A novel acyl-CoA beta-transaminase characterized from a metagenome.

Abstract

Bacteria are key components in all ecosystems. However, our knowledge of bacterial metabolism is based solely on the study of cultivated organisms which represent just a tiny fraction of microbial diversity. To access new enzymatic reactions and new or alternative pathways, we investigated bacterial metabolism through analyses of uncultivated bacterial consortia.
We applied the gene context approach to assembled sequences of the metagenome of the anaerobic digester of a municipal wastewater treatment plant, and identified a new gene which may participate in an alternative pathway of lysine fermentation.
We characterized a novel, unique aminotransferase that acts exclusively on Coenzyme A (CoA) esters, and proposed a variant route for lysine fermentation. Results suggest that most of the lysine fermenting organisms use this new pathway in the digester. Its presence in organisms representative of two distinct bacterial divisions indicate that it may also be present in other organisms.

Full text

Page 1

A Novel Acyl-CoA Beta-Transaminase Characterized from
a Metagenome
Alain Perret1,2,3*, Christophe Lechaplais1,2,3, Sabine Tricot1,2,3, Nadia Perchat1,2,3, Carine Vergne1,2,3,
Christine Pelle ´1,2,3, Karine Bastard1,2,3, Annett Kreimeyer1,2,3, David Vallenet1,2,3, Anne Zaparucha1,2,3,
Jean Weissenbach1,2,3, Marcel Salanoubat1,2,3
1Commissariat a ` l’Energie Atomique et aux Energies Alternatives, Institut de Ge ´nomique, Genoscope, Evry, France, 2CNRS-UMR 8030, Evry, France, 3UEVE, Universite ´
d’Evry, Evry, France
Abstract
Background: Bacteria are key components in all ecosystems. However, our knowledge of bacterial metabolism is based
solely on the study of cultivated organisms which represent just a tiny fraction of microbial diversity. To access new
enzymatic reactions and new or alternative pathways, we investigated bacterial metabolism through analyses of
uncultivated bacterial consortia.
Methodology/Principal Findings: We applied the gene context approach to assembled sequences of the metagenome of
the anaerobic digester of a municipal wastewater treatment plant, and identified a new gene which may participate in an
alternative pathway of lysine fermentation.
Conclusions: We characterized a novel, unique aminotransferase that acts exclusively on Coenzyme A (CoA) esters, and
proposed a variant route for lysine fermentation. Results suggest that most of the lysine fermenting organisms use this new
pathway in the digester. Its presence in organisms representative of two distinct bacterial divisions indicate that it may also
be present in other organisms.
Citation: Perret A, Lechaplais C, Tricot S, Perchat N, Vergne C, et al. (2011) A Novel Acyl-CoA Beta-Transaminase Characterized from a Metagenome. PLoS
ONE 6(8): e22918. doi:10.1371/journal.pone.0022918
Editor: Fernando Rodrigues-Lima, University Paris Diderot-Paris 7, France
Received December 17, 2010; Accepted July 9, 2011; Published August 3, 2011
Copyright: ? 2011 Perret et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the Commissariat a ` l’Energie Atomique (CEA). The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: aperret@genoscope.cns.fr
Introduction
Microorganisms are the most abundant and diverse forms of life
and are essential in the functioning of all ecosystems. However,
despite their importance and ubiquity, only a tiny fraction of them
is well understood due to their failure to grow under standard
laboratory culture conditions. With this limitation, less than 1% of
the total number of microbial species have been isolated in pure
cultures [1,2,3]. Our knowledge of microbial biodiversity is thus
severely impaired by relying solely on cultivated microorganisms,
leading to a limited appreciation of functional diversity. Recently
the development of metagenomic approaches has opened the
window on the richness of uncultured biodiversity [4]. These
cultivation-independent techniques have shed light on the
functioning of microbial communities and led to major surprises,
such as the discovery of a new bacteriorhodopsin in a c-
proteobacterium that has since been found widely represented in
different taxa, in diverse oceans [5]; the Photosystem I gene
cassettes that were shown to be present in marine virus genomes
[6]; the nitrite-driven anaerobic methane oxidation by oxygenic
bacteria [7]; the expansion of protein families in these newly-
studied ecosystems [8]; or the discovery of multi-kingdom Pfam
domains that highlight new biological processes conserved through
evolution [9].
Here, we have used the wealth of the metagenomic data
extracted from the anaerobic digester of a wastewater treatment
plant to explore metabolic capabilities of anaerobic bacteria.
Previous studies described the archeal and bacterial molecular
diversity of this digester, revealing the occurrence of previously
undescribed phylogenetic groups and phylotypes [10]. A quanti-
fication of the bacterial diversity was conducted using 16S and 23S
rRNA-targeted hybridization. Gram-positive bacteria represented
the most abundant phyla (22%), followed by the Chloroflexi (20%).
Proteobacteria and Bacteroidetes accounted for 14% each. Planctomycetes
and Synergistes represented less than 2% each while WWE1, a novel
phylum, accounted for 12% and could have considerable
importance in the community. The genome of ‘‘Candidatus
Cloacamonas acidaminovorans’’, an uncultivated representative
of this lineage, has been reconstructed in silico [11].
In anaerobic digestion, microorganisms break down organic
material in the absence of oxygen. Three main groups of
microorganisms are involved: fermenting bacteria, organic acid
oxidizing bacteria, and methanogenic archaea. In a first step,
hydrolytic and fermenting bacteria digest the input materials in
order to break down complex and polymeric compounds
(carbohydrates, proteins…) and make them available for acido-
genic bacteria which convert these sugars and amino acids into
organic acids. Then acetogenic bacteria convert them into acetic
PLoS ONE | www.plosone.org1 August 2011 | Volume 6 | Issue 8 | e22918

