No association of promoter variations of HMOX1 and UGT1A1 genes with liver injury in chronic hepatitis C.

Abstract

Heme oxygenase-1 (HMOX1) and bilirubin UDP-glucuronosyltransferase (UGT1A1), both enzymes involved in bilirubin homeostasis, play an important role in oxidative stress defense.
To assess the effect of promoter variations of HMOX1 and UGT1A1 genes on the progression of fibrosis in patients chronically infected with the hepatitis C virus (HCV).
The study was performed on146 chronic HCV infection patients, plus 146 age- and sex-matched healthy subjects. The (GT)n and (TA)n dinucleotide variations in HMOX1 and UGT1A1 gene promoters, respectively, were determined by fragment analysis in all subjects.
No differences were found in the frequencies of each particular allele of both genes, between HCV patients and a control group (p > 0.05). Furthermore, no association was detected (p > 0.05) between either the HMOX1 or the UGT1A1 promoter variants and the individual histological stages of liver disease in the HCV positive patients. Finally, no differences in the HMOX1 and UGT1A1 genotype prevalence rates were found between pre-cirrhotic and cirrhotic patients (p > 0.05).
Based on our data, microsatellite variations in the HMOX1 and UGT1A1 genes are not likely to protect from progression of liver disease in patients with chronic hepatitis C.

Full text

Page 1

445
No association of HMOX1 and UGT1A1 genes with liver injury. , 2011; 10 (4): 445-451
ORIGINAL ARTICLE
No association of promoter variations of HMOX1 and
UGT1A1 genes with liver injury in chronic hepatitis C( )
Petr Urbánek,* Martin Lenícek,† Lucie Muchová,† Iva Subhanová,†
Ladislav Dušek,‡ Nikola Kaspríková,§ Petr Hrabal,|| Radan Bruha,¶ Libor Vítek†,¶
* Department of Internal Medicine, 1st. Faculty of Medicine, Charles University in Prague and Central Military Hospital, Prague, Czech Republic.
† Institute of Clinical Biochemistry and Laboratory Diagnostics, Charles University in Prague and General Teaching Hospital, Prague, Czech Republic.
‡ Institute of Biostatistics and Analyses, Faculty of Medicine and Faculty of Science, Masaryk University in Brno, Czech Republic.
§ Institute of Biophysics and Informatics, First Faculty of Medicine, Charles University in Prague.
| | Department of Pathology, Central Military Hospital Prague, Czech Republic.
¶ 4th. Department of Internal Medicine, 1st. Faculty of Medicine, Charles University in Prague and General Teaching Hospital, Prague, Czech Republic.
ABSTRACT
Background. Heme oxygenase-1 (HMOX1) and bilirubin UDP-glucuronosyltransferase (UGT1A1), both enzy-
mes involved in bilirubin homeostasis, play an important role inoxidative stress defense. Objective. To as-
sess the effect of promotervariations of HMOX1 and UGT1A1 genes on the progression of fibrosis in
patients chronically infected with the hepatitis C virus (HCV). Material and methods. The study was per-
formed on146 chronic HCV infection patients, plus 146 age- and sex-matched healthy subjects. The (GT)n
and (TA)n dinucleotide variations in HMOX1 and UGT1A1 gene promoters, respectively, were determined
by fragment analysis in all subjects. Results. No differences were found in the frequencies of each
particular allele of both genes, between HCV patients and a control group (p > 0.05). Furthermore, no as-
sociation was detected (p > 0.05) between either the HMOX1 or the UGT1A1 promoter variants and the
individual histological stages of liver disease in the HCV positive patients. Finally, no differences in
the HMOX1 and UGT1A1 genotype prevalence rates were found between pre-cirrhotic and cirrhotic
patients (p > 0.05). Conclusion. Based on our data, microsatellite variations in the HMOX1 and UGT1A1
genes are not likely to protect from progression of liver disease in patients with chronic hepatitis C.
Key words. Bilirubin. Heme oxygenase. Bilirubin UDP-glucuronosyltransferase. Oxidative stress. Genetic predisposition.
( )This work was supported by a grant No. NR9412-3/2007 given by the
Czech Ministry of Health.
Correspondence and reprint request: Prof. Libor Vítek, M.D., Ph.D.
Institute of Clinical Biochemistry and Laboratory Diagnostics
Charles University in Prague and General Teaching Hospital
Prague, Czech Republic. Na Bojišti 3. 128 08 Prague 2. Czech Republic
E-mail: vitek@cesnet.cz
Manuscript received: May 17, 2011.
Manuscript accepted: June 19, 2011.
October-December, Vol. 10 No.4, 2011: 445-451
INTRODUCTION
During the past decades, the heme catabolic pa-
thway has been demonstrated as making an impor-
tant contribution to the protection against oxidative
stress and inflammation. Heme oxygenase (HMOX),
the first and rate-limiting enzyme in the heme cata-
bolism, leads to equimolar production of carbon mo-
noxide, free iron, and biliverdin (which in turn is
reduced to bilirubin, the major intravascular bile
pigment). T wo isoenzymes of HMOX (HMOX1,
OMIM *141250, and HMOX2, OMIM *141251) exist
in the human body.1 HMOX1 is highly inducible by
many stressful factors, including oxidative stress
and inflammatory stimuli; whereas, HMOX2 is
constitutively expressed. Hepatic bilirubin UDP-glu-
curonosyl transferase (UGT 1A1, OMIM *191740),
the other important enzyme in the heme catabolic
pathway, is responsible for the conjugation of biliru-
bin with glucuronic acid; accordingly, facilitating
thus its elimination into the biliary system. Conge-
nital reduction in bilirubin glucuronidation (to
approximately 30%) results in mild, chronic, fluc-
tuating unconjugated hyperbilirubinemia (Gilbert’s
syndrome).2
A number of recent studies have shown that spe-
cific promoter variations in both the HMOX1 and
UGT1A1 genes are associated with various patholo-
gical conditions (for review see ref. 3). The HMOX1
gene promoter contains a highly polymorphic dinu-
< < < < <
< < < < <
º

