RNA interference targeting survivin exerts antitumoral effects in vitro and in established glioma xenografts in vivo.

Abstract

Malignant glioma represents the most common primary adult brain tumor in Western industrialized countries. Despite aggressive treatment modalities, the median survival duration for patients with glioblastoma multiforme (GBM), the highest grade malignant glioma, has not improved significantly over past decades. One promising approach to deal with GBM is the inactivation of proteins essential for survival or progression of glioma cells by means of RNA interference (RNAi) techniques. A likely candidate for an RNAi therapy of gliomas is the inhibitor of apoptosis protein survivin. Survivin is involved in 2 main cellular processes-cell division and inhibition of apoptosis. We show here that stable RNAi of survivin induced polyploidy, apoptosis, and impaired proliferation of human U343-MG, U373-MG, H4, and U87-MG cells and of primary glioblastoma cells. Proteome profiler arrays using U373-MG cells identified a novel set of differentially expressed genes upon RNAi-mediated survivin knockdown. In particular, the death receptor TRAIL R2/DR5 was strongly upregulated in survivin-depleted glioma cells, inducing an enhanced cytotoxic response of allogeneic human NK cells. Moreover, an experimental in vivo therapy using polyethylenimine (PEI)/siRNA complexes for survivin knockdown efficiently blocked tumor growth of established subcutaneous U373-MG tumors and enhanced survival of NMRI(nu/nu) mice orthopically transplanted with U87-MG cells. We conclude that survivin is functionally relevant in gliomas and that PEI-mediated exogenous delivery of siRNA targeting survivin is a promising strategy for glioblastoma therapy.

Full text

Page 1

RNA interference targeting survivin exerts
antitumoral effects in vitro and in established
glioma xenografts in vivo
Sandy Hendruschk, Ralf Wiedemuth, Achim Aigner, Katrin To ¨pfer, Marc Cartellieri,
Daniel Martin, Matthias Kirsch, Chrysanthy Ikonomidou, Gabriele Schackert,
and Achim Temme
Department of Neurosurgery (S.H., R.W., K.T., D.M., M.K., G.S., A.T.), University Hospital Carl Gustav Carus
and Institute of Immunology (M.C.), Medical Faculty Carl Gustav Carus, Technical University Dresden,
Dresden; Institute of Pharmacology, Philipps University, Faculty of Medicine, Marburg, Germany (A.A.);
Department of Pediatric Neurology, University of Wisconsin-Madison, WI, USA (C.I.)
Malignant glioma represents the most common primary
adult brain tumor in Western industrialized countries.
Despite aggressive treatment modalities, the median sur-
vival duration for patients with glioblastoma multiforme
(GBM), the highest grade malignant glioma, has not
improved significantly over past decades. One promising
approachtodealwithGBMistheinactivationofproteins
essential for survival or progression of glioma cells by
means of RNA interference (RNAi) techniques. A likely
candidateforanRNAitherapyofgliomasistheinhibitor
of apoptosis protein survivin. Survivin is involved in 2
main cellular processes–cell division and inhibition of
apoptosis. We show here that stable RNAi of survivin
induced polyploidy, apoptosis, and impaired prolifer-
ation of human U343-MG, U373-MG, H4, and U87-
MG cells and of primary glioblastoma cells. Proteome
profiler arrays using U373-MG cells identified a novel
setofdifferentiallyexpressedgenesuponRNAi-mediated
survivin knockdown. In particular, the death receptor
TRAIL R2/DR5 was strongly upregulated in survivin-
depleted glioma cells, inducing an enhanced cytotoxic
response of allogeneic human NK cells. Moreover, an
experimental in vivo therapy using polyethylenimine
(PEI)/siRNA complexes for survivin knockdown effi-
cientlyblockedtumor growthof established
subcutaneous U373-MG tumors and enhanced survival
of NMRInu/numice orthopically transplanted with
U87-MG cells. We conclude that survivin is functionally
relevant in gliomas and that PEI-mediated exogenous
delivery of siRNA targeting survivin is a promising strat-
egy for glioblastoma therapy.
Keywords: glioblastoma, RNAi, survivin.
I
resection followed by radiotherapy and chemotherapy,
these tumors ultimately recur.3–5The median duration
of survival for patients with the highest grade malignant
glioma, glioblastoma multiforme (GBM), has not
improved significantly over the past decades, remaining
at 12–15 months.5The infiltrative nature of the
tumor, the impracticability of optimal resection, and
the resistance to combined chemo- and radiation
therapy lead to a 5-year survival rate of ,2%.3This
extraordinarily high morbidity has triggered a vigorous
searchfor novelandmore
approaches.
One promising avenue to deal with glioma—in par-
ticular, with glioblastoma—is the inactivation of pro-
teins that are essential for survival or progression by
RNA interference (RNAi), finally leading to the destruc-
tion of the tumor cells. Major targets for RNAi therapy
include oncogenes and genes that are involved in angio-
genesis, metastasis, survival, anti-apoptosis, and resist-
ance to chemotherapy (for review, see Ashihara et al6),
yet they must be carefully selected. Optimal RNAi
n Western industrialized countries, malignant glioma
represents the most common primary adult brain
tumor.1,2Despite aggressive treatment with surgical
specifictherapeutic
#The Author(s) 2011. Published by Oxford University Press on behalf of the Society for Neuro-Oncology.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial
License (http://creativecommons.org/licenses/by-nc/2.5) which permits unrestricted non-commercial use, distribution,
and reproduction in any medium, provided the original work is properly cited.
Corresponding Author: Achim Temme, Professor, Department of
Neurosurgery, Section Experimental Neurosurgery/Tumor
Immunology, University Hospital Carl Gustav Carus, Technical
University Dresden, Fetscherstrasse 74, 01307 Dresden, Germany
(achim.temme@uniklinikum-dresden.de).
Received June 22, 2010; accepted June 1, 2011.
Neuro-Oncology 13(10):1074–1089, 2011.
doi:10.1093/neuonc/nor098
Advance Access publication July 25, 2011
NEURO-ONCOLOGY