Page 2

acid. Finally, methanogens convert these products to methane
[12]. Carbon dioxide, hydrogen and ammonia are produced
during all the steps of this process. ‘‘Candidatus Cloacamonas
acidaminovorans’’ is considered as a fermentative bacterium, and
is suggested to be a hydrogen-producing syntroph [11].
Our previous research on the lysine fermentation pathway at
the genetic level [13] and on the predicted metabolism of
‘‘Candidatus Cloacamonas acidaminovorans’’ which is supposed
to be a lysine fermenting organism [11], led us to re-analyze this
metabolic route. We have experimentally identified a novel
enzymatic reaction which is involved in a hitherto unobserved
variant route for lysine fermentation in this organism.
Results and Discussion
Identification of a candidate gene involved in an
alternative lysine fermentation pathway
It was demonstrated since the early 1950s that in Clostridium
sticklandii, lysine was degraded to acetate, butyrate, and ammonia.
This catabolic pathway contains ten distinctive reactions (see
figure 1). All these genes have been identified [13]. The genome
annotation of ‘‘Candidatus Cloacamonas acidaminovorans’’ sug-
gested that this bacterium ferments lysine. However, kal,
responsible for ammonia elimination from 3-aminobutyryl-CoA
to produce crotonyl-CoA was absent. One hypothesis was that
‘‘Candidatus
Cloacamonas acidaminovorans’’
through a variant pathway. We then searched for the genes
involved in this alternative route by studying the genomic
neighbourhood of the genes involved in lysine fermentation in
this bacterium. However, this approach was unfruitful. In this
organism, a low percentage of genes are found in groups of co-
localized orthologs shared with other species. This led us to study
the genomic context of the genes involved in the lysine
fermentation pathway in other assembled genomic regions from
the anaerobic digester. In particular, a large contig of 50 kbp
containing the clustered genes of interest was studied. This contig
was later integrated into an in silico reconstructed genome of
4.58 Mbp that has been shown to be affiliated with the
Bacteroidetes phylum (Fonknechten N. and Le Paslier D.,
manuscript in preparation). Surprisingly, while the genes involved
in lysine fermentation were clustered, kal was also missing as
observed in ‘‘Candidatus Cloacamonas acidaminovorans’’ (figure 2).
In these assembled sequences, a gene annotated as ‘‘putative
glutamate-1-semialdehyde-2,1-aminomutase’’ (hemL) was found at
the kal locus. A gene also coding for a protein showing strong
homology (.65% of sequence identity over the total length of the
proteins) to this HemL-like protein was found in ‘‘Candidatus
Cloacamonas acidaminovorans’’ (CLOAM0809) co-localized with
ferments lysine
Figure 1. The lysine fermentation pathway. Lysine is converted to b-lysine by lysine-2,3 aminomutase (1) and then to L-erythro-3,5-
diaminohexanoate by b-lysine-5,6-aminomutase (2). This compound is deaminated and oxidized by a NAD(P)-dependent L-erythro-3,5-
diaminohexanoate dehydrogenase (3) to yield 3-keto-5-aminohexanoate. It is further converted into 3-aminobutyryl-CoA and acetoacetate in the
presence of acetyl-CoA by 3-keto-5-aminohexanoate cleavage enzyme (4). 3-aminobutyryl-CoA is deaminated to crotonyl-CoA by an ammonia lyase
(5). Crotonyl-CoA is reduced to butyryl-CoA by butyryl-CoA dehydrogenase (6), which reacts with acetoacetate to form butyrate and acetoacetyl-CoA
through the action of acetoacetate:butyrate CoA transferase (7). The latter compound is converted to acetate via acetyl-CoA and acetyl phosphate by
acetoacetyl-CoA thiolase (8), phosphate acetyltransferase (9), and acetate kinase (10), respectively.
doi:10.1371/journal.pone.0022918.g001
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org2 August 2011 | Volume 6 | Issue 8 | e22918

Page 3

the
CLOAM0810) (figure 2) that is known to participate to lysine
degradation [13].
HemL, which converts glutamate-1-semialdehyde to 5-amino-
levulinate (EC 5.4.3.8) is an aminomutase/aminotransferase
involved in the biosynthesis of porphyrins [14,15]. However, the
in silico genome analysis of ‘‘Candidatus Cloacamonas acidamino-
vorans’’ indicated that it does not possess any other gene involved
in porphyrin biosynthesis [11]. Together, these data suggested that
hemL-like was misannotated and was linked in some way to the
degradation of lysine, making it a promising candidate for the
experimental elucidation of a variant lysine fermentation pathway.
Due to the substitution of kal in ‘‘Candidatus Cloacamonas
acidaminovorans’’ and in the reconstructed Bacteroidetes genome,
we suspected 3-aminobutyryl-CoA to be metabolized in an
unreported manner. We thus focused on HemL-like from
‘‘Candidatus Cloacamonas acidaminovorans’’ to analyze how this
organism could ferment lysine in the absence of kal. Considering
the annotated function of HemL-like as an aminomutase/
aminotransferase, we hypothesized that it may transfer the amine
of 3-aminobutyryl-CoA to an a-keto acid, to directly form
acetoacetyl-CoA (Figure 3).
gene encoding acetoacetyl-CoAthiolase (EC2.3.1.9;
Purification of the enzymes involved in the alternative
lysine fermentation pathway
The recombinant HemL-like, AtoA, and AtoD (the two
components of the butyrate-acetoacetate CoA transferase com-
plex) from ‘‘Candidatus cloacamonas acidaminovorans’’ were produced
in E. coli and purified. According to gel filtration experiments,
AtoA and AtoD were both recovered as monomers (not shown).
Since butyrate-acetoacetate CoA transferase is functional as an
a2b2heterotetramer [16,17], an equimolar amount of AtoA and
AtoD were mixed and applied onto the gel filtration column to
purify the functional complex. The mobility of purified AtoA/
AtoD complex on the Superdex 200 gel filtration column (figure
S1) indicated that it is a tetramer with an apparent molecular mass
of ,93 kDa (theoretical mass : 101.5 kDa). A sample of purified
HemL-like gel filtered under the same conditions yielded an
apparent molecular mass of 81 kDa (figure S1), consistent with a
dimeric structure (theoretical mass: 94.4 kDa). Since the sequence
of the HemL-like possesses an aminotransferase class-III pyridox-
al-phosphate (PLP) attachment site (PROSITE motif PS00600),
the purified protein was incubated with excess PLP, subjected
again to gel filtration, and its spectrum recorded between 250 and
600 nm. The presence of an absorption maximum near 410 nm
confirmed that HemL-like is a PLP-dependent protein (figure S2).
Biochemical and enzymatic characterization of HemL-like
The putative activity of HemL-like was evaluated experimen-
tally by spectrophotometric monitoring at 310 nm of the
formation of acetoacetyl-CoA. 3-aminobutyryl-CoA was incubat-
ed with HemL-like in the presence of various a-ketoacids (a-
ketoglutarate, pyruvate, oxaloacetate, and glyoxylate). Under these
conditions, rapid formation of acetoacetyl-CoA was observed in
the presence of a-ketoglutarate, and a slower reaction occured
with pyruvate. Acetoacetyl-CoA formation was observed in the
presence of 3-aminobutyryl-CoA produced both enzymatically
and chemically. The enzymatic reaction could also be observed
through LC/MS analysis. In the presence of HemL-like,
acetoacetyl-CoA was detected in the positive ionization mode at
m/z 852.1442 (accuracy: 0.7 ppm), and was correlated with a
decrease in 3-aminobutyryl-CoA concentration (detected at m/z
853.1722 with an accuracy of 3.6 ppm). Its formation was also
observed in the presence of both a-ketoglutarate and pyruvate.
The kinetic constants of the enzyme were determined spectro-
photometrically using (3S)-3-aminobutyryl-CoA (Table 1). There-
fore, hemL-like codes for a 3-aminobutyryl-CoA aminotransferase
that we have named kat. This novel b-aminotransferase is, to our
knowledge, the first that acts on a CoA ester.
Its activity in the presence of saturating substrate concentrations
was high only in a narrow pH range (7.5–8.5), with an optimum
around pH 8.0. The enzyme was inactive below pH 7.0 and
exhibited only 20% activity at pH 10 (figure S3a). Kat’s activity
could not be quantified in HEPES/NaOH nor in Na/K
phosphate buffers. At optimal pH, the activity of Kat increased
with temperature, up to a maximum at ,30uC, and sharply
decreased with higher temperatures to be undetectable above
Figure 2. Models of the gene cluster organization for lysine fermentation. (A): Fusobacterium nucleatum ATCC 25586; (B): a contig sequence
affiliated with the Bacteroidetes phylum originating from the metagenome of the anaerobic digester of a wastewater treatment plant; (C): the
reconstructed genome of ‘‘Candidatus Cloacamonas acidaminovorans’’, an uncultivated bacterium found in this digester (only the ID number of the
CLOAM genes are reported). The symbol ‘‘//’’ means an interruption of .5.5 kb in the cluster. HP indicates a gene encoding a Hypothetical Protein;
mutS a gene encoding a MutS family protein.
doi:10.1371/journal.pone.0022918.g002
Figure 3. The hypothetical alternative metabolism of 3-
aminobutyryl-CoA.
doi:10.1371/journal.pone.0022918.g003
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org3 August 2011 | Volume 6 | Issue 8 | e22918