Page 2

Urbánek P, et al. , 2011; 10 (4): 445-451
446
cleotide GT repeats (ranging from 11 to 42), which
are responsible for the regulation of HMOX1 gene
transcription.4 Subjects with the less active long (L)
allele (GT ≥ 29) have been shown to exhibit an in-
creased risk of oxidative stress-mediated conditions
including cardiovascular diseases, as well as certain
forms of cancer.3 UGT 1A1 also has a highly po-
lymorphic promoter region with (TA)n repeat varia-
tions, modulating the UGT 1A1 transcriptional
activity with clinically important consequences simi-
lar to those of the HMOX1 promoter gene variants.3
Among other factors, oxidative stress makes an
important contribution to the pathogenesis of li-
ver fibrosis in chronic HCV infection.5 It has been
reported by Mori, et al., that cells transfected with
cDNA of the HCV core antigen exhibited elevated
levels of reactive oxygen species (ROS).6 T herefore
it is surprising, that recent data suggest that
HMOX1 might also play a role in the pathogenesis
of chronic HCV infection. Abdalla, et al., recently
described a decrease of HMOX 1 protein and
mRNA in liver samples from patients infected with
HCV.7 Such down regulation of HMOX1 is likely
caused by the HCV core protein, rather than by
the non-structural HCV proteins.8 In contrast,
Ghaziani, et al. found upregulation of HMOX1 in
the human hepatoma cells expressing HCV pro-
teins from the core region, up to the aminotermi-
nal domain of the NS3 region of the HCV
genome.9 T he importance of HMOX1 on HCV re-
plication was proven by Zhu, et al., who transfec-
ted human hepatoma cells harboring HCV
replicons with a human H MOX 1 gene.10 H CV
replication was inhibited in cells overexpressing
HMOX1; and this was reversed with siRNA-media-
ted HMOX 1 knockdown. Moreover, HMOX 1 in-
duction with hemin also significantly decreased
HCV replication. T hese findings suggest that the
pharmacological activation of HMOX1 might pro-
vide an adjuvant benefit to the standard antiviral
treatment options and/or protect from hepatocellu-
lar injury in chronic HCV infection. T his concept
is supported by the recent investigation of L eh-
man, et al., who demonstrated that HMOX 1 in-
duction significantly inhibited HCV replication by
increasing interferon response in vitro.11 On the
other hand, Bonkovsky, et al., in their clinical
study did not find any association of the variatio-
ns of HMOX1 gene promoter and responses to the
first phase of antiviral therapy, or to the likeliho-
od of developing outcomes in a HALT -C trial.12
Based on this data, we focused on assessing the
role of HMOX1 and UGT1A1 promoter variations in
liver disease progression in chronically HCV-infec-
ted patients.
MATERIAL AND METHODS
Patients
The study was performed on 146 patients diagno-
sed with chronic HCV infection, who were followed
at the Department of Internal Medicine of 1st. Fa-
culty of Medicine, Charles University in Prague
and Central Military Hospital, Prague, Czech Re-
public.
Chronic HCV infection was defined as the HCV
RNA positivity by RT-PCR in the serum for at least
6 months, and in whom other possible causes of li-
ver disease were excluded (including HBV or HIV
coinfections). A liver biopsy was performed on 112
patients by the aspiration technique. The transcuta-
neous approach was used in the majority of cases,
while transjugular biopsies were performed on 23
patients. T issue samples were evaluated according
to the Ishak scoring system (as has been described
previously).13 All samples were evaluated by a single
experienced pathologist (P.H. Central Military Hos-
pital Prague). In these patients, complete data on
the grading and staging of the liver disease was
available. A liver biopsy was refused by 19 patients;
however, none of these patients showed clinical sig-
ns of liver cirrhosis. Clinically evident liver cirrho-
sis was found in 15 patients (signs of portal
hypertension, hypersplenism, or a history of liver
decompensation). Bioptically-proven liver cirrhosis
(stage 6) was detected in 10 patients; together for-
ming the group of 25 liver cirrhosis patients (Figure
1). The control group consisted of 146 age- and sex-
matched healthy blood donors.
The study’s protocol conformed to all of the ethi-
cal guidelines in the 1975 Declaration of Helsinki,
as well as being approved by the Ethics Committee
of the respective institutions.
The study was registered on www.clinicaltrials.gov
(ClinicalTrials.gov Identifier NCT00842205).
Methods
T he (GT )n variations in HMOX1 (dbSNP
rs1805173) and (T A)n variations in the UGT 1A1
(dbSNP rs81753472) gene promoters were determi-
ned by fragment analysis as described previously.14
In brief, corresponding DNA fragments were ampli-
fied by a duplex polymerase chain reaction (PCR),
using the following primers:

Page 3

447
No association of HMOX1 and UGT1A1 genes with liver injury. , 2011; 10 (4): 445-451
•HMOX1
°
°
Forward: 5’ -ctgcagcttctcagatttcc - 3’.
Reverse: 5’ - acaaagtctggccataggac - 3’.
•UGT1A1
°
°
Forward: 5’ -gaacttggtgtatcgattggtttttgc - 3’.
Reverse: 5’ - catccactgggatcaacagtatcttcc - 3’.
T he reverse primers were labeled at the 5’ end
with WellRE D fluorescent dyes (Beckman Coulter,
Fullerton, CA, USA). T he resulting PCR products
were separated on a CEQ 8000 Genetic Analysis Sys-
tem (Beckman Coulter, Fullerton, CA, USA). Based
on the number of (GT )n repeats, HMOX1 alleles
were classified into short (S, n < 24), medium (M,
n = 24-28) and long (L, n ≥ 29) subgroups.15,16
The distribution of genotypes in the control sub-
jects was within the Hardy-Weinberg equilibrium for
both studied loci.
HCV RNA was detected in the plasma by use of
the Cobas Ampliprep/TaqMan system (Roche, Lower
limit of Detection, LLD = 15 IU/mL).
Statistical analyses
T he analyses comparing the frequency rates of
different alleles as markers tophenotype parameters
Figure 1. Study design.
146 pts
Liver biopsy performed
N = 112
Liver biopsy not performed
N = 34
Fibrosis stage S 0-4
N = 102
Fibrosis stage S 61
N = 10
Clinically liver cirrhosis
N = 15
LB refused by pt
LB contraindicated
N = 19
all these pts, did not
show any clinical signs
of liver cirrhosis
Liver cirrhosis YES
N = 25
Liver cirrhosis NO
N = 121
1 S5 was not found in our group of patients.
were based on the F isher exact test. All analy-
ses were performed with alpha set to 0.05.
RESULTS
HMOX1 promoter variants in
HCV-infected patients
T he frequencies of S, M, and L alleles of the
HMOX1 gene promoter did not differ between the
HCV positive patients and control subjects (p >
0.05, data not shown). Analogously, no differences
were found between the cases and controls for the
individual HMOX1 genotypes (p = 0.40, data not
shown).
In addition, no differences were also detected in
the frequencies of the individual alleles between
HCV patients without liver cirrhosis and those with
overt liver cirrhosis (T able 1, p > 0.05 for all com-
parisons). T his observation was confirmed in the
detailed analysis of the possible role of HMOX1 pro-
moter gene variants on disease progression in HCV-
infected patients who had undergone a liver biopsy.
For this purpose, we grouped non-cirrhotic patients
according to the staging into three subgroups: S 0-1
(n = 43), S 2 (n = 29) and S 3-4 (n = 30). T here
were no significant associations between the fre-
