Construction of a lytically replicating Kaposi's sarcoma-associated herpesvirus.

Matthias Budt, Tsvetana Hristozova, Georg Hille, Katrin Berger, Wolfram Brune

Division of Viral Infections, Robert Koch Institute, Berlin, Germany.

Journal Article: Journal of virology (impact factor: 5.15). 07/2011; 85(19):10415-20. DOI: 10.1128/JVI.05071-11

Abstract

Karposi's sarcoma-associated herpesvirus (KSHV) is found predominantly in a latent state in most cell types, impeding investigations of the lytic replication cycle. Here, we engineered the cloned KSHV genome, bacterial artificial chromosome 36 (BAC36), to enforce constitutive expression of the main lytic switch regulator, the replication and transcription activator (RTA) (open reading frame 50 [ORF50]). The resulting virus, KSHV-lyt, activated by default the lytic cycle and replicated to high titers in various cells. Using KSHV-lyt, we showed that ORF33 (encoding a tegument protein) is essential for lytic KSHV replication in cell culture, but ORF73 (encoding the latent nuclear antigen [LANA]) is not. Thus, KSHV-lyt should be highly useful to study viral gene function during lytic replication.

Source: PubMed

Comments on this publication

ResearchGate members can add comments. Sign up now and post your comment!

Similar publications

Page 1
 
Page 2
 
Page 3
 
Page 4
 
Page 5
 
Page 6
 
Page 1
JOURNAL OF VIROLOGY, Oct. 2011, p. 10415–10420 Vol. 85, No. 19
0022-538X/11/$12.00 doi:10.1128/JVI.05071-11
Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Construction of a Lytically Replicating Kaposi’s
Sarcoma-Associated Herpesvirus�
Matthias Budt,1 Tsvetana Hristozova,1 Georg Hille,1 Katrin Berger,1 and Wolfram Brune1,2*
Division of Viral Infections, Robert Koch Institute, Nordufer 20, 13353 Berlin, Germany,1 and Heinrich Pette Institute,
Leibniz Institute for Experimental Virology, Martinistr. 52, 20251 Hamburg, Germany2
Received 10 May 2011/Accepted 18 July 2011
Karposi’s sarcoma-associated herpesvirus (KSHV) is found predominantly in a latent state in most cell
types, impeding investigations of the lytic replication cycle. Here, we engineered the cloned KSHV genome,
bacterial artificial chromosome 36 (BAC36), to enforce constitutive expression of the main lytic switch
regulator, the replication and transcription activator (RTA) (open reading frame 50 [ORF50]). The resulting
virus, KSHV-lyt, activated by default the lytic cycle and replicated to high titers in various cells. Using
KSHV-lyt, we showed that ORF33 (encoding a tegument protein) is essential for lytic KSHV replication in cell
culture, but ORF73 (encoding the latent nuclear antigen [LANA]) is not. Thus, KSHV-lyt should be highly
useful to study viral gene function during lytic replication.
Kaposi’s sarcoma-associated herpesvirus (KSHV; human
herpesvirus 8) is the etiologic agent of Kaposi’s sarcoma and
the B-cell-derived malignancies multicentric Castleman’s dis-
ease (MCD) and primary effusion lymphoma (PEL) (3, 5).
KSHV infects a variety of cell types in vivo but predominantly
establishes a latent state of infection (1). During latency, the
viral genome is maintained in the nucleus as an episome, and
only a few viral genes are expressed. Although latent infection
seems to be sufficient to promote cellular transformation, lytic
replication is also required for KS development (17) and for
virus dissemination. The switch from latency to lytic replication
is initiated by the open reading frame 50 (ORF50)-encoded
replication and transcription activator (RTA) protein. The
ORF50 transcript consists of two exons separated by an intron,
which encoded ORF49 on the complementary strand (Fig.
1A). Splicing of ORF50 mRNA allows the expression of RTA,
which functions as an immediate-early transcription factor ca-
pable of inducing many viral and cellular genes (9, 15, 20).
RTA expression is both necessary and sufficient to induce the
complete progression of KSHV through the lytic cycle (9).
In vitro, KSHV infection is either abortive or results in la-
tency in most cell types (1). Lytic replication was found to some
extent after infection of primary human endothelial cells but