Page 4

33uC (figure S3b). This optimum temperature is similar to that of
the digester [18].
Kim et al. had recently characterized a novel b-aminotransferase
from Mesorhizobium sp [19], which shows striking properties: its
amino acid sequence shows the highest similarity with a
glutamate-1-semialdehyde 2,1-aminomutase (53% identity with
the enzyme from Polaromonas sp. strain JS666, which does not have
b-aminocarboxylictransaminase
Mesorhizobium b-transaminase shows its highest activity in the
presence of a-ketoglutarate as the amino acceptor as well. It has
strong activity with b-aminocarboxylic acids, in particular 3-
aminobutyrate, which is structurally close to 3-aminobutyryl-CoA.
While the enzyme from Mesorhizobium sp has only 24% identity
with Kat, its properties prompted us to check whether Kat could
have a similar activity. Kat was thus assayed for activity in the
presence of the best amino donors of the b-transaminase from
Mesorhizobium sp: 3-aminobutyrate, b-homoleucine and b-phenyl-
alanine. Since none of these compounds could be transformed by
Kat, we hypothesized that the CoA moiety is essential for substrate
recognition. Previous work has demonstrated that N-acetylcystea-
mine (NAC) thioesters can serve as activated acyl-CoA mimics that
activity). Furthermore,this
are used by the cell [20]. Because the acyl-CoA compounds are
difficult to synthesize and to handle due to their high sensitivity to
hydrolysis reaction, we chose to use the NAC thioesters. More
particularly, the CoA side chain of acetyl-CoA could be substituted
by NAC in the reaction catalyzed by the 3-keto-5-aminohexanoate
cleavage enzyme (Kce) in the lysine fermentation pathway: in the
presence of 3-keto-5-aminohexanoate and acetyl-NAC, the
enzyme yielded acetoacetate and 3-aminobutyryl-S-NAC (unpub-
lished results). NAC thioesters of 3-aminobutyrate, b-homoleucine,
and b-phenylalanine were thus synthesized and tested as amino
donors for Kat. Their structure, along with the corresponding
products that would be formed in the presence of a-ketoglutarate
and the enzyme are presented in figure 4. Kat was incubated in
10 mM Tris/HCl pH 8.1 in the presence of 20 mM a-
ketoglutarate and 50 mM S-NAC-thioester for 2 hours before
LC/MS analysis (positive ionization mode). Under these condi-
tions acetoacetyl-S-NAC was detected at m/z 204.0682 (Table 2),
illustrating that NAC can serve as a CoA mimic for Kat. More
interestingly, b-homoleucine-NAC and b-phenylalanine-NAC
were also converted to their corresponding oxo-compounds,
because 5-methyl-3-oxohexanoate-NAC and 3-oxo-3-phenylpro-
panoate-NAC were detected at m/z 204.0682 and 266.0838,
respectively (Table 2). The formation of glutamate was also
detected in these three reactions. Additional MS/MS experiments
conducted on these three reaction products yielded a common
fragment at m/z 119.98. This mass is consistent with the
protonated form of NAC. Together, these results further confirm
the identity of each oxo-metabolite. In conclusion, it appears that
the thioester moiety (CoA or its NAC mimic) is actually necessary
for substrate recognition, but most of all, Kat is able to transform
other b-amino compounds besides 3-aminobutyryl-CoA, including
aromatic ones.
Determination of a variant lysine fermentation pathway
We have demonstrated that kat codes for a 3-aminobutyryl-CoA
aminotransferase. The concomitant absence of kal and presence of
Figure 4. Structure of the different NAC-thioesters and their corresponding products after b-transamination catalyzed by Kat in the
presence of a-ketoglutarate.
doi:10.1371/journal.pone.0022918.g004
Table 1. Kinetic parameters of 3-aminobutyryl-CoA
transamination.
SubstrateKm(M)kcat(s21)kcat/Km(s21. M21)
3-aminobutyryl-CoA1
4.361.5 1026
1.8060.204.2 105
a-ketoglutarate2
2.960.1 1023
1.8060.10620
pyruvate2
20.161.3 1023
0.4060. 01 20
Values correspond to the average of two replicates.
1a-ketoglutarate concentration was 50 mM.
23-aminobutyryl-CoA concentration was 25 mM.
doi:10.1371/journal.pone.0022918.t001
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org4 August 2011 | Volume 6 | Issue 8 | e22918