Page 2

targets to treat tumors include molecules that are func-
tionally relevant in the tumor and, to avoid site effects,
should not be expressed at significant levels in normal
tissues. In addition, when using a 1-target-approach,
RNAi-targets should be chosen that cannot be function-
ally compensated by other members of the same protein
family.
Among the family of inhibitor of apoptosis proteins
(IAPs), survivin has received special attention because it
is highly expressed in cancer tissues and cancer cell
lines.7A large comparative scale analysis of human tran-
scriptsintumorandnormaltissue identifiedsurvivinas1
of the 4 most highly expressed genes selectively found in
tumors.8Survivin is also expressed in human gliomas,9
where increased levels of expression have been described
to correlate with higher malignancy of the tumor and,
therefore, with a poorer prognosis.10–12Survivin exerts
an anti-apoptotic function through its baculoviral IAP
repeats domain by binding to activated caspases.13,14
Furthermore, an anti-apoptotic capacity of survivin
through inhibition of the second mitochondria derived
apoptosis inducing factor Smac/DIABLO15and of the
apoptosis inducing factor has been reported.16The gene
for survivin, birc5, is located in 17q25 and gives rise to
a dominant expressed isoform with a molecular weight
of 16.5 kD.7Survivin is periodically expressed during
the cell cycle, with peak expression in the G2and the M
phase.17Interestingly, its expression is impaired by p53,
and loss of p53 function, which is often observed in
cancer,increasesbirc5transcription.18,19Itisanticipated
that an increase in survivin steady-state levels enhances
the resistance of cancer cells to chemotherapeutic drugs
or radiation.20Thus far, these properties of survivin are
not unique, and RNAi-mediated knockdown of survivin
might be compensated by the upregulation of other IAP
family members, such as XIAP or cIAP, or by increased
expression of anti-apoptoticmembersof the bcl2-family,
such as bcl2 and bcl-XL. However, to date, it is widely
accepted that survivin plays an additional and unique
role in the regulation of mitotic events.21–24The
mitoticlocalizationofsurvivin isconsistentwiththe pro-
teins described as chromosomal passenger proteins.23–25
Duringearlymitosis,survivinassociatesaroundchromo-
somestogetherwithitsproteinpartnersAuroraB,borea-
lin, and inner centromeric protein—in particular, at the
kinetochores in metaphase.25Cells with impaired func-
tion of survivin or of one of its partners due to
RNAi-mediated inhibition or expression of dominant-
negative mutants showed comparable phenotypes (ie,
disturbedsegregationofchromosomesanddefectivecyto-
kinesis).24–27Furthermore, the disruption of the genetic
locus of survivin was not compensated and led to an
embryonically lethal phenotype in homozygous mice.23
We hypothesized that the selective inhibition of
glioma cells by RNAi-mediated knockdown of survivin
may represent a reasonable therapeutic strategy for the
treatment of malignant brain tumors. Therefore, we
employed retroviral shRNA expression vectors and the
nonviral delivery of siRNAs to silence survivin in
glioma cells and glioma xenografts, respectively, and
analyzed the effects. We found that survivin knockdown
led to mitotic defects and decreased cell proliferation. In
particular, an impaired long-term clonogenic survival
was noted in H4 and U373-MG as well as in primary
glioblastoma cells after knockdown of survivin. In
addition, a strong increase in death receptor TRAIL
R2/DR5 expression was detected, which rendered
glioma cells more susceptible to allogeneic human NK
cells. The treatment of immune-deficient mice bearing
subcutaneousU373-MG
tumors, with polyethylenimine (PEI)-complexed siRNA
against survivin resulted in a significant decrease of
tumor growth and increased survival time, respectively,
indicating the potential of RNAi approaches for survivin
inhibition as a feasible therapeutic option in GBM.
or orthothopicU87-MG
Materials and Methods
Cell Culture, Determination of Proliferation,
and Clonogenic Survival
U373-MG is a glioblastoma/astrocytoma-derived cell
line; U343-MG, U87-MG, and H4 are glioblastoma-
derived cell lines. The cell lines were kindly provided
by H. K. Schackert (Medical Faculty, Technical
University-Dresden, Dresden, Germany). The primary
glioblastomacelllines
DD-HT7606 were obtained in the course of surgery of
glioblastoma patients with informed consent and
approval of the local ethics committee. Primary gliobas-
toma cells of passages 8–10 and human glioma cell lines
were maintained on poly-L-lysine coated plasticware
and in Basal Minimal Eagle medium (Invitrogen) sup-
plemented with 2 mM L-glutamine and 1% nonessential
amino acids (Biochrom). Two hundred ninety-three T
cells were human embryonic kidney cells. They were cul-
tured in Dulbecco’s modified Eagle medium containing
4.5 g/L glucose (PAA Laboratories). The medium was
supplemented with 10% heat-inactivated fetal calf
serum, 100 U/mL penicillin, and 100 mg/mL streptomy-
cin (both from Invitrogen). Primary human NK cells
were isolated using a negative depletion kit (Miltenyi
Biotech) and stimulated with NKp46/CD2 beads
(Miltenyi Biotech) and 500 IU rhIL-2 (Immunotools).
After 5 days, the NK cells were used for the experiments.
All experiments with human NK cells were approved
by the local ethical committee of the Medical Faculty
Carl Gustav Carus (Technical University-Dresden).
Expression of TRAIL and CD95 ligand was tested by
FACS analysis using specific antibodies against TRAIL
and CD95L (both BD Biosciences) and Cy3- or
FITC-coupled secondary antibodies (Dianova). Cell pro-
liferation of human glioma cells was assessed by Trypan
blue staining and counting of viable cells using a hema-
cytometer. Cells (1 × 105) were plated in triplicates on
30-mm dishes and 24 h later cells were transduced
with retroviral vectors. Twenty-four h, 72 h, and 5
days after transduction, cell numbers were determined.
Long-term survival of transduced glioma cells was
tested by plating quadruplicates of 1000 cells/dish for
every vector transduction onto 10-cm dishes. After
DD-T3,DD-T4,and
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1075

Page 3

3 weeks U373-MG and H4 cells and after 5 weeks
primary GBM cells were stained with Giemsa, and the
number of clones was quantified. At least 2 independent
experiments were performed for each cell line. The
Student t test was used for statistical analysis.
shRNA-Retroviral Vectors and Transduction
For the transduction of DNA-sequences encoding
shRNA-molecules,the
Moloney murine leukemia virus backbone pRVH-1 was
used. This vector contains a H1 polymerase III promoter
for the expression of shRNA molecules in reverse
orientation. pRVH1 was digested with EcoRI and NotI
and ligated with a cytomegalovirus immediate early
promoter and enhanced green fluorescent protein (EGFP)
reporter gene fragment containing appropriate restriction
sites, resulting in the vector pRVH-N1-EGFP. For some
experiments, a RVH1-puro vector was used. On the
basis of 2 previously described survivin target sequences,
DNA oligonucleotideswith
site overhangs shown in italic (shSurvivin #237 upper
strand: 5′-gatccccgaggctggcttcatccactttcaagagaagtggatga-
agccagcctctttttggc-3′; shSurvivin #237 bottom strand:
5′-tcgagccaaaaagaggctggcttcatccacttctcttgaaagtggat-
gaagccagcctcggg-3′;28shSurvivin #433 upper strand:
5′-gatccccgaattaacccttggtgaatttcaagagaattcaccaagggt-
taattctttttggc-3′, shSurvivin
5′tcgagccaaaaagaattaacccttggtgaattctcttgaaattcaccaag-
ggttaattcggg-3′29) were synthesized (Eurofins MWG
Biotech), and after annealing of the single strands, the
shRNA-encoding fragment was ligated into the BglII/
SalI-restrictions sites of pRVH-N1-EGFP and pRVH-
puro, respectively. As negative control, we included a
previously described shRNA against luciferase.30
Retroviral particles were generated as described
previously.31In brief, 293 T cells were cotransfected
with an expression construct for gag-pol (pHIT60), the
MoMuLV-based retroviral vectors and the vesicular sto-
matitis virus G-protein (pMD.G2). Viral supernatants
were harvested 48 and 72 h after transfection. Target
cells (105) cells were plated in 30-mm dishes 1 day
before transduction and were transduced with retroviral
supernatants. Transduction efficacies were usually in the
range of 90%–98%, as determined by FACS-analysis of
EGFP-positivecells.Gliomacells,whichweretransduced
with pRVH1-puro vectors, were additionally selected
using 10 mg/mL puromycin (Invitrogen) for 24 h.
self-inactivating retroviral
appropriaterestriction
#433bottomstrand:
Indirect Immunofluorescence Analysis
Cells grown on poly-L-lysine–mounted glass slides and
6-mm slices from frozen brain tissues were fixated for
20 min with 4% paraformaldehyde in phosphate-
buffered saline (PBS). Samples were treated with
ice-cold permeabilization solution (0.1% sodium citrate
in PBS, 0.1% Triton X-100) for 5 min. Samples were
incubated for 1 h with a polyclonal rabbit anti-survivin
antibody (R&D Systems; dilution, 1:200) or were ana-
ylzed using a monoclonal anti rabbit Ki67 (Epitomics).
Samples were washed 3 times with PBS + 0.1% BSA
and were subsequently incubated with a secondary anti-
rabbit immunoglobulin (Ig) G, Cy3 conjugated antibody
(dilution, 1:200; Jackson IR) for 1 h. DNA counterstain-
ing was accomplished with Hoechst33342 solution
(10 mg/mL) for 5 min. Finally, the stained cells and
tissues were washed 3 times in PBS/0.1% BSA and
once in double-distilled water, prior to examination by
confocal laser scanning microscopy (Leica SP5 inverse
MP)or standardimmunfluorescence
(Olympus IX70). The Ki67-proliferation index was cal-
culated by analyzingthe
fluorescence-labeled cells in ≥14 random fields from
different sections at ×400 magnification. Statistical
analysis was performed using the Student t test.
microscopy
average percentage of
Proteome Profiler Array and Western Blot Analysis
Forimmunoblotanalysis,105cellsgrownin6-wellplates
were harvested in 75 mL 2× Laemmli protein sample
buffer (Sigma). Samples were subsequently boiled for
10 min and placed in an ultrasonic bath for 10 min.
Equal protein amounts of lysate fractions were loaded
onto polyacrylamide gels and, after separation, blotted
onto PVDF membranes. Subsequently, membranes were
washed 3 times for 10 min in TBS + 2% Triton X-100,
0.5% Tween 20 (TBS-TT) and another 10 min in TBS.
Themembraneswereprobedwithrabbitpolyclonalanti-
survivin (R&D Systems), and signals were developed as
described below.Forloadingcontrol,blots werestripped
and probed with a monoclonal anti-tubulin antibody
(Sigma) or a monoclonal anti GAPDH (dilution,
1:1000;Cellsignaling).Cell-cyclearrestwasinvestigated
using an anti-p21waf/cipantibody (monoclonal rabbit;
dilution, 1:1000; Cell Signaling Technology), and induc-
tion of apoptosis was analyzed by an anti-caspase 3 anti-
body (mousemonoclonal;
Signaling). After incubationwiththe primaryantibodies,
the membranes were washed 3 times with TBS-TT and
1 × 10 min with TBS buffer. Subsequently, the mem-
branes were incubated for 1 h with appropriate second-
ary antibodies conjugated with HRP (dilution, 1:1000;
Dako). The membranes were washed again, signals
were developed with ECLplus detection solution (GE
Healthcare), and chemoluminescence was detected in a
LAS3000 device. The effects of survivin-RNAi on
U373-MG cells were assessed by the apoptosis proteome
profiler kit (R&D Systems) in accordance with the
instructions of the provider. The kit allows the simul-
taneous analysis of the cell cycle, stress response, and
expression of apoptosis inhibiting proteins and of pro-
and anti-apoptotic members of the bcl-2- protein family
and proteins involved in cell cycle arrest. In brief, 6 ×
106U373-MG cells were seeded in T75 culture flasks
and transduced with 12 mL viral supernatants represent-
ing an multiplicity of infection of 20. Three days after
transduction, the cells were harvested, the protein con-
centration was determined, and knockdown of survivin
was confirmedby immunoblotting.
250 mL of lysate representing 150 mg of total protein
was diluted in 1.25 mL of Array buffer 1. Arrays were
dilution,1:1000; Cell
Subsequently,
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1076
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 4