was not self-sustaining over longer periods of time (4, 7). In
latently infected cells, KSHV reactivation can be triggered
by chemical inducers, such as 12-O-tetradecanoylphorbol-13-
acetate (TPA) or sodium butyrate (13). However, these chem-
icals are quite toxic and can cause unwanted side effects (6).
Alternatively, enforced RTA expression in trans by a plasmid
or viral vector can be used to drive KSHV lytic replication (1).
However, these systems are not self-sustaining, and replication
stops when the inducing stimulus is withdrawn. Here, we de-
scribe the construction and characterization of a recombinant
KSHV carrying an intronless ORF50 gene under the control of
a constitutively active promoter. The recombinant virus enters
the lytic replication cycle by default in different cell types
without the need for further induction. Infected cells display a
cytopathic effect (CPE), produce expanding foci, express all
kinetic classes of viral genes, and release considerable amounts
of virus progeny into the supernatant. We further show that
this lytically replicating KSHV can be used to analyze viral
gene function during lytic replication.
A KSHV genome derived from the PEL cell line BCBL1
has been cloned as a bacterial artificial chromosome (termed
BAC36) in Escherichia coli, making it amenable to bacterial
mutagenesis techniques (26). We used BAC36 to construct a
lytically replicating KSHV clone. First, we replaced ORF50
exon 1 and ORF49 (nucleotides [nt] 71110 to 72093 in BAC36,
GenBank accession number HQ404500) by homologous re-
combination using a zeocin resistance cassette PCR amplified
with primers 5�-CAACCTTACTCCGCAAGGGGTAGTCT
GTTGTGAGAATACTGTCCAGGCAGTCAAGTCCTGC
TCCTCCTCGGCCA-3� and 5�-CCGAGAGGCCGACGA
AGCTTTCCACACAGGACCGCCGAAGCTTCTTACCC
TTGTTGACAATTAATCATCGGCA-3� essentially as
described previously (21). The resulting BAC was termed
KSHV�49 (Fig. 1A). For the second recombination step, a
helper plasmid was constructed. It contained ORF49, a kana-
mycin resistance (kan) marker, a cellular phosphoglycerate
kinase (PGK) promoter, ORF50 exon 1, and 50-nt flanking
sequences for homologous recombination. Briefly, two oligonu-
cleotides (5�-GATCTCCACCATGGCGCAAGATGACAAGG
GTAAGAAGCTTCGGCGGTCCTGTGTGGAAAGCTTCG
TCGGCCTCTCGGGCC-3� and 5�-GGCCGCAACCTTACTC
CGCAAGGGGTAGTCTGTTGTGAGAATACTGTCCAGG
CAG-3�) were inserted into pReplacer (11) between the BglII
and ApaI sites and the NotI and EcoRI sites, respectively.
ORF49 was then PCR amplified and inserted between the
BamHI and EcoRI sites. A kan marker flanked by FLP recom-
bination target (FRT) sites was introduced at the EcoRI site.
The recombination cassette was excised with NotI and ApaI
from the helper plasmid and used to modify KSHV�49 (Fig.
* Corresponding author. Mailing address: Heinrich Pette Institute,
Leibniz Institute for Experimental Virology, Martinistr. 52, 20251
Hamburg, Germany. Phone: 49 40 48051351. Fax: 49 40 48051352.
E-mail: wolfram.brune@hpi.uni-hamburg.de.
� Published ahead of print on 27 July 2011.
10415
Page 2
1A). Finally, the kan marker was removed with FLP recombi-
nase yielding KSHV-lyt, in which an intronless ORF50 gene is
driven by a PGK promoter. All constructs were analyzed by
restriction digest and gel electrophoresis (Fig. 1B), by PCR,
and by sequencing the relevant regions (data not shown).
Transfection of BAC DNA into telomerase-immortalized
retinal pigment epithelial cells (hTERT-RPE1, ATCC CRL-
4000) was monitored by expression of green fluorescent pro-
tein (GFP), which is encoded adjacent to the BAC cassette
(26). Transfection of KSHV-lyt resulted in the development of
morphologically distinct foci of GFP-expressing cells (Fig. 2A),
suggesting that KSHV-lyt-derived virus was able to cause CPE
and spread to neighboring cells without any further exogenous
stimulus. Foci increased in size and number over time until the
entire monolayer was infected. In contrast, the parental BAC36
did not spread and did not form foci. After transfer of the super-
natant from infected cells to fresh RPE1 cells, new foci appeared,
even if the supernatant was passed through a 0.45-�m filter.
