qmoA with a Strep-TEV-FLAG (STF) tag. To create this vector two segments were amplified by PCR: the qmoA gene (QmoA Exp Vctr P1 Fw-AGGTTGGGAAGCCCTGCAATGCAGTCCCAGGAGGTACCATATGTCGAACTCCATACTCGTCGTCG and QmoA Exp Vctr P2 Rev-AATTTTTTCGAACTGCGGGTGGCTCCACCTCCCTCTCACCGTTTGAATCGC) and the STF-tag gene from pSLIC-DVU0171-STF-Kan-Tag (Chhabra et al., 2011a; STF-Tag Fw-TGGAGCCACCCGCAGTTCGAAAAAATT and STF-Tag Rev-GATCGTGATC CCCTGCGCCATCAGATCCTTGCTACTTGTCATCGTCATCCTTGTAGTCGATGTCA); and then added into pMO9075 background via SLIC. The amplifications products were transformed into E. coli α-select Silver Efficiency (Bioline®), and cells were plated on spectinomycin (100 μg/ml)-containing agar plates. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The adenosine 5'-phosphosulfate reductase (AprAB) is the enzyme responsible for the reduction of adenosine 5'-phosphosulfate (APS) to sulfite in the biological process of dissimilatory sulfate reduction, which is carried out by a ubiquitous group of sulfate reducing prokaryotes. The electron donor for AprAB has not been clearly identified, but was proposed to be the QmoABC membrane complex, since an aprBA-qmoABC gene cluster is found in many sulfate reducing and sulfur-oxidizing bacteria. The QmoABC complex is essential for sulfate reduction, but electron transfer between QmoABC and AprAB has not been reported. In this work we provide the first direct evidence that QmoABC and AprAB interact in Desulfovibrio spp., using co-immunoprecipitation, cross-linking Far-Western blot, tag-affinity purification, and surface plasmon resonance studies. This showed that the QmoABC-AprAB complex has a strong steady-state affinity (K(D) = 90 ± 3 nM), but has a transient character due to a fast dissociation rate. Far-Western blot identified QmoA as the Qmo subunit most involved in the interaction. Nevertheless, electron transfer from menaquinol analogs to APS through anaerobically purified QmoABC and AprAB could not be detected. We propose that this reaction requires the involvement of a third partner to allow electron flow driven by a reverse electron bifurcation process, i.e., electron confurcation. This process is deemed essential to allow coupling of APS reduction to chemiosmotic energy conservation.
    Frontiers in Microbiology 04/2012; 3:137. DOI:10.3389/fmicb.2012.00137 · 3.99 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Project Goals: Desulfovibrio vulgaris has been selected as a model bacterium for intensive study by ENIGMA because it can reduce heavy metals and radionuclide contaminants present in the soil at many DOE sites, rendering the contaminants insoluble. ENIGMA seeks to model, at a molecular systems level, how this and similar bacteria respond to natural and human induced changes in their environment and how this alters their ability to stabilize contaminants in the soil. A component of our strategy is to develop and use high throughput pipelines to purify and characterize soluble protein complexes. We expect that these interaction data will improve our ability to produce accurate metabolic and regulatory models of key members of microbial communities. The group led by Mark Biggin has developed a novel method for identification of stable, soluble protein complexes in microbes. In a small-scale pilot study, we showed that many protein complexes survive intact through a series of orthogonal chromatographic methods, with complex components having correlated elution profiles. These profiles were measured with the aid of mass spectrometry (MS) and iTRAQ reagents (Dong et al., 2008). We developed statistical and machine learning methods to analyze a full-scale data set, which were required in order to obtain biologically meaningful results due to the high potential for false positives (FP) caused by co-elution of proteins that are not part of a complex. Our methods were tuned using a manually curated gold standard (GS) set. As a first high-throughput study, we demonstrated this technique in identifying a high-precision subset of stable protein complexes in Desulfovibrio vulgaris. We have shown that our predicted network of interactions is significantly enriched in pairs with similar functional annotations. The quantitative information from elution profiles allowed us to develop a statistical model to estimate the false discovery rate in our predictions; because this varies according to how "crowded" the eluted fractions are, we are able to identify a subset of hundreds of highly reliable (i.e., with very low false discovery rate) interactions, as well as a much larger set of interactions that can be predicted with known false discovery rates. Advantages of the tagless approach include not requiring a mutant library (needed for alternative tag-based approaches such as TAP), and a false discovery rate comparable to TAP. The group led by Gareth Butland has identified a number of protein complexes using TAP. We have developed an automated pipeline for synthesis of tagged gene constructs in collaboration with Swapnil Chhabra (Chhabra et al., 2011). To date, over 700 pulldowns (comprising more than 600 unique D. vulgaris strains) have been subject to analysis. In these experiments, more than 10,000 interactions were detected with over 1,000 distinct prey proteins. Using curated GS datasets (as in the tagless analysis), we filtered out ubiquitous proteins and other likely FP, resulting in a set of high-confidence interactions. A number of these interactions have been reciprocally confirmed, using strains in which the original prey protein was tagged and used as bait. Preliminary analysis of the data have identified several novel complexes, including multiple paralogous versions of the DnaJK-GrpE chaperone complex, each of which is bound to a small protein that may act as an allosteric regulator.
Show more