pre-incubated in 1.5 mL of Array buffer 1 prior to incu-
bating the arrays in the diluted lysate at 48C overnight.
The arrays were washed 3 times using wash buffer, incu-
bated for 4 h with the detection antibody cocktail
(dilution, 1:100 in 1× array buffer 1), and after repeated
washingarrays,incubated
Streptavidin-HRP-solution (dilution, 1:2000). Signals
were detected usingthe
Healthcare) and the LAS3000 device. Images were
taken for several time intervals and analyzed using
imageJ software (National Institutes of Health) and by
substracting PBS background levels (negative control)
from sample signal levels. Experiments were performed
at least twice. Statistical analysis was performed using
the Student t test.
witha
ECLplus reagent(GE
Flow Cytometry for Cell Cycle Analysis, BrdU
Incorporation and TRAIL R2/D5 Expression
Analysis of the cell cycle and apoptosis was determined
by flow cytometry (FACscan; BD Bioscienes) of propi-
dium iodide-stained cells using Cell Quest Software
(BD Biosciences). In brief, nonsynchronized cells were
washed in PBS and fixed in 70% (v/v) ethanol. After
centrifugation of the cells at 600 g for 10 min at 208C,
thecell pelletwas suspended
DNA-extraction buffer (4 mM citric acid in 0.2 M
Na2HPO4; pH, 7.8). After 5 min incubation at room
temperature, the cells were spun down at 600 g. The
cells were washed once with PBS, followed by incu-
bation in PBS containing 40 mg/mL propidium iodide
(Sigma) and 200 mg/mL RNase A (Sigma) for 1 h at
room temperature in the dark. Stained nuclei were
analyzed using a Becton Dickinson FACScan (BD
Biosciences) with at least 10, 000 events/determination.
Cells that displayed propidium iodide-fluorescence emis-
sions lower than the 2N-DNA peak were considered to
be apoptotic (hypodiploid) cells. FACS analysis of
TRAIL R2/DR5, Fas-L, and TRAIL expression was
accomplished using monoclonal mouse anti TRAIL
R2/D5 (Acris) and monoclonal mouse anti Fas-L and
TRAIL antibodies (both from BD Biosciences) and sec-
ondarygoat anti-mouse
Appropriate isotype controls were included as controls.
For DNA-synthesis analysis, cells were incubated with
10 mM of BrdU (Sigma) for 45 min. Then, cells were
harvested and spun down at 330 g for 8 min. The cell
pellets were fixed in cold (2208C) 70% (v/v) ethanol
at 48C. DNA of 2 × 105cells/sample were denatured
by incubation with 2 N HCl-0.5% Triton X-100 for
30 min at room temperature, followed by neutralization
with 0.1 M Na2B4O7× 10H2O (pH8.5) for 30 min at
room temperature. Subsequently, cells were stained
with fluorescein isothiocyanate-conjugated anti-BrdU
antibody (BD; dilution, 1:12.5) in PBS containing 1%
BSA and 0.3% Triton-X-100 for 45 min at room temp-
erature in the dark. DNA was counterstained using pro-
pidium iodide as described above, and gated viable cells
were measured by flow cytometry. An appropriate
FITC-conjugated isotype control was included in the
in 0.5 mLof
IgG coupled to FITC.
analysis. Experiments were performed in triplicates
and were performed at least twice. Statistical analysis
was performed with the Student t test.
51Cr Release Assay
The ability of primary human NK cells to recognize and
kill U373-MG and H4 glioma cells upon knockdown of
survivin expression was analyzed in a51Cr release assay.
In brief, 5 days after transduction (1 × 106), shLuc- or
shSurvivin #433-transduced glioma target cells were
labeled with 100 mCi of
Sciences) for 1 h at 378C and then washed 4 times
with PBS. Labeled target cells were plated as triplicates
in round-bottom 96-well plates at 3 × 103/well and
were incubated with NK effector cells at different
effector-target (E:T) ratios for 4 h and 8 h, respectively.
Released
(PerkinElmer Life Sciences). Maximal and minimal
release was measured by treating labeled cells with 2%
Triton X-100 or medium alone, respectively. The
specific cytotoxicity was calculated according to the fol-
lowing formula: percent-specific lysis ¼ 100 × [(cpm
experimental release - cpm spontaneous release)/(cpm
maximum release - cpm spontaneous release)].
51Cr (PerkinElmer Life
51Cr was determined in a beta counter
Tumor Growth in Nude Mice and Experimental
siRNA Therapy
Nine-week-old NMRInu/numice were obtained from the
animal facility of the University of Dresden. Mice were
held under standardized pathogen-free conditions with
ad libitum access to food and water. Experiments were
approved by the responsible local authorities according
totheGermananimalprotectionlaw.Fortheexperimen-
tal PEI/siRNA therapy of established subcutaneous
tumors, U373-MG cells (1 × 106in 200 mL PBS) were
injected into the right flank of the mice. After 3 weeks,
the established wild-type tumors were measured using a
digital caliper, and the mice were subdivided in 3
groups with the same mean tumor diameter. For the
experiments, we used a siRNA (siSurvivin), which
targets the same complementary mRNA sequence as the
small hairpin RNA shSurvivin #433. Chemically unmo-
dified siRNAs siSurvivin (sense: 5′-gaauuaacccuuggu-
gaau(tt)-3′; antisense: 5′-auucaccaaggguuaauuc(tt)-3′)
and siLuc control (sense: 5′-cguacgcggaauacuucga(tt)-
3′; antisense: 5′-ucgaaguauuccgcgguacg(tt)-3′) were syn-
thesized, purifiedusing
Biotech), and complexed with low-molecular weight
PEI F25-LMW, as described elsewhere.32Every 2 days,
mice received intraperitoneal
(400 mg/kg bodyweight) PEI-complexed siRNA against
survivin or firefly luciferase (siLuc) in 150 mL of PBS,
starting at day 1 of treatment, for a total of 10 injections.
As additional negative control, a group of mice receiving
intraperitoneal injections of 150 mL of PBS was included
to exclude nonspecific effects of PEI on tumor growth.
Tumor sizes were measured in both directions by a
digital caliper every 2 days. After calculating the mean
HPLC(EurofinsMWG
injectionsof 10 mg
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1077