quency of individual HMOX1 alleles and the stage of
the liver lesion (T able 2, p > 0.05 for all compari-

Page 4

Urbánek P, et al. , 2011; 10 (4): 445-451
448
UGT1A1 promoter
variants in HCV-infected patients
In a comparable manner, non-significant findings
were also detected for the UGT 1A1 promoter gene
variants. T he frequencies of alleles 6 and 7 of the
UGT1A1 gene promoter did not differ between HCV
positive patients and the healthy controls (data not
shown, p > 0.05).
T he frequencies of the UGT 1A1 alleles in HCV
positive patients are shown in table 1. No diffe-
sons). As expected, patients with either a more ad-
vanced liver fibrosis, or cirrhosis, were significantly
older than were patients with lower stages (p <
0.005, data not shown).
As the S allele of the HMOX1 gene seems to be as-
sociated with a lower incidence of oxidative stress-
related diseases, we have analyzed in detail the
frequency of this particular allele (genotypes SS/SL/
SM) in the HCV infected patients with liver cirrho-
sis. Similarly, no difference was detected from this
analysis (Table 3, p = 1.00).
Table 1. Frequency of HMOX1 and UGT1A1 alleles in HCV patients with and without liver cirrhosis
Patients
n = 146
Cirrhosis
Yes (n = 25)
p-value
No (n = 121)
HMOX1
Allele S
Allele M
Allele L
40.7%
52.1%
7.2%
46.0%
48.0%
6.0%
39.7%
52.9%
7.4%
0.66
0.76
1.00
UGT1A1
Allele 6
Allele 7
60.2%
39.8%
68.0%
32.0%
58.7%
43.3%
0.53
0.41
Data are given as percentage of a given allele.
Table 2. Association between HMOX1 and UGT1A1 alleles, and the severity of liver disease.
Patients Cirrhosis
n=127
p-valueStage
S2
(n = 29)
p-value
S0-1 x
S2
p-value
S0-1 x
S3-4
Yes*
(n = 25)
No* *
(n = 102)
S0-1
(n = 43)
S3-4
(n = 30)
HMOX1
Allele S
Allele M
Allele L
41.7%
50.4%
7.9%
46.0%
48.0%
6.0%
39.7%
52.5%
7.4%
0.324
0.448
1.000
37.2%
58.1%
4.7%
43.1%
43.1%
13.0%
43.3%
48.3%
8.3%
0.463
0.044
0.042
0.142
0.132
1.000
UGT1A1
Allele 6
Allele 7
60.2%
39.8%
68.0%
32.0%
58.3%
41.7%
0.475
0.594
64.6%
35.4%
65.1%
34.9%
58.4%
41.6%
0.628
0.568
0.421
0.641
* Cirrhosis-clinically evident or bioptically proved. * * Patients who underwent liver biopsy and staging <6 data are given as percentage of a given allele.
Table 3. Relationship between the HMOX1 S allele and UGT1A1 7/7 genotype, and the presence of liver cirrhosis.
Patients
n =146
Cirrhosis
Yes (n = 25)
p-value
No (n = 121)
HMOX1 S allele
Yes
No
65.1%
34.9%
68.0%
32.0%
64.5%
35.5% 1.00
UGT1A1 7/7
Yes
No
15.7%
84.3%
12.0%
88.0%
16.5%
83.5%0.57