Page 5

kat suggests that lysine is metabolized in a different way. In the
well-known route, the conversion of 3-aminobutyryl-CoA to
acetoacetyl-CoA occurs through three distinct enzymatic steps:
1) ammonia elimination of 3-aminobutyryl-CoA to crotonyl-CoA
(EC 4.3.1.14) , 2) reduction of crotonyl-CoA to butyryl-CoA (EC
1.3.99.2) and 3) CoA-SH transfer from butyryl-CoA to acetoac-
etate (EC 2.8.3.9) [13]. In the proposed alternative route, Kat
generates acetoacetyl-CoA, and the AtoA/AtoD complex may
yield a second molecule of acetoacetyl-CoA from acetoacetate and
acetyl-CoA. Following this scheme, the exergonic reduction of
crotonyl-CoA to butyryl-CoA would be suppressed, which could
be detrimental to the cell, as this reaction can be coupled to energy
conservation via electron bifurcation [21,22]. The genome of
‘‘Candidatus Cloacamonas acidaminovorans’’ contains good candi-
date genes (CLOAM1274, 1482, and 0104) coding for a butyryl-
CoA dehydrogenase/electron-transferring-flavoprotein complex
(Bcd/EtfAB). However, the formation of crotonyl-CoA from
acetoacetyl-CoA or other metabolites remains enigmatic, because
no genes coding for 3-hydroxybutyryl-CoA dehydrogenase (EC
1.1.1.157), crotonase (EC 4.2.1.55) or glutaryl-CoA dehydroge-
nase (EC 1.3.99.7) could be detected. Syntrophic bacteria are able
to catalyse the energetically unfavourable formation of crotonyl-
CoA from butyryl-CoA using a reverse electron transfer via the
Rnf system [23]. Since C. acidaminovorans is predicted to be a
Table 2. Identification of NAC-thioesters formed by Kat.
[M+ +H+]+
NAC-thioesterFormula TheoreticalObserved Accuracy (ppm) RT (min)*
acetoacetyl-C8H13NO3S204.0689 204.0682
23.4 6.14
5-methyl-3-oxohexanoate-C11H19NO3S 246.1158246.1152
22.4 8.06
3-oxo-3-phenylpropanoate-C11H19NO3S 266.0845 266.0838
22.6 8.02
*RT indicates the retention time of the compound on the chromatography column; [M+H+]+, protonated molecular ion (positive ionization mode).
doi:10.1371/journal.pone.0022918.t002
Figure 5. The alternative lysine fermentation pathway. Enzymes involved are L-lysine-2,3-aminomutase (1); b-L-lysine-5,6-aminomutase (2);
3,5-diaminohexanoate dehydrogenase (3); 3-keto-5-aminohexanoate cleavage enzyme (4); 3-aminobutyryl-CoA aminotransferase (Kat; 5); butyrate-
acetoacetate CoA transferase (6); glutamate dehydrogenase (7); acetoacetyl-CoA thiolase (8); phosphate acetyltransferase (9); acetate kinase (10);
butyryl-CoA dehydrogenase (11); butyrate-acetoacetate CoA transferase (12).
doi:10.1371/journal.pone.0022918.g005
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org5 August 2011 | Volume 6 | Issue 8 | e22918

Page 6

syntroph, one may consider that in this organism the Bcd/Etf
complex catalyses the formation of crotonyl-CoA from butyryl-
CoA, a reaction coupled to the formation of hydrogen via a
formate hydrogen lyase. However sequences of proteins catalysing
the oxidative degradation of crotonyl-CoA to acetoacetyl-CoA are
not detected in the genome, making this reverse electron transfer
rather unlikely. Thus, we can not exclude that the two enzymatic
reactions catalysing the formation of crotonyl-CoA from acet-
oacetyl-CoA are carried out by genes with no homology to those
known so far, or that the formation of crotonyl-CoA could be
performed through a novel enzymatic sequence.
On this basis, a variant lysine fermentation pathway is proposed
in figure 5. The divergence with the classical pathway begins in
step 5, where acetoacetyl-CoA and glutamate are generated from
3-aminobutyryl-CoA and a-ketoglutarate. The AtoA/AtoD com-
plex can then catalyse the formation of acetoacetyl-CoA and
acetate from acetoacetate and acetyl-CoA, yielding a second
molecule of acetoacetyl-CoA (step 6). Recycling of a-ketoglutarate
may be performed by a glutamate dehydrogenase (step 7). The two
acetoacetyl-CoA molecules could be metabolized in two different
ways. First, acetoacetyl-CoA can generate ATP and acetate, as
described in the classical pathway (Figure 1, steps 8–10). Besides,
acetoacetyl-CoA may also be converted to crotonyl-CoA, via
unidentified enzymatic steps. Afterwards, the butyryl-CoA dehy-
drogenase complex may carry out the concomitant reduction of
crotonyl-CoA and ferredoxin (step 11) [21]. Butyryl-CoA may
finally be converted to butyrate and acetyl-CoA in the presence of
acetate (step 12). Experimental evidence strengthens our model :
the previous characterisation of kdd and kce in ‘‘Candidatus
Cloacamonas acidaminovorans’’ [13] validates that L-erythro-3,5-
diaminohexanoate is actually metabolized to acetoacetate and 3-
aminobutyryl-CoA, in this organism. Furthermore in addition to
the established function of Kat, the purified AtoA/AtoD complex
has been shown to catalyze the formation in vitro of acetoacetyl-
CoA and acetate from acetoacetate and acetyl-CoA (Table S1).
Thus, cultivable organisms which possess the same gene cluster
organization as F. nucleatum and ‘‘Candidatus Cloacamonas
acidaminovorans’’ may ferment lysine to identical products, but
through different pathways. This is not totally surprising, as it has
been demonstrated that the fermentation of glutamate in
Clostridium tetanomorphum and Peptococcus aerogenes leads to identical
products, but proceeds via entirely different metabolic pathways
[24,25]. Furthermore, previous studies using tracer experiments
have indicated that at least three more or less distinct pathways
participate in the process of lysine fermentation in Clostridia
[26,27]. The first one corresponds to that described in F. nucleatum
[13], but another pathway involves a different carbon cleavage in
lysine to form butyrate and acetate. Finally, a third pathway
involves the formation of butyrate from two acetate or acetyl
moieties. Only the first pathway has been established with
confidence because there is little data available for the last two.
Occurrence of kat in genomes and metagenomes
To determine if in the digester lysine is fermented through the
canonical or the alternative pathway we searched first in the
metagenomic sequences those related to the five genes present in
both pathways (i.e kdd (coding for the 3,5 diaminohexanoate
dehydrogenase), kce (coding for the 3-keto-5-aminohexanoate
cleavage enzyme, kamD (coding for the lysine 5,6-aminomutase
a-subunit), and kamE (coding for the lysine 5,6 aminomutase b-
subunit, kamA (coding for the lysine 2,3 aminomutase)) The results
are reported in Table 3. kdd, kce, kamD and kamE are present
between 100 and 200 times. The overabundance of kamA could be
explained by the similarity between its encoded protein and other
aminomutases found in organisms which probably do not ferment
lysine. Then we searched for sequences similar to either Kal or
Kat. The scarcity of kal suggests that a very few organisms present
in the digester contained this gene and ferment lysine using the
canonical pathway. On the other hand, since kat is found with a
similar frequency to kdd, kce, kamD, and kamE, the alternate
pathway may be present in most if not all organisms fermenting
lysine in the digester. Kat sequences can be divided into two
subgroups composed of almost identical sequences that share
,65% identity. The first one contains sequences related to WWE1
organisms while in the other one, sequences were affiliated with
Bacteroidetes organisms. This indicates that the variant lysine
fermentation pathway proceeds in at least two different phyla. A
gene (DIG1_60031) from the reconstructed Bacteroidetes genome
was cloned and expressed in E. coli for protein purification and
biochemical characterization. Its enzymatic activity, tested in the
presence of 25 mM 3-aminobutyryl-CoA and 30 mM a-ketoglu-
tarate at 28uC in Activity Buffer, showed a similar rate (84%) to
the one found for Kat under the same conditions. These data
confirm that the variant route can be actually found in distinct
phyla.
When Kat is compared to the millions of protein sequences
accessible through (1) the Integrated Microbial Genomes interface
(http://img.jgi.doe.gov; database : all_img_w_v310.suser), (2) the
CAMERA web site [28] (3) large scale gut microbiome survey
[29], no clear Kat homolog could be detected. However, when
Kat is compared to the NCBI RefSeq collection (http://www.
ncbi.nlm.nih.gov/projects/RefSeq/), a protein with 60% identity
over the whole length of the sequence was identified (NCBI
Reference Sequence: ZP_07200410.1). This protein, annotated as
a Class III aminotransferase belongs to the delta proteobacterium
NaphS2 [30]. Despite this homology, this cultivable anaerobic
marine sulphate-reducing bacterium does not possess the lysine
fermentation genes, indicating that the function of its aminotrans-
ferase probably differs from that of Kat.
On the basis of sequence similarity, aminotransferases can be
grouped into subfamilies (class I to V). Kat is proposed as a class
III aminotransferase since it contains a Pfam-A domain (PF00202).
As the amino acid similarity between all the aminotransferases is
low (,30% identity), homology modelling appears to be a method
of choice to compare protein sequences [31]. We have decided to
build an aminotransferase tree including Kat from ‘‘Candidatus
Cloacamonas acidaminovorans’’ based on a classification of active
site homology models using the Active Sites Modelling and
Clustering (ASMC) method [32]. ASMC is a phylogeny
independent approach which permits to divide a family into
Table 3. Occurrences in the metagenome from the anaerobic
digester of a wastewater treatment plant of the genes known
to be involved in lysine fermentation.
Gene nameNumber of occurrences
kdd124
kce 125
kal7
kamA 285
kamD184
kamE89
kat 159
doi:10.1371/journal.pone.0022918.t003
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org6 August 2011 | Volume 6 | Issue 8 | e22918