Page 5

ofthetumordiameter,thevolumeofeachtumorwascal-
culated by the formula VTumor¼ 1/6 × p × d3. Mice
were killed at day 21 after the start of the PEI/siRNA
treatment, and the tumors were prepared and used for
mRNA-analysis and histology. The experiments were
performed twice, with comparable results. In total, 10
controls,11siLuc-treated
siSurvivin-treated mice were analyzed. For the exper-
imental PEI/siRNA treatment of intracranial gliomas,
westereotacticallytransplantedU87-MGcellsinaccord-
ance with the guide screw method described by
Brockmann et al.33Guide screws were implanted 3 days
before injection of 1 × 106U87-MG glioma cells in
10 mL of PBS into the right brain hemisphere of mice.
Threedaysaftertransplantationoftumorcells,theexper-
imental siRNA therapy was started with daily stereotac-
tical injections of 2.5 mg of PEI-complexed siSurvivin
and siLuc for 10 days. Mice were killed when neurologi-
cal symptoms became apparent. The experiments were
performed twice with comparable results. In total, survi-
val of 13 siLuc-treated mice, and of 12 siSurvivin-treated
mice was monitored. Additional mice, including 4
siLuc-treated mice bearing neurological symptoms and 3
siSurv-treated mice having no neurological deficits, were
killed at day 17 and brain cryoslices were used for hema-
toxylin staining, Terminal deoxynucleotidyl transferase
nick end labeling (TUNEL), and Ki67 analysis. Statistical
analysis of tumor growth and survival were performed
with the Student t test and by log-rank test, respectively.
mice,and11
mRNA Preparation, cDNA Synthesis, and Quantitative
(Q) Real-Time Polymerase Chain Reaction (QPCR)
Total mRNA of tumor samples was prepared using a
QiaShredder and the RNAeasy kit from Qiagen in
accordance with the instructions of the provider. cDNA
was generated using 1 mg of total mRNA, Oligo
(dT)12–15primer (GE Healthcare), and the Omniscript
reverse-transcriptase kit (Qiagen). On the basis of the
LightCycler (LC) technology (Roche), QPCR assays
wereperformedtoquantifythemRNAexpressionofsur-
vivinandofthehousekeepinggeneb-actin.Thelevelsofa
specific PCR product were determined by the use of
TaqMan probes (b-actin-TM: 5′-6FAM-CAgCTTCA
CCACCACggCCAXT-PH;
CCACTgCCCCACTgAgAACgAgCXT-PH).
primers,weused LC-BETA_ACTIN_FOR
ccgagcgcggct-3′, LC_BETA_ACTIN_REV
cacgcatttccc-3, LC_SURVIVIN_FOR 5′-gccgaggctggc
ttca-3′, andLC_SURVIVIN-REV
gccaagtct-3′.Thelevelsofalltranscriptsweredetermined
byan amplificationprotocol consisting of a denaturation
step at 958C for 10 min, followed by 40 cycles with a
958C denaturation step for 15 s, 618C annealing for 5 s,
and a 728C extension step of 5 s. Standard curves were
generated applying dilutions over 6 log scales (101–
106) per capillary using a plasmid encoding human
b-actin and a plasmid encoding human survivin and
were used to calculate the amplification products. All
measurements were performed with aliquots from the
Survivin-TM:5′-6FAM-
As
5′-tca
5′-taatgt
PCR
5′-gaagaaacactgg
same cDNA batches to guarantee standardized and com-
parable conditions. A negative control (no template) was
included in each of the PCR runs. The cDNA copy
numbers of survivin mRNAs were normalized to the
quantitative measurements of b-actin mRNA levels. All
PCR runs were repeated twice to ensure reproducibility
and reliability and were analyzed by the LC quantifi-
cation software, version 3.5 (Roche). For statistical
analysis, the Student t test was used.
TUNEL Apoptosis Assay
Analysis of apoptosis in tumors was performed using
TUNEL (in situ cell death detection kit; Roche) using
the protocol recommended by the supplier. DNA coun-
terstaining was accomplished with Hoechst33342 sol-
ution. Finally, cells were washed 3 times in PBS/0.1%
BSA and once in double-distilled water prior to examin-
ationby standard immunfluorescence
(Olympus IX70). The apoptosis index was calculated
byanalyzing the
BrdU-FITC-labeled cells in ≥10 random fields from
different sections at ×400 magnification. Statistical
analysis was performed using the Student t test.
microscopy
mean percentageof
Determination of Interferon (IFN)-a Serum Levels
For analysis of IFN-a levels in PEI/siRNA-treated
animals (each group contained 4 animals), serum of
C57BL/6-mice and of NMRI mice treated with
PEI-complexed survivin siRNA or luciferase siRNA,
respectively, was collected. As positive control, we
included mice intraperitoneally injected with 150 mL
(100 mg/mL) of polyinosinic-polycytidylic acid (in
0.9% NaCl in endotoxin-free H2O; Cayla InvivoGen
Europe), which is known to activate TLR3 and to
increase IFN-a levels. The blood was allowed to clot
for 2 h at room temperature and was centrifuged for
10 min at 400 × g. The aqueous phase representing the
serum was removed, diluted 1:1 and 1:2 with PBS, and
analyzed in triplicates using an IFN-a enzyme-linked
immunosorbent assay (Mu-IFN- a; PBL Biomedical
Laboratories) in accordance with the instructions of
the manufacturer.
Results
Stable Knockdown of Survivin Expression in Glioma
Cells ResultsinMitotic Defects andImpairs Glioma Cell
Growth In Vitro
Retroviral expression vectors encoding EGFP and
shRNAs targeting human survivin mRNA, or firefly luci-
ferase mRNA as negative control, were transduced in
glioma cell lines H4, U373-MG, U343-MG, and
U87-MG. Western blot analysis of total protein lysates
confirmed survivin protein expression in all tested
gliomacelllinestreatedwithshLuciferaseandanefficient
knockdown of survivin protein steady-state levels when
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1078
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 6

using the small-hairpin RNAs shSurvivin #237 and
shSurvivin # 433 (Fig. 1A). Indirect immunofluorescence
analyses of all glioma cells with knockdown of survivin
showed impaired or lost survivin immunosignals at the
kinetochores of metaphase chromosomes, confirming a
robust RNAi effect (representative images are depicted
in Fig. 1B). Because no differences in the silencing
effects of the shSurvivin #237 and #433 hairpins were
observed, we used both throughout our experiments.
The inactivation of survivin caused polyploidy in all
tested glioma cell lines, with the fastest effect after survi-
vin knockdown being observed in H4 and U373-MG
glioma cells. We therefore chose these glioma cell lines
for additional experiments. When tested by FACS analy-
sis of the cellular DNA content, the H4 and U373-MG
cells developed remarkable amounts of cells with DNA
content greater than 4N within 24 h (Fig. 1C). The frac-
tion of cells with polyploidy genomes gradually
increased over time. Notably, a time-dependent slight
but significant increase in the fraction of apoptotic
cells bearing hypodiploid genomes was detected in
U373-MG cells treated with shSurvivin (mean + stan-
dard deviation [SD], 10.1%+2.4% at 72 h after trans-
duction) compared with shLuc-transduced controls
(mean + SD, 4.9+3.2% 72 h after transduction)
(Fig. 1C). In contrast, the H4 cells showed a significantly
larger fraction of apoptotic cells (mean + SD, 22.3%+
4.8%) when compared to the shLuc-transduced controls
(mean + SD, 9.9%+2.1%) already at 24 h after the
shSurvivin transduction, but the apoptotic rate remained
stable for all analyzed time points thereafter (Fig. 1C).
Confocal laser-scanning microscopy using a specific
antibody for survivin confirmed that the knockdown of
survivin was associated with an increase in cell size
and appearance of multiple nuclei in interphase
(Fig. 1D). We hypothesized that knockdown of survivin
in H4 and U373-MG cells led to an endoreplication
without affecting cell cycle (ie, cell-cycle arrest). In line
with this notion, Western blot analysis of p21waf/cip
induction, which hallmarks cell-cycle arrest, was not
detected in U373 cells after knockdown of survivin
(Fig. 2A). However, we observed a weak induction of
Fig. 1. Knockdown of survivin protein expression in glioma cell lines using small hairpin RNAs #237 and #433. (A) Glioma cells lines were
transduced with retroviral pRVH-N1-EGFP vectors encoding the indicated shRNAs. Western blot analyses demonstrate efficient survivin
knockdown compared to shLuc controls (shLuciferase-transduced cells). (B) Confocal laser scanning microscopy-based analysis of
representative samples show the loss of survivin immunefluorescence at kinetochors of shSurvivin #433-transduced U86-MG and H4
glioma cells. In the images showing shLuciferase shRNA-treated cells, arrows indicate centromere regions of chromosomes that are
positive for survivin. In contrast, note the increased number of chromosomes in the shSurvivin #433–treated cells. Bars represent 10 mm.
(C) Analysis of the DNA content in U373-MG glioma cells and H4 glioma cells, transduced with shSurvivin #433 or control
(shLuciferase). Note the increase in cell numbers with a DNA content .2N after knockdown of survivin. Arrows depict fractions of cells
with DNA contents at 4N, 8N, and .8N. The percentage of cells containing DNA content less than the 2N peak (SubG1), representing
apoptotic cells, is indicated as well. (D) Representative pictures showing the phenotype of shSurvivin #433–treated glioma cells. Note
the increased cell size and the appearance of multiple nuclei in the survivin knockdown cells. Bars represent 25 mm.
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1079