By the same three-step procedure outlined in Fig. 1A, we
also constructed KSHV-lyt[�49]. ORF49 was not reinserted in
the second recombination step, but otherwise KSHV-lyt[�49]
was constructed analogously to KSHV-lyt. KSHV-lyt[�49]
formed foci and replicated in RPE1 like KSHV-lyt (data not
shown), indicating that ORF49 is not required for KSHV lytic
replication. However, since a previous study has shown that
ORF49 cooperates with RTA to activate several KSHV lytic
promoters (8), we decided to continue further work only with
KSHV-lyt.
Surprisingly, serial passaging of KSHV-lyt virus resulted in a
loss of GFP expression within the first 2 to 3 passages (Fig. 2B).
FIG. 1. Construction of KSHV-lyt. (A) Schematic illustration of KSHV BAC36 mutagenesis. ORF50 exon 1 and ORF49 were first replaced by
a zeo cassette. ORF49 was then reinserted in reverse orientation together with a PGK promoter and ORF50 exon 1. The kan cassette flanked by
FRT sites (black ovals) was subsequently removed with FLP recombinase. Nucleotide positions refer to GenBank accession no. HQ404500.
(B) XbaI restriction pattern of the parental and mutant BAC genomes in an ethidium bromide-stained agarose gel. For better visibility, images
of the upper and lower parts of the gel were taken separately. Fragments affected by mutagenesis as predicted in panel A are indicated by
arrowheads.
10416 NOTES J. VIROL.
Page 3
KSHV virion DNA was recovered from supernatants of in-
fected RPE1 cells and analyzed by restriction digest. Com-
pared to KSHV-lyt BAC DNA, the virion DNA lacked the
region containing the BAC cassette (Fig. 2C and D), suggest-
ing that the BAC replicon and the adjacent GFP expression
cassette were lost during virus reconstitution and lytic replica-
tion. In an attempt to avoid the loss of GFP expression, we
constructed a modified version of KSHV-lyt, in which the BAC
cassette contained a Cre recombinase gene and was flanked
with loxP sites to make it self-excising. Such a procedure has
been used previously for other herpesvirus BACs (19, 24). The
GFP gene was kept outside the loxP-flanked region in order to
preserve GFP expression after excision of the BAC replicon.
Much to our chagrin, this modification did not prevent loss of
GFP expression during virus reconstitution (data not shown).
When we further investigated the underlying reason for this
phenomenon, we found out that the region in which the BAC
cassette was inserted was duplicated in the parental BAC36.
The second copy of the region, ranging approximately from
ORF K5 to ORF19, is located within the terminal repeats
(TRs) and contains the BAC cassette (data not shown). While
this work was in progress, an analysis of the complete BAC36
sequence was published by others (23). The paper identified
and documented the same duplication that we had observed.
Hence, we did not further investigate this property of BAC36.
However, the presence of the BAC cassette within the dupli-
cated region within the TR region offers a rational explanation
for the rapid loss of the BAC cassette and the GFP gene. In
fact, a recent publication suggested that the TRs are a suitable
location for insertion of the BAC cassette, because it will be
automatically excised upon virus reconstitution by terminal
repeat-mediated homologous recombination (25).
FIG. 2. Analysis of KSHV-lyt replication. (A) Virus reconstitution following BAC transfection into RPE1 cells. GFP expression and focus
formation was observed by fluorescence microscopy over time. Images were taken 1 and 8 days posttransfection (dpt). (B) Focus formation 8 days
after transferring infected cell supernatant onto fresh RPE1 cells. (C) Comparison of KSHV-lyt BAC and virion DNA. Equal amounts of DNA
were digested with PmeI or XhoI and analyzed by gel electrophoresis. Fragments representing the BAC cassette are indicated by arrowheads.
Asterisks indicate additional differences. (D) The PmeI and XhoI restriction maps with the expected fragments in the BAC cassette region are
depicted. (E) Replication of KSHV-lyt on different cells after low-MOI infection. Titers (focus-forming units) were determined on RPE1 cells