Page 7

sub-families depending on the composition of the active sites of its
members. Since Kat does not show sequence homology with
enzymes belonging to the other classes, the analysis was restricted
to the class III aminotranferase family. A reduced set of 1343
sequences corresponding to a redundancy of 50% (UniRef50) was
selected. Sequences from the digester that are homologous to Kat
and the aminotransferases from NaphS2 and Mesorhizobium sp
were added to this set. Results show that the sequence from
‘‘Candidatus Cloacamonas acidaminovorans’’ and the one from the
reconstructed Bacteroidetes genome are clustered, beside other
Kat homologous sequences from the anaerobic digester (figure 6).
The aminotransferase from the delta proteobacterium NaphS2
belongs also to the same cluster. Ten additional enzymes have
been classified in this cluster, but surprisingly, they are poorly
related to Kat (,30% identity) and belong to organisms not
expected to ferment lysine (UniProtKB entry: A8ZXI1, D6ZIK6,
A0YBF7, Q2GBS7, Q39NX5, D8F1V2, B5JCU4, C1A9A5,
Q2J7L8, and C4YXY7). This suggests that structural features of
the active site of Kat are shared by other members of the
aminotransferases class III family. It is worthy to note that the
enzyme from Mesorhizobium sp that metabolizes the same substrate
as Kat (minus the CoA moiety) is located in a distinct cluster. One
may hypothesize that in the Kat cluster, the enzymes are involved
in acyl-CoA transamination.
Conclusion
Taking advantage of the enormous metabolic potential of
uncultivated microbial diversity, we have identified and kinetically
characterized Kat, a novel b-transaminase involved in an
alternative lysine fermentation pathway. The enzyme catalyzes
the transamination of both aliphatic and aromatic substrates. b-
aminoacids are chiral synthetic targets found in free forms, i.e. b-
alanine or b-homoleucine, or as chiral moieties in molecules of
pharmaceutical interest. Since b-transaminases catalyse the
reductive amination of the prochiral keto group of b-ketoacids
to produce optically pure b-amino acids, they could become useful
tools for the organic chemist. Although several b-transaminases
have been isolated to date, this enzyme is unique as it shows
activity exclusively on thioesters (CoA and CoA mimics). This
substrate specificity could be seen as an advantage because b-
ketoacid substrates are prone to decarboxylation and are therefore
difficult to manipulate. Coupling the enzymatic reductive
amination catalyzed by this new b-transaminase with a thioester
cleavage enzyme, would produce the b-aminoacids of interest.
The gene encoding this enzyme was detected using gene context
methods on assembled sequences of a metagenome from the
anaerobic digester of a wastewater treatment plant. To date, this
gene seems to be found exclusively in this metagenome (with the
exception of a gene from the the delta proteobacterium NaphS2,
Figure 6. ASMC tree based on sequence and structural similarities of modelled active sites for 1343 enzymes belonging to the
aminotransferases class III family (see Material and Methods). Known enzymatic activities are reported. Green: Adenosylmethionine-8-
amino-7-oxononanoate transaminase. Red: 3-aminobutyryl-CoA transaminase. Orange: glutamate-1-semialdehyde-2, 1-aminomutase. Yellow:
diaminobutyrate-2-oxoglutarate transaminase. Pink: taurine-pyruvate aminotransferase. Blue: ornithine, acetylornithine, pyruvate, 4-aminobutyrate,
and diaminobutyrate-2-oxoglutarate transaminases.
doi:10.1371/journal.pone.0022918.g006
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org7 August 2011 | Volume 6 | Issue 8 | e22918