Page 7

p21waf/cipin shSurvivin #433-treated H4 glioma cells.
To analyze whether this weak p21waf/cipexpression
wasable to induce acell-cycle arrestand to further inves-
tigate whether H4 and U373 bearing genomes .4N still
were able to enter S-phase BrdU incorporation assays
were performed. That H4 cells were able to arrest in
the cell cycle was confirmed by incubating the cells
with doxorubicin and subsequent BrdU incorporation
analysis (Fig 2A). After analyzing the BrdU incorpor-
ation in cells with knockdown of survivin, it became
clear that the knockdown of survivin led to a 40%–
45% reduction in the fraction of BrdU-positive cells.
However, H4 and U373-MG glioma cells with DNA
contents at 4N, 8N, and higher especially did not
arrest in the cell cycle and were still able to enter
S-phase (Fig. 2B). Additional experiments demonstrated
a statistically significant near abolishment of cell pro-
liferation in U373-MG cells and H4 compared with
the shLuc-transduced controls (Fig. 3A and B). In
particular, survivin knockdown significantly impaired
long-term survival of U373-MG and H4 cells in a
clonogenic assay (Fig. 3C and D).
Additional experiments with primary glioblastoma
cell lines DD-T3, DD-T4, and DD-HT7606 revealed a
similarphenotypeaftersurvivinknockdown,asobserved
in permanent glioma cell lines. An induction p21waf/cip
was not detected by Western blot analysis, neither in
untreated controls nor in shLuc- and shSurvivin-
transduced cells (Fig. 4A). However, knockdown of sur-
vivin resulted in an increase in cells having genomes
.4N (Fig. 4B). The fraction of cells bearing genomes
,2N (apoptotic cells) in the primary cell lines with
knockdown of survivin were not increased in the
DD-T3 and DD-T4 primary GBM cells compared with
shLuc controls. In contrast, we noted significantly
increased apoptosis rates in DD-HT7606 cells upon
surivivin RNAi (mean +SD, 33.8%+3.2% 72 h
after transduction) compared with those of shLuc-
Fig. 2. Analysis of p21waf/cipand BrdU incorporation in H4 and U373-MG cell with knockdown of survivin. (A) Western blot analysis of
p21waf/cipinduction in H4 and U373-MG cells. Cells were transduced with shSurvivin #433 and shLuc. Seventy-two
transduction, total cell lysates were prepared and subjected to electrophoresis. After blotting, p21waf/cipexpression was investigated. To
demonstrate equal loading, the blot was stripped and probed with an antibody against the housekeeping protein GAPDH. As positive
controls for p21waf/cip, total protein lysates from HCT116 cells treated with nocodazole (+Noc) and doxorubicine (+Dox) were included.
Note the weak p21waf/cipsignal in H4 cells with knockdown of survivin. That the H4 cells were able to arrest the cell cycle was
demonstrated by using doxorubicin and subsequent BrdU incorporation analysis. (B) BrdU incorporation analysis of H4 and U373 cells
72 h after transduction of shSurvivin #433 and transduction with shLuc control, respectively, demonstrating that the cells did not arrest
the cell cycle at 4N, 8N, and higher. Note that cells displaying polyploidy still incorporate BrdU.
h after
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1080
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 8

transduced controls (mean +SD, 23.1%+2.4% 72 h
after transduction) (Fig. 4B). Notably, we observed that
the effect of survivin knockdown on clonogenic survival
of primary glioblastoma cells was even stronger than
measured for H 4 and U373-MG cells. Here, clonogenic
survival of primary glioma cells was nearly completely
abolished after RNAi of survivin (Fig. 4C).
RNAi-Mediated Survivin Knockdown in U373-MG
Cells Induced Expression of Hypoxia Inducible Factor–
1a (HIF-1a) and of Death Receptor TRAIL R2
In addition to its function in the spindle checkpoint and
cytokinesis, survivin functions as an inhibitor of
apoptosis by blocking activated caspases and other
pro-apoptotic molecules, such as Smac/DIABLO. To
Fig. 4. Effects of survivin knockdown on primary glioblastoma
multiforme (GBM) cells. (A) Total cell lysates from hSurvivin
#433, shLuc-transduced and untreated primary GBM cells were
subjected to Western blot analysis for confirming survivin
knockdownandfor investigating
positive controls for p21waf/cip, total protein lysates from HCT116
cells treated with nocodazole (+Noc) and doxorubicine (+Dox)
were included. Equal loading was demonstrated using a tubulin
antibody. (B) Analysisof the
glioblastoma cell lines DD-T3, DD-T4, and DD-HT7606 either
transduced with shSurvivin #433 or control (shLuciferase). Note
the increase in cell numbers with a DNA content .2N upon
survivin knockdown. Arrows depict fractions of cells with DNA
contents at 4N and 8N. The percentage of cells containing DNA
content less than the 2N peak (SubG1), representing apoptotic
cells, is indicated as well. (C) Representative images of colony
formation assays of primary GBM cells. Cells (103) were plated
per 10-cm dish and, after 5 weeks, were stained with Giemsa.
Note the nearly completely abolished clonogenic survival of
shSurvivin #433 transduced primary GBM cells.
p21waf/cip
expression. As
DNAcontent inprimary
Fig. 3. Reduced proliferation and colony formation capacities of
U373-MG and H4 glioma cells upon knockdown of survivin. (A
and B) Proliferation of glioma cells after transduction of retroviral
vectors encoding the depicted shRNA was determined by
counting cell numbers. U373-MG (A) and H4 (B) cells transduced
with shLuciferase exhibited a time-dependent increase in cell
numbers. The numbers of U373-MG and H4 glioma cells
transduced with shSurvivin #237 and shSurvivin #433 vectors
were significantly lower, indicating the almost absence of
proliferation (*P , .05; **P , .01). (C and D) Colony formation
of U373-MG (C) and H4 (D) glioma cells transduced as indicated
in the figure was assessed by plating of 103cells per 10 cm dish
in quadruplicates. After 3 weeks cells were stained with Giemsa
and the mean+SEM number of clones was quantified. Data
represent two independent transductions (*P , .05).
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1081