using the TCID50 method. DL, detection limit.
VOL. 85, 2011 NOTES 10417
Page 4
RPE1 cells were used routinely for virus reconstitution from
BAC DNA and for titration of infectious KSHV. They have an
intact contact inhibition response and tolerate the prolonged
culturing required to recover replicating virus after BAC trans-
fection. RPE1 cells were also the preferred cell type for titra-
tion, because they developed the clearest CPE and showed the
most reliable and reproducible results. Viral titers (focus-form-
ing units) were determined using the 50% tissue culture infec-
tive dose (TCID50) method (16). Larger quantities of infec-
tious virus were grown on RPE1 cells and harvested from the
supernatants of infected cells. High-titer KSHV-lyt stocks were
obtained by pelleting the virus (180 min at 27,000 � g) and
resuspending it in a smaller volume of complete medium. To
determine the replication capability of KSHV-lyt, growth ki-
netics were determined on different cells. RPE1 cells, Vero
cells (ATCC CRL-1587D), and primary human umbilical vein
endothelial cells (HUVEC) (Lonza, Switzerland) were in-
fected at a multiplicity of infection (MOI) of 0.02 using 5 �g/ml
Polybrene and centrifugal enhancement of infection (30 min at
900 � g). On all cell lines used here, KSHV-lyt infection led to
cell rounding and swelling, release of infectious virions into the
supernatant, and finally cell demise several days after infection.
After low-MOI infection, the virus replicated to maximum
titers of about 105 TCID50/ml in RPE1 cells.
Next, we tested whether KSHV-lyt can be used to determine
the importance of viral genes for lytic replication. First, we
replaced ORF33, encoding a tegument protein (27), with a
galK-kan cassette with methods described previously (18). In a
second step, galK-kan was removed by homologous recombi-
nation using a synthetic oligonucleotide (5�-GCTATAGGGC
GTCGAAGGAGGATCTGGTGTTCATTCGAGGCC
GCTATGGCTAGCAGCATGTTGCGCACATCAGC
GAGCTGGACCGTCCTCCGGGTCGCGT-3�), generating
the seamless deletion mutant KSHV-lyt�33. The revertant vi-
rus, Rev33, was obtained by replacing galK-kan with a PCR-
amplified ORF33 sequence (Fig. 3A). Mutant BACs were
FIG. 3. ORF33 is required for KSHV-lyt lytic replication. (A) Genomic organization of KSHV-lyt ORF33 mutants. Nucleotide positions refer
to GenBank accession no. HQ404500. (B) Acc65I (isoschizomer of KpnI) restriction pattern of the parental and mutant BAC genomes in an
ethidium bromide-stained agarose gel. The relevant fragments (see panel A) are indicated by arrowheads. (C) RPE1 cells were transfected with
recombinant BAC genomes as indicated, and GFP fluorescence was observed 10 days posttransfection. (D) RPE1 cells were infected at an MOI
of 0.02 TCID50/cell of the indicated viruses. Infectious virus (focus-forming units) released into the supernatants was titrated on RPE1 cells. DL,
detection limit.
10418 NOTES J. VIROL.
Page 5
checked by restriction digest (Fig. 3B) and transfected into
RPE1 cells (Fig. 3C). As expected, parental and revertant
BACs yielded infectious virus that replicated to comparable
titers (Fig. 3D). The �33 deletion mutants (with or without
galK-kan) repeatedly failed to reconstitute infectious virus, in-
dicating that ORF33 is essential for lytic replication. This re-
sult matches similar findings for the related gammaherpesvirus
murid herpesvirus 68 (MHV-68), in which ORF33 is also es-
sential for replication (10).
The LANA-encoding ORF73 was deleted by a similar ap-
proach (Fig. 4A). ORF73 was first replaced with galK-kan,
yielding KSHV-lyt�73. A cloned KSHV fragment containing
ORF73 and approximately 150 nt of flanking KSHV sequence
(kindly provided by Rolf Renne) was then used to generate the
revertant Rev73. LANA expression from the recombinant
KSHVs was checked by immunofluorescence (Fig. 4B) and
immunoblotting (Fig. 4C). As the cloned ORF73 sequence
used for Rev73 was derived from a different KSHV clone and
contained fewer internal repeats, Rev73-expressed LANA was
slightly smaller in size than that of the parental virus. All three
recombinant viruses expressed RTA and K8.1 proteins in in-