Page 5

449
No association of HMOX1 and UGT1A1 genes with liver injury. , 2011; 10 (4): 445-451
rences in the frequencies of alleles 6 and 7 of the
UGT 1A1 gene were found between cirrhotic and
non-cirrhotic HCV patients (T able 1, p = 0.53).
In addition, no differences were also found in the
more detailed analysis, when the non-cirrhotic
patients were grouped according to their fibrosis
stage upon liver biopsy (Table 2).
As the UGT 1A1 7/7 genotype has been reported
to be associated with a lower incidence of oxidative
stress-related diseases, we have analyzed the oc-
currence of this particular genotype in patients with
or without liver cirrhosis compared to genotypes 6/7
and 6/6 (Table 3). However, in this analysis, no sig-
nificant differences were found.
HMOX1 and UGT1A1
promoter variants and HCV RNA viral load
In the final analysis, we focused on the possible
protective role of both genetic variants on the HCV
RNA viral load. The baseline viral load was conside-
red low if the HCV RNA level at baseline (immedia-
tely before treatment initiation) was < 800,000 IU/
mL. Nevertheless, no significant difference in the vi-
ral load was found in relationship to the presence of
the HMOX1 allele S or the UGT 1A1 7/7 genotype
(Table 4).
DISCUSSION
The physiological role of HMOX in heme catabo-
lism has been recognized for almost four decades.17
However, its role in mediating protection from inflam-
mation and oxidative stress via the production of bi-
lirubin was confirmed only in 1987.18 Several
investigators have proven that the induction of
HMOX1 can prevent or diminish the severity of liver
injury (at least in animal models).19 T o date, the
precise mechanisms of the protective effects of
the HMOX1 have yet to be elucidated. T hese may
involve the degradation of prooxidants, such as
heme; the increased generation of antioxidants such
as ferritin, biliverdin, bilirubin even carbon monoxi-
de (a bioactive gaseous molecule).
T he mechanisms of liver injury in chronic HCV
infection are not completely understood. It is belie-
ved that several mechanisms might be involved; in-
cluding immune cell mediated injury, apoptosis, as
well as oxidative stress. Pianko, et al. found signifi-
cantly greater apoptosis in patients with chronic
HCV infection, compared with the healthy con-
trols.20 Apoptosis is a likely mechanism of liver cell
injury in chronic hepatitis C patients with persisten-
tly normal ALT . Ming-J u, et al., recently reported
recently increased levels of proinflammatory and
pro-fibrotic mediators in the HuH7 cell line; expres-
sing the HCV E 2 protein.21 T his study indicates
that the E 2 protein is involved in the pathogenesis
of HCV mediated fibrosis by the up-regulation of co-
llagen α and oxidative stress, which is J anus kinase
(J AK 1) as well as J AK 2 pathway-related. Lin and
coworkers provided evidence that HCV enhances the
progression of hepatic fibrosis through the genera-
tion of ROS.22 T he other possible factors contribu-
ting to liver inflammation in chronic HCV are viral
proteins such as the HCV core antigen.23 Ghaziani,
et al. found the upregulation of HMOX1 in a cell
line expressing several HCV proteins, including core
protein.9 HMOX1 in human hepatoma cells may be
induced by iron exposure. Furthermore, it has been
proven that iron inhibits the expresion of HCV in vi-
tro.24 T his fact might be of particular interest, as
iron 12 overload is negatively associated with the
stage of liver disease, and treatment efficacy in HCV
infection; and, iron itself is involved in the pathoge-
nesis of liver inflammation.25
T he presence of the short allele of the highly
polymorphic HMOX1 gene promoter was reported to
be associated with higher HMOX1 inducibility, lea-
ding to increased cytoprotection. Indeed, higher ba-
sal HMOX1 expression, as well as stronger
inducibility in human endothelial cells carrying the
Table 4. Relationship between the frequency of the HMOX1 S allele and UGT1A1 7/7 genotype, and the baseline HCV viral load.
HCV RNA < 800,000 IU/mL
Yes (n = 51)
p-value
No (n = 95)
HMOX1 S allele
Yes
No
66.7%
33.3%
64.2%
35.8%0.564
UGT1A1 7/7
Yes
No
13.7%
86.3%
17.9%
82.1%0.781