Page 9

elucidate the effects of the survivin knockdown on apop-
totic pathways,a proteome
U373-MG cells was performed (for details of analyzed
proteins, see the Materials and methods section
above). Significant alterations in protein expression on
depletion of survivin were noted as follows (marked in
the proteome profiler arrays in Fig. 5A) and quantified
by densitometric analysis (Fig. 5B): a marked decrease
in the survivin protein level and heat shock protein 60
(hsp60) expression, a decrease in catalase and increase
in HIF-1a expression, a decrease of the pro-apoptotic
factor BAD, a moderately but significantly increased
expression of death receptor CD95/Fas, and a marked
upregulation of TRAIL R2/DR5. No changes in the
expression levels of p21waf/cipand p27kipwere observed.
It was of particular interest whether survivin RNAi led
to intrinsic apoptosis via activation of effector caspase
3. As shown in Fig. 5A and in the quantitative analysis
of protein expression profiles (Fig. 5B), the amounts of
pro-caspase 3 and of activated caspase 3 were not
affected by survivin knockdown in our experimental
setting, compared with shLuc controls. To investigate
whether this result could be recapitulated in other
glioma cell lines, we additionally silenced survivin in
H4, U343-MG, and U87-MG cells and also found no
signals for cleaved pro-caspase 3 after RNAi of survivin
in Western blot analyses (Fig. 5C).
profiler analysisof
Increase of Cell Death Receptor TRAIL R2 Upon
Survivin Knockdown Render Glioma Cells More
Susceptible to NK Cells
Because we observed a profound increase in the
steady-state expression levels of the death receptor
TRAIL R2/DR5 in U373-MG glioma cells upon knock-
down of survivin (see Fig. 5A and B), it was of special
interest whether human immune effector cells—in par-
ticular, NK cells—show enhanced lysis of these glioma
cells. Therefore, human NK cells were prepared from
peripheral blood, expanded, and cocultured with
shRNA-treated glioma cells. The expression of CD95L
and TRAIL on activated NK cells was confirmed by
FACS analysis (data not shown). In line with the
results of the proteome profiler assay, FACS analysis
revealed that H4, U373-MG, U343-MG, and U87-MG
cells transduced with shLuc displayed a surface
expression of the death receptor TRAIL-R2/DR5A
(Fig.6A).Also, TRAIL-R2/DR5
further increased after knockdown of survivin, as
revealed by analysis of the mean fluorescence intensities
of TRAIL-R2/DR5-stained cells (Fig. 6A and B). On the
other hand, no significant increase in CD95/Fas levels
were noted upon survivin inhibition in H4, U373-MG,
U343-MG, and U87-MG cells (data not shown).51Cr
release assays demonstrated that in vitro expanded and
interleukin-2 activated NK cells—in particular, at
higher effector-target ratios—showed a increased basal
cytotoxicreactionagainst
U373-MG glioma cells (6c). Notably, the increased
surface expression of TRAIL R2/DR5 in H4 and
expressionwas
shLuc-treated H4and
Fig. 5. Proteome profiler analysis of glioma cells upon knockdown
of survivin. (A) Total protein lysates from glioma cells transduced
with the shLuciferase-control vector versus cells transduced with
the shSurvivin #433-vector were analyzed using an apoptosis
proteome profiler blot. Depicted are representative images of the
chemiluminescence signals, with differences in signal intensities
between both blots showing changes in protein expression levels
upon knockdown ofsurvivin
Indicated in black boxes are significant changes in the expression
levels of distinct proteins. Red boxes indicate selected proteins of
interest showing no changes in protein expression levels after
survivin knockdown. (B) Densitometric analysis of the proteome
profiler blots depicting those proteins with significant changes in
mean expression levels. Also shown are the unchanged mean
expression levels of proteins involved in cell cycle arrest and
caspase 3 status. (C) Western blot analysis of glioma cell lines
transducedwithshLuciferase
(shSurv) revealed no signals indicating activated caspase 3. The
levels of pro-caspase 3 remained unchanged. As positive control,
H4 cells treated with 50 mm of C2 ceramide are included. *P ,
.05. **P ..01.
versusshLuciferase-treatment.
(shLuc)and shSurvivin #433
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1082
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 10

U373-MG cells transduced with shSurvivin further sig-
nificantly enhanced glioma cell lysis after incubation
with NK cells (Fig. 6C).
Therapeutic Knockdown of Survivin Attenuates Growth
of Established Subcutaneous Glioma Xenografts and
Improves Survival of Mice in an Orthotopic Glioma
Model
In a next step, we sought to set up an experimental
therapy approach using exogenously delivered siRNA
molecules targeting survivin. We employed a low-mol-
ecular weight polyethylenimine (PEI F25-LMW) to
complexand deliversiRNA
(siSurvivin) in NMRInu/numice bearing established sub-
cutaneous U373-MG tumors. The PEI/siRNA com-
plexes were given systemically by intraperitoneal
injectionsstartingatday1(Fig.7A).Asnegativecontrols,
weincluded groupsof tumor-bearing mice treated with a
PEI-complexed control siRNA targeting firefly luciferase
(siLuc)or,toexcludenonspecificeffectsofthePEIcarrier
ontumor growth,treatedwithPBS. Although thetumors
of the control mice and of the siLuc-treated mice grew
substantially and with similar growth rates, tumor
growth in siSurvivin-treated mice was markedly attenu-
ated. Differences in tumor sizes between specific treat-
ment and control groups reached statistical significance
at day 11 after start of PEI/siRNA treatment (Fig. 7A).
In line with this observation, the mean tumor masses of
excised siSurvivin-treated tumors upon termination of
the experiment at day 21 after treatment start were
lower, compared with the mean tumor mass of the PBS-
or siLuc-treated treated control mice (data not shown).
To determine intra-tumoral survivin expression levels,
QPCR analysisusingspecific primers for human survivin
and actin was performed. Due to the small sizes of the
siSurvivin-treated tumors, only 3 tumors could be ana-
lyzed in this group, and they were compared with
results for 7 siLuc-treated tumors and 7 control tumors.
Remaining tumors samples were used for histological
analysis. The analysis of survivin mRNA revealed a
.3-fold lower expression in siSurvivin-treated tumors,
compared with siLuc-treated or -untreated (PBS)
control tumors (Fig. 7B). The histological analysis of
siSurvivin-treated U373-MG tumors revealed frequently
tumor cells with enlarged nuclei and tumor cells with
multiple nuclei, whereas no such gross morphological
changes were evident in the siLuc-treated controls
(Fig. 7C; asterisk and arrowheads, respectively). In
addition, atypical metaphase figures (propeller-like
alignment of chromosomes) were detected in tumor
targetingsurvivin
Fig. 6. NK cell cytotoxicity towards glioma cells upon survivin
knockdown. (A) Knockdown of survivin increases the expression
of the death receptor TRAIL R2/DR5: H4, U373-MG, U343-MG,
and U87-MG gliomacells
pRVH1-puro-vector encoding the indicated shRNAs. After 5 days,
cells were stained with anti-TRAIL-R2/DR5 antibodies and
measured by FACS (gray line, isotype control; black line,
sh-Luc-transducedcells stained
histogram,sh-Survivin #433-transduced
TRAIL-R2/DR5). (B) Quantification of TRAIL R2/DR5 expression
levels by calculating the mean fluorescence intensities (MFIs)
measured in FACS. Note the depicted increase in TRAIL R2/DR5
signal intensities in the glioma cells with knockdown of survivin.
(C) Allogeneic human NK cells show increased cytotoxicity
towards glioma cells with reduced survivin expression. NK cells
were incubated with
were transduced witha
forTRAIL-R2/DR5;
cells
gray
for stained
51chromium-loaded H4 and U373-MG
glioma cells at different effector to target ratios. H4 glioma cells
were transduced with shLuc (open squares) or shSurvivin #433
(black squares). In parallel experiments, U373-MG glioma cells
transduced with shLuc (open circles) or shSurvivin #433 (black
circles) were probed against NK cells. The cytotoxic response of
NK cells was measured after 4 h and 8 h.
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1083