fected RPE1 cells (Fig. 4C), demonstrating that LANA expres-
sion is not essential for KSHV lytic replication. However, the
�73 mutant grew to slightly lower titers than the parental and
revertant viruses, indicating that LANA might contribute di-
rectly or indirectly to lytic virus production (Fig. 4D). In con-
trast, LANA-deficient KSHV BAC36 and rhesus rhadinovirus
showed increased virus production in previous studies, which
was attributed to the loss of LANA-mediated repression of the
RTA promoter (14, 22). This repression is probably absent in
KSHV-lyt, as RTA expression is driven by a heterologous
promoter.
In summary, we demonstrated that a molecular KSHV clone
modified to express RTA constitutively replicates to substan-
tial titers in cultured cells. The lytically replicating KSHV is
well suited to study viral gene function during lytic replication.
Another promising application for lytically replicating KSHV
is the field of antiviral drug testing. Most of the available
antiherpesviral drugs target the lytic replication phase (12, 17)
and are therefore difficult to test with previously available
systems in which KSHV is predominantly latent (2). Of course,
PEL cell lines and unmodified BAC36 remain the systems of
choice for investigating latency and reactivation.
We thank Shou-Jiang Gao for BAC36, Gary Hayward and Keji
Ueda for antibodies, Thomas Schulz and Cornelia Henke-Gendo for
sharing the BAC36 sequence before publication, and Antonio Gallo
and Adam Grundhoff for a critical reading of the manuscript.
REFERENCES
1. Bechtel, J. T., Y. Liang, J. Hvidding, and D. Ganem. 2003. Host range of
Kaposi’s sarcoma-associated herpesvirus in cultured cells. J. Virol. 77:6474–
6481.
2. Casper, C., and A. Wald. 2006. The use of antiviral drugs in the prevention
FIG. 4. ORF73 is dispensable for KSHV-lyt lytic replication. (A) Genomic organization of KSHV-lyt ORF73 mutants. Nucleotide positions
refer to GenBank accession no. HQ404500. (B) RPE1 cells were infected as indicated and analyzed by immunofluorescence. RTA was stained with
a rabbit antiserum (kindly provided by Gary Hayward) and Alexa Fluor 488-coupled anti-rabbit IgG (Invitrogen, Germany). LANA was visualized
with mouse anti-LANA (Acris, Germany) and Alexa Fluor 568-coupled anti-mouse IgG. Nuclei were counterstained with DAPI (4�,6-diamidino-
2-phenylindole). (C) Viral protein expression in infected RPE1 cells was analyzed by immunoblotting with the same primary antibodies as those
described above or anti-K8.1 (Santa Cruz, CA) and peroxidase-coupled (Dako, Germany) secondary antibodies. (D) RPE1 cells were infected at
an MOI of 0.005 TCID50/cell, and viral titers (focus-forming units) in the supernatant were determined. DL, detection limit.
VOL. 85, 2011 NOTES 10419
Page 6
and treatment of Kaposi sarcoma, multicentric Castleman disease and pri-
mary effusion lymphoma, p. 289–307. In R. W. Compans et al. (ed.), Current
topics in microbiology and immunology, vol. 312. Springer Verlag, Berlin,
Germany.
3. Chang, Y., et al. 1994. Identification of herpesvirus-like DNA sequences in
AIDS-associated Kaposi’s sarcoma. Science 266:1865–1869.
4. Ciufo, D. M., et al. 2001. Spindle cell conversion by Kaposi’s sarcoma-
associated herpesvirus: formation of colonies and plaques with mixed lytic
and latent gene expression in infected primary dermal microvascular endo-
thelial cell cultures. J. Virol. 75:5614–5626.
5. Damania, B. 2004. Oncogenic gamma-herpesviruses: comparison of viral
proteins involved in tumorigenesis. Nat. Rev. Microbiol. 2:656–668.
6. Filippovich, I., N. Sorokina, K. K. Khanna, and M. F. Lavin. 1994. Butyrate
induced apoptosis in lymphoid cells preceded by transient over-expression of
HSP70 mRNA. Biochem. Biophys. Res. Commun. 198:257–265.
7. Gao, S. J., J. H. Deng, and F. C. Zhou. 2003. Productive lytic replication of
a recombinant Kaposi’s sarcoma-associated herpesvirus in efficient primary
infection of primary human endothelial cells. J. Virol. 77:9738–9749.
8. Gonzalez, C. M., et al. 2006. Identification and characterization of the Orf49
protein of Kaposi’s sarcoma-associated herpesvirus. J. Virol. 80:3062–3070.