Page 8

which obviously does not ferment lysine). Since kat is over
represented as compared to kal (a distinctive gene of the classical
pathway), one may suggest that a higher number of organisms
ferment lysine according to the alternative pathway. It should be
noticed that this pathway was found in organisms representative of
two abundant phyla in the digester. This suggests that it should
also be present in other organisms yet to be described. This raises
the question of whether the classical pathway observed so far in
cultivable organisms is actually representative. A complementary
study of the occurrence of kat and kal in metagenomes from other
digesters of wastewater treatment plants should address this issue,
as representative sequences of the WWE1 lineage have been
identified in at least two other anaerobic digesters [33]. More
generally, this study raises a series of questions that will need to be
answered, such as: is this kind of situation an exception or a
common feature? And what is the biological relevance of the
variant pathway?
Materials and Methods
Chemicals
All chemicals and enzymes were purchased from Sigma-
Aldrich. Reagents for molecular biology were from Invitrogen.
Oligonucleotides were from Sigma Genosys. Proteinase inhibitor
Pefabloc SC was purchased from Roche Applied Science. The
LysonaseTMBioprocessing Reagent was from Novagen. (3S)-3-
aminobutyryl-CoA was prepared by enzymatic conversion of 3,5-
diaminohexanoate [13]. The compound was produced using
70 mg of 3,5-diaminohexanoate dehydrogenase, 140 mg of 3-keto-
5-aminohexanoate cleavage enzyme, 30 mM 3,5-diaminohexano-
ate, 6 mM NAD+, and 4 mM acetyl-CoA in 500 ml 50 mM Tris/
HCl pH 9.1. Once equilibrium was reached (as indicated by
NAD+reduction kinetics), the reaction was stopped by 1% 13 M
trifluoroacetic acid. 3-aminobutyryl-CoA concentration was esti-
mated by NADH formation. (R,S)-3-aminobutyryl-CoA was
synthesized by Alpha Chimica from (R,S)-3-aminobutyrate. S-
NAC thioesters were synthesized using conventional routes [34]
(see Data S1).
Construction of the expression vectors
The coding sequences of hemL-like (CLOAM0809) and atoA/
atoD from ‘‘Candidatus Cloacamonas acidaminovorans’’ were ampli-
fied by PCR with the following primers:
CLOAM0809-fwd-59-GCAGAAAAATTGAAATTAGCC-39
and
CLOAM0809 -rev-59-TTATAACATCTTTTTCACTTCG-
39;
atoA-fwd-59-GCATTAGATAAACGAGCTATG-39 and
atoA-rev-59-TCAGAAGGTATTAACTCTTTC-39;
atoD-fwd-59-GTACAAATTATTAGTGCCGC-39 and
atoD-rev-59-TTAATTCTCCTTTGCTAAAAC-39
The amplified sequences were inserted into the Invitrogen
pEXP-5-NT/TOPO vector according to the manufacturer’s
protocol. The coding sequence of hemL-like (DIG1_60031) from
the reconstructed genome affiliated with the Bacteroidetes phylum
was amplified with the following primers:
DIG1_60031 -fwd-59-AAAGAAGGAGATAGGATCATGCA
TCATCACCATCACCATTCAAAGAAACTAAAACTGGACG
-39 and
DIG1_60031 -rev-59-GTGTAATGGATAGTGATCTTAAA-
TATATTTTTTCAGTTCGCC-39
The PCR product was inserted into the modified Novagen
pET22b(+) vector (kindly provided by V. Do ¨ring) by directional
cloning according to the ligation independent cloning method
[35]. The sequence of the resulting plasmids, named pEXP5-
HEML-LIKE, pEXP5-ATOA, pEXP5-ATOD, and pET22-
HEML-LIKE, respectively, were verified.
Expression and purification of the recombinant proteins
Cell culture, cell extracts, and protein purifications were
conducted as previously reported [13].
Analytical methods
Acetoacetyl-CoA formation was monitored at 310 nm, in the
presence of Mg2+ions, using a molar extinction coefficient of
11900 M21.cm21at pH 8.1, as described by Stern et al. [36].
Enzyme assays
Butyrate-acetoacetate CoA transferase activity was assayed in the
presence of various substrates by monitoring the formation of
acetoacetyl-CoA (acyl-CoA+acetoacetate«acid+acetoacetyl-CoA).
Reactions were performed in 100 ml of Activity Buffer (50 mM
Tris/HCl pH 8.1) containing 10 mM acetoacetate, 15 mg of
reconstituted AtoA/AtoD complex, and 4 mM MgCl2. The
reaction was initiated by the addition of the acetyl-CoA. 3-
aminobutyryl-CoA aminotransferase activity was assayed following
acetoacetyl-CoA formation. Reactions were performed in 100 ml of
Activity Buffer containing 5 mM MgCl2in the presence of various
concentrations of 3-aminobutyryl-CoA, a-ketoglutarate and pyru-
vate. The kinetic parameters were determined by varying one
substrate concentration while keeping the other one at a fixed
concentration. Kinetic constants were obtained from duplicate
experiments by non-linear analysis of initial rates using SigmaPlot
9.0 (Systat Software, Inc.). Activity-pH and activity-temperature
relationships were determinedbyincubatingtheenzyme atdifferent
pHvaluesandconstanttemperature(28uC) and atconstant pH(8.1)
and different temperatures. As the apparent molecular extinction
coefficient of acetoacetyl-CoA increases continuously with pH [37],
its value was experimentally determined for each pH tested for
enzyme activity. All enzymatic reactions were performed in a Safas
UV mc2
or a Lambda 650 Perkin Elmer double beam
spectrophotometer.
LC/MS analyses
LC/MS analyses were carried out using a LTQ/Orbitrap mass
spectrometer coupled to an Accela LC system (Thermo-Fisher).
Chromatographic separation was conducted using an Acquity
BeH C18 column (15062 mm61.7 mm; Waters) thermostated at
30uC. A mobile phase gradient was used with a flow rate of
0.4 ml/min in which mobile phase A consisted of 10 mM
ammonium acetate adjusted to pH 4.0 with 0.1% (vol/vol) formic
acid and mobile phase B consisted of methanol. The gradient
started at 100% A for 1 min, followed by a linear gradient at
100% B for 7 min, and finally 5 min at 100% B. The entire eluant
was sprayed into the mass spectrometer using a heated electro-
spray ionization source (175uC) at +4.5 kV with sheath, auxiliary
and sweep gases set at 60, 45 and 8 arbitrary units, respectively.
Desolvation of the droplets was further aided by setting the heated
capillary temperature at 250uC. All metabolites were detected in
the positive mode by full scan mass analysis from m/z 50–1000 at a
resolving power of 30,000 at m/z=400. Data dependant scanning
was performed without use of a parent ion list. The resulting ion
fragments were recorded in the LTQ linear trap.
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org8 August 2011 | Volume 6 | Issue 8 | e22918