Page 11

xenografts upon survivin knockdown (Fig. 7C, arrow).
No signs of infiltrating leukocytes were observed in any
analyzed tumor sample.
To exclude the possibility that an unspecific response
of the innate immune system accounts for the observed
anti-tumoral effects, NMRInu/nuand C57BL/6 mice
were treated with PEI-complexed siLuc or siSurvivin,
respectively, and levels of serum IFN-a were measured.
In all mice, the levels of IFN-a were less than the limit
of detection, whereas in polyinosinic-polycytidylic
acid–treated C57BL/6-positive control mice, a mean
(+SD) IFN-a level of 18+0.5 pg/mL was found
(data not shown).
For a more relevant in vivo validation we tested
whether treatment of orthotopic U87-MG xenografts
with PEI-complexed siRNA targeting survivin results
in a better survival of NMRInu/numice. Three days
after transplantation of the glioma cells, mice were
treated for 10 days with daily stereotactical injections
of PEI-complexed siRNAs targeting survivin or lucifer-
ase. No toxic side effects of PEI/siRNA complexes
were observed. Analysis at day 17 after tumor cell trans-
plantation revealed smaller tumors in mice treated with
PEI/siSurvivin, compared with the control group treated
with PEI/siLuc (Fig. 8A). Concomitantly, indirect
immunofluorescence analysis of survivin expression
showed decreasedimmunoreactivity
siSurvivin-treated tumors versus the PEI/siLuc controls
(Fig. 8B). The analysis of the survival of the mice (ie,
the time period before the onset of neurological symp-
toms) revealed a significant improvement of the mean
survival time for PEI/siSurvivin-treated tumor-bearing
mice (23 days) compared with the PEI/siLuc-treated
negative controls (18 days; Fig. 8C). Additional immu-
nohistochemical analysis of the tumors showed that
that siSurvivin treatment induced a 2-fold reduction in
the percentage of Ki67-positive cells, indicating loss of
proliferation capacity (Fig. 8D). The possibility that
the observed effects were due to increased apoptosis in
the siSurvivin-treated tumors was rendered unlikely
because a TUNEL assay revealed an only slight and
statistically insignificantincrease
siSurvivin-treated tumors (mean apoptosis index +
SD, 0.21%+0.04%) compared with siLuc-treated
tumors (mean apoptosis index+SD, 0.11%+0.09%)
(Fig. 8E).
inPEI/
in apoptosis in
Discussion
GBM, classified as glioma World Health Organization
grade IV, is the most frequent and malignant brain
tumor which is mostly resistant to conventional thera-
pies.1–3Consequently, novel therapeutic options for
the treatment of malignant gliomas are warranted.
siRNA is evolving as a promising strategy for cancer
therapy due to its high efficiency and specificity in block-
ing target mRNA expression.6,34,35For treating exper-
imental gliomas, we chose survivin as target because it
is strongly expressed in tumors and barely detected in
normal differentiated tissues.8Survivin expression has
also been reported in human gliomas,9and expression
of survivin is found in glioma- and glioblastoma-derived
cell lines.26Furthermore, the knockdown of survivin
cannot be fully compensated by the upregulation of
other members of the inhibitor of apoptosis family
because, beside its role in anti-apoptosis, survivin plays
a unique and pivotal role in the spindle checkpoint and
cytokinesis.25,29
Here, we report efficient knockdown of survivin
expression in glioma cell lines and primary glioma cell
lines using retrovirus-delivered shRNAs targeting survi-
vin. Glioma cells with loss of survivin developed mitotic
defects resultinginpolyploidy,andweshowed decreased
Fig. 7. Anti-tumor effects in established tumor xenografts upon
therapeutic knockdown of survivin through polyethylenimine
(PEI)–complexedsiRNA.(A)
subcutaneously transplanted in the right flank of NMRInu/numice.
After establishment of tumors, mice were randomized and
treated every second day by intraperitoneal injection of (i)
PEI-complexed, survivin-specific siRNA (siSurv; n ¼ 11) or, as
negative controls, (ii) PEI-complexed unrelated siRNA (firefly
luciferase, siLuc; n ¼ 11) or (iii) PBS (n ¼ 10). The mean+
standard error of the mean (SEM) of tumor volumes is shown at
the indicated time points after treatment start. The treatment
with PEI-complexed siSurvivin significantly attenuates tumor
growth, with statistical significance (*P , .05) being reached 10
days after treatment start at day 1. (B) Quantitative real-time
polymerase chain reaction analysis of survivin expression levels in
tumors of control mice (n ¼ 7) and of mice treated with
PEI-complexed siSurv (n ¼ 3) and siLuc (n ¼ 7). The mean+SEM
of survivin transcript levels is shown. *P , .05. **P , .01. (C)
Hematoxylin-eosinstaining of
multinuclear cells (arrowheads) and huge nuclei (asterisks) in
siSurvivin-treated tumors. Also note the atypical propeller-like
mitotic figure (arrow) in the siSurvivin-treated tumor.
U373-MGglioma cellswere
tumor cryosections reveal
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1084
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 12

proliferation and impaired clonogenic survival in long-
term cell culture assays. In vitro analyses of the hypodi-
ploid cell fraction in U373-MG and H4 glioma cells
and primary glioma cells revealed, in most cases,
increasesinthefractionofapoptoticcells.However,pro-
teome profiler arrays of survivin-shRNA–transduced
U373-MG cells, and additional Western blot analysis of
U373-MG, U343-MG, U87-MG, and H4 cells after
survivin knockdown showed no activation of the
executioner caspase 3, indicating a caspase-independent
cell death mechanism. This observation is in line with
findings fromother reports
caspase-independent induction of cell death upon silen-
cing of survivin or upon ectopic expression of dominant-
negativesurvivin mutants.16,26,36
reports—in particular, those that used U251-MG
thatdescribea
However,some
glioma cells—also have described a caspase-dependent
cell death upon RNAi of survivin.37–39Thus far, it is
tempting to speculate whether the observed differences
are cell type specific or are due to technical differences.
Survivin knockdown also resulted in a marked
decrease of hsp60. Interestingly, this chaperone mol-
ecule has been reported to directly interact with survi-
vin,40and RNAi-mediated reduction of hsp60 has
been reported to decrease survivin expression, in par-
ticularmitochondrial survivin
suggests that, vice versa, hsp60 levels are dependent on
to survivin expression. Therefore, additional studies
are warranted to elucidate this survivin/HSP60 inter-
play. Moreover, we noted a decrease in catalase
expression and increase in expression of HIF-1a in
survivin-knockdown cells. These changes in protein
levels.40
Our data
Fig. 8. Intracranially administered polyethylenimine (PEI)–complexed siRNA targeting survivin attenuates cellular proliferation and improves
survival of mice in an orthotopic glioma model. (A) Images showing hematoxylin-eosin–stained slices of U87-MG intracranial tumors 17
days after tumor cell transplantation. Tumors are indicated by arrowheads. Note the prominent U87-MG tumor in the siLuc treated
mouse and the smaller tumor size in siSurvivin-treated mouse. (B) Indirect immunfluorescence analysis using anti-survivin antibody
showing decreased survivin immunosignals in siSurvivin-treated tumors. (C) Kaplan-Meier-plot showing the time schedule of PEI/siRNA
injections and the survival curves of the animals in the different treatment groups. Mice treated with PEI/siSurvivin showed significantly
increased survival times when compared to the PEI/siLuc-treated controls. (D) Indirect immunofluorescence analysis of the proliferation
marker Ki67 reveals attenuated cell proliferation in siSurvivin-treated U87-MG cells when compared to siLuc controls (**P , .01).
Arrowheads depict the borderline between U87-MG tumor and mouse brain parenchyma. (E) Investigation of apoptosis using TUNEL
assay. Arrowheads depict apoptotic cells. No significant increased apoptosis was detected in tumors treated with siSurvivin. A
DNase-treated slice is included as positive control. DNA counterstaining in all fluorescence images were accomplished with Hoechst
33342. Bars in panel B represent 300 mm; bars in panels D and E represent 200 mm.
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1085