Page 6

Urbánek P, et al. , 2011; 10 (4): 445-451
450
S allele, exposed to oxidative and inflammatory sti-
muli, has recently been described.26 Based on this
data, we have hypothesized that the genetic variant
in the HMOX1 gene promoter might affect the res-
ponse to chronic HCV infection, as well as the pro-
gression of liver disease in chronically HCV infected
patients. However, our data, however, do not sup-
port this hypothesis. We were not able to prove any
hepatoprotective effect of the S allele HMOX1 car-
rier status, either on the HCV infection risk or on
liver disease progression.
Similar findings were also obtained also for
UGT1A1, another important heme catabolic gene. In
contrast to other oxidative stress-mediated diseases,
such as atherosclerosis,3 no associations were found
for major UGT1A1 gene promoter variations; either
in HCV infection risk or liver disease progression.
In addition, we were not able to find any association
of the biologically relevant variants of both
UGT1A1, as well as the HMOX1 genes and hepati-
tis C viral load.
T he lack of any such associations in our study
may have been due to several factors. Liver fibrosis
in HCV infection is a very complex process, in which
many genetically determined factors as well as viro-
logical or environmental factors, can play a role.
Important factors possibly contributing to the
pathogenesis of liver injury in HCV patients such
as: the patients age at the time of infection, alcohol
consumption, body mass index, insulin resistance,
past HBV infection, or hepatic iron content were not
available; therefor, these could not be controlled for.
In general, taken together, these factors are likely
to contribute more significantly to the pathogenesis
of liver injury in HCV infection compared to the pos-
sible protective role of HMOX1/UGT 1A1 promoter
gene variants.
Nevertheless, our findings are in accord with a
recent clinical study by Bonkovsky, et al., who also
found no association between HMOX1 promoter
gene variants and the response to HCV infection
therapy in chronically infected patients.12
CONCLUSION
Our study in human patients with chronic HCV
infection did not prove any association between pro-
moter variants of the HMOX1 and UGT 1A1 genes
and the risk of disease progression.
ABBREVIATIONS
•
CI:CI:
CI:CI:
CI: Confidence interval.
•
•
•
•
•
•
HBV: HBV:
HBV: HBV:
HBV: Hepatitis B virus
HCV: HCV:
HCV: HCV:
HCV: Hepatitis C virus.
HCV RNA:HCV RNA:
HCV RNA: HCV RNA:
HCV RNA: Hepatitis C virus ribonucleic acid.
HIV:HIV:
HIV:HIV:
HIV: Human inmmunodeficiency virus.
HMOX:HMOX:
HMOX:HMOX:
HMOX: Heme oxygenase.
LLD: LLD:
LLD: LLD:
LLD: Lower limit of detection of polymerase
chain reaction.