Page 9

Sequence analysis
The genome sequence of ‘‘Candidatus Cloacamonas acidaminovor-
ans’’ and the corresponding annotations were extracted from EMBL
databankunderaccessionnumberCU466930.Thesequenceofgenes
involved in the lysine fermentation pathway (FN1869, FN1868,
FN1867, FN1866, FN1863, FN1862, Fusobacterium nucleatum ATCC
25586, AE009951) were compared to the ‘‘Candidatus Cloacamonas
acidaminovorans’’ genome and to assembled genomic regions from
theanaerobicdigesterusingtheBLAST2algorithm[38].Thesegenes
were also compared to ‘‘All Metagenomic Sequence Reads (N) » and
All ORF Peptides available through the CAMERA web site
(v1.3.2.29) [28] using the BLAST wizard algorithm. Putative
orthologous relations between two genomes were defined as gene
pairs satisfying the Bidirectional Best Hit criterion and an alignment
threshold of 35% sequence identity over 80% of the length of the
smallestprotein.Syntenygroups,i.e.conservationofthechromosomal
co-localisation between pairs of orthologous genes from different
genomes, were computed as previously described [39]. The data (i.e.
syntactic and functional annotations, and results of comparative
analysis) were stored in a relational database and explored by using
the graphical interface of our microbial genome annotation system,
MaGe. This database is publicly available at http://www.genoscope.
cns.fr/agc/microscope/cloacamonascope [40]. Following the steps
described in de Melo-Minardi et al. [32], homology models were built
foreachsequenceandthenaligned.Residuesofcatalyticpocketswere
extracted, and then submitted to a hierarchical clustering. The set of
sequences for modelling was extracted from Uniprot (Pfam family
PF00202; Aminotransferase class III). A reduced set of 1343
sequences corresponding to a redundancy to 50% (UniRef50) has
been selected (http://www.uniprot.org/uniref/?query=unipro-
t%3a(PF00202)+identity:0.5). Thirteen template structures were used
for modelling the following enzymes: n-acetylornithine aminotrans-
ferase (PDB code: 2PB2, Chain: A), adenosylmethionine-8-amino-7-
oxonanoate aminotransferase (1DTY, A), 7,8-diaminopelargonic acid
synthase (1QJ5, A), 2,2-dialkylglycine decarboxylase (1D7R, A),
gamma-aminobutyrate aminotransferase (1SFF, A), glutamate-1-
semialdehyde aminotransferase (3K28, A), lysine aminotransferase
(2CIN, A), omega-amino acid:pyruvate aminotransferase (3A8U, X),
ornithine aminotransferase (1GBN, A), aminotransferase prk07036
(3I5T, A), d-phenylglycine aminotransferase (2CY8, A), alpha-amino-
epsilon-caprolactam racemase (2ZUK, A), and aminotransferase class
iii (3I4J, A). Half of these structures have been crystallized with a
bound ligand in their active site.
Supporting Information
Figure S1
AtoD complex and Heml-like by Sephadex G-200 gel filtration.
(N) molecular weight standards ovalbumin (mol. wt=43,000),
conalbumin (mol. weight=75,000), aldolase (mol. wt=158,000),
ferritin (mol. weight=440,000), and thyroglobulin (mol. weight
=669,000). (n) Peak of eluted AtoA/AtoD complex. (#) Peak of
eluted HemL-like.
(EPS)
Determination of the molecular weight of the AtoA/
Figure S2
Activity Buffer (50 mM Tris/HCl pH 8.1) after incubation with
excess PLP and submitted to gel filtration.
(EPS)
Absorption spectrum of HemL-like recorded in
Figure S3
Kat from ‘‘Candidatus Cloacamonas acidaminovorans’’. (A) pH-
dependence of activity of Kat. Activities were measured at 28uC in
the presence of 25 mM 3-aminobutyryl-CoA, 30 mM a-ketoglu-
tarate, and 4 mM MgCl2. The buffers used (50 mM) were Tris/
HCl (N), and glycine/NaOH (#). (B) Temperature-dependence of
activity of Kat. Activities were determined in 50 mM Tris/HCl
pH 8.1 with 25 mM 3-aminobutyryl-CoA and 30 mM a-ketoglu-
tarate. Values correspond to the average of two replicates.
(EPS)
pH- and temperature-dependent activity profiles of
Table S1
performed in 100 ml of Activity Buffer containing 4 mM MgCl2,
10 mM acetoacetate,15 mg of reconstituted AtoA/AtoD complex, and
100 mM acyl-CoA. 100% activity corresponds to 1.7 mmole of
product/min/mg. Values correspond to the average of two replicates.
ND: non detected.
(DOC)
Substrate specificity of AtoA/AtoD. Reactions were
Data S1
(DOC)
S-NAC thioesters synthesis.
Acknowledgments
We are very grateful to Nuria Fonknechten, Maxime Durot, and Georges
Cohen for their helpful discussions. We also thank Aure ´lie Fossey for
excellent technical assistance and Susan Cure for reading the manuscript.
Author Contributions
Conceived and designed the experiments: AP MS. Performed the
experiments: CL ST NP CP. Analyzed the data: AP MS CL AK ST NP
CP. Contributed reagents/materials/analysis tools: DV AZ CV KB. Wrote
the paper: AP MS JW.
References
1. Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identification and in
situ detection of individual microbial cells without cultivation. Microbiol Rev 59:
143–169.
2. Cowan DA (2000) Microbial genomes–the untapped resource. Trends
Biotechnol 18: 14–16.
3. Pace NR (1997) A molecular view of microbial diversity and the biosphere.
Science 276: 734–740.
4. Hugenholtz P, Tyson GW (2008) Microbiology: metagenomics. Nature 455:
481–483.
5. DeLong EF, Beja O (2010) The light-driven proton pump proteorhodopsin
enhances bacterial survival during tough times. PLoS Biol 8: e1000359.
6. Sharon I, Alperovitch A, Rohwer F, Haynes M, Glaser F, et al. (2009)
Photosystem I gene cassettes are present in marine virus genomes. Nature 461:
258–262.
7. Ettwig KF, Butler MK, Le Paslier D, Pelletier E, Mangenot S, et al. (2010) Nitrite-
driven anaerobic methane oxidation by oxygenic bacteria. Nature 464: 543–548.
8. Ellrott K, Jaroszewski L, Li W, Wooley JC, Godzik A (2010) Expansion of the
protein repertoire in newly explored environments: human gut microbiome
specific protein families. PLoS Comput Biol 6: e1000798.
9. Yooseph S, Sutton G, Rusch DB, Halpern AL, Williamson SJ, et al. (2007) The
Sorcerer II Global Ocean Sampling expedition: expanding the universe of
protein families. PLoS Biol 5: e16.
10. Chouari R, Le Paslier D, Daegelen P, Ginestet P, Weissenbach J, et al. (2005)
Novel predominant archaeal and bacterial groups revealed by molecular analysis
of an anaerobic sludge digester. Environ Microbiol 7: 1104–1115.
11. Pelletier E, Kreimeyer A, Bocs S, Rouy Z, Gyapay G, et al. (2008) ‘‘Candidatus
Cloacamonas acidaminovorans’’: genome sequence reconstruction provides a
first glimpse of a new bacterial division. J Bacteriol 190: 2572–2579.
12. Angelidaki I, Karakashev D, Batstone DJ, Plugge CM, Stams AJ (2011)
Biomethanation and its potential. Methods Enzymol 494: 327–351.
13. Kreimeyer A, Perret A, Lechaplais C, Vallenet D, Medigue C, et al. (2007)
Identification of the last unknown genes in the fermentation pathway of lysine.
J Biol Chem 282: 7191–7197.
14. Ilag LL, Jahn D (1992) Activity and spectroscopic properties of the Escherichia
coli glutamate 1-semialdehyde aminotransferase and the putative active site
mutant K265R. Biochemistry 31: 7143–7151.
15. Luer C, Schauer S, Mobius K, Schulze J, Schubert WD, et al. (2005) Complex
formation between glutamyl-tRNA reductase and glutamate-1-semialdehyde
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org9 August 2011 | Volume 6 | Issue 8 | e22918