9. Gradoville, L., et al. 2000. Kaposi’s sarcoma-associated herpesvirus open
reading frame 50/Rta protein activates the entire viral lytic cycle in the
HH-B2 primary effusion lymphoma cell line. J. Virol. 74:6207–6212.
10. Guo, H., L. Wang, L. Peng, Z. H. Zhou, and H. Deng. 2009. Open reading
frame 33 of a gammaherpesvirus encodes a tegument protein essential for
virion morphogenesis and egress. J. Virol. 83:10582–10595.
11. Jurak, I., and W. Brune. 2006. Induction of apoptosis limits cytomegalovirus
cross-species infection. EMBO J. 25:2634–2642.
12. Kedes, D. H., and D. Ganem. 1997. Sensitivity of Kaposi’s sarcoma-associ-
ated herpesvirus replication to antiviral drugs. Implications for potential
therapy. J. Clin. Invest. 99:2082–2086.
13. Lagunoff, M., et al. 2002. De novo infection and serial transmission of
Kaposi’s sarcoma-associated herpesvirus in cultured endothelial cells. J. Vi-
rol. 76:2440–2448.
14. Li, Q., F. Zhou, F. Ye, and S. J. Gao. 2008. Genetic disruption of KSHV
major latent nuclear antigen LANA enhances viral lytic transcriptional pro-
gram. Virology 379:234–244.
15. Lukac, D. M., J. R. Kirshner, and D. Ganem. 1999. Transcriptional activa-
tion by the product of open reading frame 50 of Kaposi’s sarcoma-associated
herpesvirus is required for lytic viral reactivation in B cells. J. Virol. 73:9348–
9361.
16. Mahy, B. W. J., and H. O. Kangro. 1996. Virology methods manual. Aca-
demic Press, San Diego, CA.
17. Martin, D. F., et al. 1999. Oral ganciclovir for patients with cytomegalovirus
retinitis treated with a ganciclovir implant. N. Engl. J. Med. 340:1063–1070.
18. Qian, Z., B. Xuan, T. T. Hong, and D. Yu. 2008. The full-length protein
encoded by human cytomegalovirus gene UL117 is required for the proper
maturation of viral replication compartments. J. Virol. 82:3452–3465.
19. Smith, G. A., and L. W. Enquist. 2000. A self-recombining bacterial artificial
chromosome and its application for analysis of herpesvirus pathogenesis.
Proc. Natl. Acad. Sci. U. S. A. 97:4873–4878.
20. Sun, R., et al. 1998. A viral gene that activates lytic cycle expression of
Kaposi’s sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. U. S. A.
95:10866–10871.
21. Valchanova, R. S., M. Picard-Maureau, M. Budt, and W. Brune. 2006.
Murine cytomegalovirus m142 and m143 are both required to block protein
kinase R-mediated shutdown of protein synthesis. J. Virol. 80:10181–10190.
22. Wen, K. W., D. P. Dittmer, and B. Damania. 2009. Disruption of LANA in
rhesus rhadinovirus generates a highly lytic recombinant virus. J. Virol.
83:9786–9802.
23. Yakushko, Y., et al. 2011. Kaposi’s sarcoma-associated herpesvirus bacterial
artificial chromosome contains a duplication of a long unique-region frag-
ment within the terminal repeat region. J. Virol. 85:4612–4617.
24. Yu, D., G. A. Smith, L. W. Enquist, and T. Shenk. 2002. Construction of a
self-excisable bacterial artificial chromosome containing the human cyto-
megalovirus genome and mutagenesis of the diploid TRL/IRL13 gene. J. Vi-
rol. 76:2316–2328.
25. Zhou, F., Q. Li, S. W. Wong, and S. J. Gao. 2010. Autoexcision of bacterial
artificial chromosome facilitated by terminal repeat-mediated homologous
recombination: a novel approach for generating traceless genetic mutants of
herpesviruses. J. Virol. 84:2871–2880.
26. Zhou, F. C., et al. 2002. Efficient infection by a recombinant Kaposi’s sar-
coma-associated herpesvirus cloned in a bacterial artificial chromosome:
application for genetic analysis. J. Virol. 76:6185–6196.
27. Zhu, F. X., J. M. Chong, L. Wu, and Y. Yuan. 2005. Virion proteins of
Kaposi’s sarcoma-associated herpesvirus. J. Virol. 79:800–811.
10420 NOTES J. VIROL.
View full-text

Resources

Science & Research Jobs

Keywords

bacterial artificial chromosome 36
 
cell types
 
cloned KSHV genome
 
Karposi's sarcoma-associated herpesvirus
 
KSHV
 
KSHV-lyt
 
latent nuclear antigen [LANA]
 
latent state
 
lytic cycle
 
lytic KSHV replication
 
lytic replication
 
lytic replication cycle
 
main lytic
 
open reading frame 50 [ORF50]
 
study viral gene function
 
titers
 
transcription activator
 
various cells