LVL:LVL:
LVL:LVL:
LVL: Low viral load.
OR: OR:
OR: OR:
OR: Odds ratio.
PCR:PCR:
PCR:PCR:
PCR: Polymerase chain reaction.
ROS:ROS:
ROS: ROS:
ROS: Reactive oxygen species.
SNP:SNP:
SNP:SNP:
SNP: Single nucleotide polymorphism.
SVR:SVR:
SVR:SVR:
SVR: Sustained virlogical response.
UGT1A1: UGT1A1:
UGT1A1:UGT1A1:
UGT1A1: Bilirubin UDP-glucuronosyltransferase.
•
•
•
•
•
•
•
REFERENCES
1.Farombi EO, Surh YJ . Heme oxygenase-1 as a potential
therapeutic target for hepatoprotection. J Biochem Mol
Biol 2006; 39: 479-91.
Vitek L, Ostrow JD. Bilirubin chemistry and metabolism; harmful
and protective aspects. Curr Pharm Des 2009; 15: 2869-83.
Lin J P, Vitek L, Schwertner HA. Serum bilirubin and genes
controlling bilirubin concentrations as biomarkers for car-
diovascular disease. Clin Chem 2010; 56: 1535-43.
Exner M, Minar E, Wagner O, Schillinger M. The role of
heme oxygenase-1 promoter polymorphisms in human di-
sease. Free Radic Biol Med 2004; 37: 1097-104.
Muriel P. Role of free radicals in liver diseases. Hepatol Int
2009; 3: 526-36.
Moriya K, Nakagawa K, Santa T, Shintani Y, Fujie H, Mi-
yoshi H, Tsutsumi T, et al. Oxidative stress in the absen-
ce of inflammation in a mouse model for hepatitis C
virus-associated hepatocarcinogenesis.
2001; 61: 4365-70.
Abdalla MY, Britigan BE, Wen F, Icardi M, McCormick ML,
LaBrecque DR, Voigt M, et al. Down-regulation of heme
oxynase-1 by hepatitis C virus infection in vivo and by the
in vitro expression of hepatitis C virus infection in vivo
and by the in vitro expression of hepatitis C core protein.
J Infect Dis 2004; 190: 1109-18.
Abdalla MY, Ahmad IM, Spitz DR, Schmidt WN, Britigan BE.
Hepatitis C virus-core and non structural proteins lead to
different effects on cellular antioxidant defences. J Med
Virol 2005; 76: 489-97.
Ghaziani T, Shan Y, Lambrecht WR, Donohue SE, Pietsch-
mann T, Bartenschlager R, Bonkovsky HL. HCV proteins in-
crease expression of heme oxygenase-1 (HO-1) and
decrease expression of Bach1 in human hepatoma cells. J
Hepatol 2006; 45: 5-12.
10. Zhu Z, Wilson TA, Mathis MM, Wen F, Bown KE, Luxon BA,
Schmidt WN. Heme oxygenase-1 suppresses Hepatitis C vi-
rus replication and increases resistance of hepatocytes
to oxidant injury. Hepatology 2008; 28: 1430-9.
11. Lehman E, El-Tantawy WH, Ocker M, Bartenschlager R,
Lohmann V, Hashemolhosseini S, Tiegs G, et al. The heme
oxygenase 1 product biliverdin interferes with hepatitis C
virus replication by increasing antiviral interferon respon-
se. Hepatology 2010; 51: 398-404.
12. Bonkovsky HL, Lambrecht RW, Naishadham D. Genetic va-
riations in heme oxygenase-1 and chronic hepatitis. Hepa-
tology 2010; 52: 400 [Letter].
2.
3.
4.
5.
6.
Cancer Res
7.
8.
9.