Page 10

2,1-aminomutase in Escherichia coli during the initial reactions of porphyrin
biosynthesis. J Biol Chem 280: 18568–18572.
16. Barker HA, Jeng IM, Neff N, Robertson JM, Tam FK, et al. (1978) Butyryl-
CoA:acetoacetate CoA-transferase from a lysine-fermenting Clostridium. J Biol
Chem 253: 1219–1225.
17. Cary JW, Petersen DJ, Papoutsakis ET, Bennett GN (1990) Cloning and
expression of Clostridium acetobutylicum ATCC 824 acetoacetyl-coenzyme
A:acetate/butyrate:coenzyme A-transferase in Escherichia coli. Appl Environ
Microbiol 56: 1576–1583.
18. Riviere D, Desvignes V, Pelletier E, Chaussonnerie S, Guermazi S, et al. (2009)
Towards the definition of a core of microorganisms involved in anaerobic
digestion of sludge. Isme J 3: 700–714.
19. Kim J, Kyung D, Yun H, Cho BK, Seo JH, et al. (2007) Cloning and
characterization of a novel beta-transaminase from Mesorhizobium sp. strain
LUK: a new biocatalyst for the synthesis of enantiomerically pure beta-amino
acids. Appl Environ Microbiol 73: 1772–1782.
20. Yue S, Duncan JS, Yoshikuni Y, Hutchinson CR (1987) Macrolide biosynthesis.
Tylactone formation involves the processive addition of three carbon units. J Am
Chem Soc 109: 1253–1255.
21. Herrmann G, Jayamani E, Mai G, Buckel W (2008) Energy conservation via
electron-transferring flavoprotein in anaerobic bacteria. J Bacteriol 190:
784–791.
22. Li F, Hinderberger J, Seedorf H, Zhang J, Buckel W, et al. (2008) Coupled
ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by
the butyryl-CoA dehydrogenase/Etf complex from Clostridium kluyveri.
J Bacteriol 190: 843–850.
23. McInerney MJ, Sieber JR, Gunsalus RP (2009) Syntrophy in anaerobic global
carbon cycles. Curr Opin Biotechnol 20: 623–632.
24. Buckel W, Barker HA (1974) Two pathways of glutamate fermentation by
anaerobic bacteria. J Bacteriol 117: 1248–1260.
25. Lerud RF, Whiteley HR (1971) Purification and properties of alpha-
ketoglutarate reductase from Micrococcus aerogenes. J Bacteriol 106: 571–577.
26. Barker HA, Kahn JM, Hedrick L (1982) Pathway of lysine degradation in
Fusobacterium nucleatum. J Bacteriol 152: 201–207.
27. Stadtman TC (1973) Lysine metabolism by Clostridia. Advances in Enzymology
- and Related Areas of Molecular Biology 38: 413–448.
28. Seshadri R, Kravitz SA, Smarr L, Gilna P, Frazier M (2007) CAMERA: a
community resource for metagenomics. PLoS Biol 5: e75.
29. Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, et al. (2010) A human gut
microbial gene catalogue established by metagenomic sequencing. Nature 464:
59–65.
30. Galushko A, Minz D, Schink B, Widdel F (1999) Anaerobic degradation of
naphthalene by a pure culture of a novel type of marine sulphate-reducing
bacterium. Environ Microbiol 1: 415–420.
31. Battey JN, Kopp J, Bordoli L, Read RJ, Clarke ND, et al. (2007) Automated
server predictions in CASP7. Proteins 69 Suppl 8: 68–82.
32. de Melo-Minardi RC, Bastard K, Artiguenave F (2010) Identification of
subfamily-specific sites based on active sites modeling and clustering. Bioinfor-
matics 26: 3075–3082.
33. Chouari R, Le Paslier D, Dauga C, Daegelen P, Weissenbach J, et al. (2005)
Novel major bacterial candidate division within a municipal anaerobic sludge
digester. Appl Environ Microbiol 71: 2145–2153.
34. Brobst SW, Townsend CA (1994) The Potential Role of Fatty-Acid Initiation in
the Biosynthesis of the Fungal Aromatic Polyketide Aflatoxin B-1. Canadian
Journal of Chemistry-Revue Canadienne De Chimie 72: 200–207.
35. de Jong RN, Daniels MA, Kaptein R, Folkers GE (2006) Enzyme free cloning
for high throughput gene cloning and expression. J Struct Funct Genomics 7:
109–118.
36. Stern JR, Coon MJ, Delcampillo A, Schneider MC (1956) Enzymes of Fatty
Acid Metabolism .4. Preparation and Properties of Coenzyme a Transferase.
Journal of Biological Chemistry 221: 15–31.
37. Stern JR (1956) Optical properties of aceto-acetyl-S-coenzyme A and its metal
chelates. J Biol Chem 221: 33–44.
38. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, et al. (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res 25: 3389–3402.
39. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, et al. (2006) MaGe: a
microbial genome annotation system supported by synteny results. Nucleic Acids
Res 34: 53–65.
40. Vallenet D, Engelen S, Mornico D, Cruveiller S, Fleury L, et al. (2009)
MicroScope: a platform for microbial genome annotation and comparative
genomics. Database (Oxford) 2009: bap021.
A New Acyl-CoA Beta-Transaminase
PLoS ONE | www.plosone.org10 August 2011 | Volume 6 | Issue 8 | e22918