Page 7

451
No association of HMOX1 and UGT1A1 genes with liver injury. , 2011; 10 (4): 445-451
13. Ishak K, Baptista A, Bianchi L, Callea F, De Groote J , Gu-
dat F, Denk H, et al. Histological grading and staging of
chronic hepatitis. J Hepatol 1995; 22: 696-9.
14. J iraskova A, Lenicek M, Vitek L. Simultaneous genotyping
of microsatellite variations in HMOX1 and UGT1A1 genes
using multicolored capillary electrophoresis. Clin Biochem
2010; 43: 697-9.
15. Fu WP, Zhoa Z, Fang L, Sun Ch, Zhang J , Zhang Y, Dai L.
Heme oxygenase-1 polymorphism associated with severity
of chronic obstructive pulmonary disease. Chin Med J
2007; 120: 12-6.
16. Fredenburgh LE, Perrella MA, Mitsialis A. The role of heme
oxygenase-1 in pulmonary disease. Am J Respir Cell Mol
Biol 2007; 36: 158-65.
17. Tenhunen R, Marver HS, Schmid R. The enzymatic conver-
sion of heme to bilirubin by microsomal heme oxygenase.
Proc Natl Acad Sci USA 1968; 61: 748-55.
18. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames
BN. Bilirubin is an antioxidant of possible physiological im-
portance. Science 1987; 235: 1043-6.
19. Chiu H, Brittingham J A, Laskin DL. Differential induction
of heme oxygenase-1 in macrophages and hepatocytes du-
ring acetaminophen-induced hepatotoxicity in the rat:
effects of hemin and biliverdin. Toxicol Appl Pharmacol
2002; 181: 106-15.
20. Pianko S, Patella S, Ostapowicz G, Desmond P, Sievert W.
Fas-mediated hepatocyte apoptosis is increased by hepa-
titis C virus infection and alcohol consumption, and may
be associated with hepatic fibrosis: mechanisms of liver
cell injury in chronic hepatitis C virus infection. J Viral
Hepat 2001; 8: 406-13.
21. Ming-J u H, Yih-Shou H, Tzy-Yen C, Hui-Ling C. Hepatitis C
virus E2 protein induce reactive oxygen species (ROS)-re-
lated fibrogenesis in the HSC-T6 hepatic stellate cell line. J
Cell Biochem 2011; 112: 233-43.
22. Lin W, Tsai WL, Shao RX, Wu G, Peng LF, Barlow LL, Chung
WJ , et al. Hepatitis C virus regulates transforming growth
factor beta1 production through the generation of reac-
tive oxygen species in a nuclear factor kappaB-dependent
manner. Gastroenterology 2010; 138: 2509-18.
23. Choi J , Ou J H. Mechanisms of liver injury III. Oxidative
stress in the pathogenesis of hepatitis C virus. Am J Phy-
siol Gastrointest Liver Physiol 2006; 290: G847-51.
24. Hou WH, Ross L, Shan Y, Zheng J Y, Lambrecht RW, Bonko-
vsky HL. Iron increases HMOX1 and decreases hepatitis C
viral expression in HCV-expressing cells. World J Gas-
troenterol 2009; 15: 4499-510.
25. Ghany MG, Strader DB, Thomas DL, Seeff LB; American As-
sociation for the Study of Liver Diseases. Diagnosis, ma-
nagement, and treatment of hepatitis C: an update.
Hepatology 2009; 49: 1335-74.
26. Taha H, Skrzypek K, Guevara I, Nigish A, Mustafa S, Gro-
chot-Przeczek A, Ferdek P, et al. Role of heme oxygena-
se-1 in human endothelial cells: lesson from the promoter
allelic variants. Arterioscler Thromb Vasc Biol 2010; 30:
1634-41.