Page 13

expression levels were accompanied by the development
of huge multinuclear cells, and we suggest that this
finding might reflect some adaptation of the cells to
alteredintracellularreactive
oxygen levels.
Interestingly, we found no increase in the levels of
p21waf/cipand p27kipafter RNAi of survivin in a pro-
teome profiler array, indicating that the U373-MG
glioma cells did not activate cell-cycle checkpoints. In
addition, no cell-cycle arrest was detected when analyz-
ing the DNA content of H4 cells and of 3 primary glio-
blastoma cell lines. In line with this, BrdU incorporation
assays revealed that U373-MG and H4 cells, even with
DNA contents of ≥4N, still entered S-phase. We
assume thata compromised
allowsongoingDNA replicationswithout the separation
of daughter cells due to defects in cytokinesis.24The
higher DNA contents in turn might result in prolonged
cell cycle phases, which could explain the general
decrease in the fraction of BrdU-positive cells observed
in our experiments (see Fig. 2).
The knockdown of survivin led to a downregulation
of the pro-apoptotic Bad molecule, whereas higher
expression of the death receptor CD95/Fas and an
even more pronounced increase in the steady-state
expression level of the death receptor TRAIL R2/DR5
was observed. The induction of TRAIL R2/DR5 after
RNAi-mediated targeting of survivin was verified using
FACS-based analysis of H4, U343-MG, U373-MG,
and U87-MG glioma cells. Interestingly, the increased
expression of TRAIL R2/DR5 rendered H4 and
U373-MG cells more susceptible to NK cells, as shown
in a cytotoxic assay.
Several groups have demonstrated strong anti-cancer
effects in vivo upon RNAi-mediated survivin knock-
down. However, because of problems in pharmakoki-
netics and cellular uptake of RNAi effector molecules,
siRNAs/shRNAs or shRNA-encoding vectors, most
studies were based on tumor cells transfected with
siRNAs or shRNA-encoding vectors ex vivo prior to
transplantationandin vivo
approach, anti-tumoral effects were shown in xenografts
established from in vitro-transfected esophageal squa-
mous carcinoma,41
gastric
cancer,43breast cancer,44cervical carcinoma,44and
glioma cells.38On the other hand, only a few studies
on the RNAi-mediated knockdown of survivin in
already established tumors have been reported. One
simple treatment approach made use of direct intratu-
moral injection of a shRNA-expression vector targeting
survivin mRNA. In this study, a reduction of xeno-
graftedrhabdomyosarcoma
observed.45More recently George et al.39reported atte-
nuated growth of orthotopic U251-MG gliomas when
stereotactically transfected with an DNA plasmid encod-
ing a shRNA targeting survivin. Other reports have
described antitumor effects in xenografted hepatocellu-
lar carcinoma, colorectal carcinoma, and non-small
cell lungcarcinoma
shRNA-encoding constructs against survivin using ade-
noviral vectors and replication defective lentiviral
oxygenspeciesand
checkpointfunction
analysis.Usingthis
cancer,42
pancreatic
tumorgrowth was
uponthedeliveryof
vectors.46–48Likewise, an anti-cancer effect on subcu-
taneous U251-MG glioma xenografts upon direct intra-
tumoral injection of adenoviral vectors encoding a
survivin-specific shRNA has been reported.37
However,because the
shRNA-encoding plasmids is mostly ineffective, and
because application of viral shRNA delivery systems in
patients is generally hampered due to safety concerns
and limited routes of application, we performed a thera-
peutic knockdownof survivin using a nonviral,polymer-
based carrier system for systemic siRNA delivery.
Previously, certain PEIs have been established as
reagents for complexation and cellular delivery of
siRNA in vitro and in vivo.49–51This siRNA delivery
platform allowed the systemic application of unmodified
siSurvivin siRNA molecules ata dose of 400 mg/kg body
weight for an experimental therapy of subcutaneous
glioma xenografts. More specifically, we demonstrate
that treatment of established U373-MG subcutaneous
xenografts using PEI-complexed siRNA targeting survi-
vin led to a decrease of survivin mRNA levels in tumors
and resulted in markedly attenuated tumor growth. The
analysisof serum samples
siRNA-treated immunodeficient NMRInu/nu, as well as
immune-competent C57BL/6 mice, did not reveal any
IFN response, indicating that the PEI/siRNA treatment
of mice did not activate the innate immune system.
Notably, thehistological
siSurvivin-treated tumors revealed an increase in the
appearance cells bearing large nuclei, as well as
increased numbers of cells having multiple nuclei, both
being frequently observed phenotypes caused by inter-
ference with survivin function.24,28,45,52In connection
with our QPCR data demonstrating decreased survivin
expression levels in the siSurvivin-treated glioma xeno-
grafts,wedemonstratethat the intraperitoneally injected
PEI/siRNA complexes are able to reach the subcu-
taneous glioma xenografts, as shown elsewhere,50and
that PEI/siRNA-mediated survivin knockdown exerts
profound antitumor effects.
We further extended our studies toward more aggres-
sively proliferating U87-MG cells in an orthotopic
glioma model. Because the brain is an “immune privi-
leged” organ lacking the components of the lymphatic
system, a systemic delivery of siRNA to the tumor can
be envisioned only via the bloodstream. However, prob-
ably because of the blood-brain barrier, previous studies
on the biodistribution of PEI F25-LMW/siRNA after
intraperoneal injection revealed only very little siRNA
uptake into the brain. The same study showed that intra-
venous injection of PEI/siRNA-complexes via the tail
vein resulted in siRNA accumulation, mostly in the
liver and lungs.32These findings are in line with results
from other groups demonstrating that the transport of
nanoparticlesacross the
strongly rely on ligand-mediated, “targeted” delivery
strategies or “Trojan horse” concepts (for review see
Schulze et al.53). Despite the possibility of a somewhat
leakier blood-brain barrier, this may also apply to glio-
blastomas. Therefore, we performed a local PEI/
siRNA-treatment of orthotopic U87-MG gliomas that
in vivodelivery of
obtainedfrom PEI/
investigation of the
blood-brainbarrierwill
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1086
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1

Page 14

circumvents the blood-brain barrier. The clinical rel-
evance of this approach is supported by many clinical
studies that focused on glioma treatment and used
local delivery methods of compounds such as paclitaxel,
IL13-PE38QQR, or TGF-b2 antisense.54–56In the long
run, however, we and others aim to develop of ligand-
functionalized nanoparticles for the targeted delivery
of nucleic acids, allowing systemic administration and
leading to higher efficacy. In summary, by applying con-
secutive stereotactical injections of PEI-complexed
siRNA targeting survivin at the tumor site, we signifi-
cantly improved the survival time of mice. Additional
analysis of the proliferation marker Ki67 revealed that
siSurvivin-treated intracranial U87-MG tumors had a
decreased proliferation capacity, whereas induction of
apoptosis was barely visible.
In conclusion, our results show— to our knowledge,
for the first time—that the knockdown of survivin
expressionbyexogenous,
PEI-complexed siRNA molecules significantly inhibits
the growth of established gliomas in vivo. Our in vitro
and in vivo data indicate that loss of survivin leads to
defective mitosis and increased endoreplication in
tumor cells, finally leading to decreased proliferation
and mitotic catastrophe. Notably, glioma cells with sur-
vivin knockdown also displayed significantly more
TRAIL R2/DR5 on the cell surface, which increased
the cytotoxic responses of human NK cells in vitro.
However, because we used immunodeficient NMRInu/
numice as host for the xenografts, an appropriate
immune response in vivo appears unlikely in our exper-
iments; in line with this assumption, the histological
analysis of glioma xenografts revealed no infiltration of
leukocytes (ie, NK cells present in immunodeficient
NMRInu/nu) into the treated tumors. This indicates
that the antitumor effects of PEI/siSurvivin treatment
observed here are only based on “direct” intracellular
effects of survivin knockdown. In contrast, an exper-
imental PEI/siSurvivin therapy approach targeting
transplantedsyngeneic
nonviraldelivery of
gliomacellsin
immunocompetent mice will address the question
whether the host immune system can even further
promote anti-glioma effects caused by the knockdown
of survivin. However, for the development of a systemic
PEI/siRNA-therapy of gliomas, additional improve-
ments of PEI-siRNA carrier molecules are warranted.
Modifications might include covalent coupling of
maltose- or polyethylenglycol molecules for minimizing
unspecific uptake and additional conjugation of anti-
bodies (ie, transferrin receptor antibody) and ligands
(ie, transferrin, lactoferrin), which hold promise for a
receptor-mediated transcytosis in brain endothelial
cells.57–59
In the view of the efficiency and specificity of RNA
interference in connection with the development of
advanced carrier systems, siRNA therapies for the
knockdown of target genes, such as survivin, may be
useful in therapy of gliomas and other cancers.
Acknowledgments
We thank F. Zachow and B. Goldberg for excellent tech-
nical assistance. pMD.G2 was kindly provided by
D. Trono (University of Geneva, Switzerland). The
pRVH-1 and pRVH1-puro vectors were kindly provided
by S. Schuck and K. Simons (MPI for Cell Biology and
Genetics, Dresden, Germany).
Conflict of interest statement. None declared.
Funding
Wilhelm Sander Stiftung (2008.065.1 to A.T.), Deutsche
Krebshilfe (106992 to A.A), Deutsche Forschungs-
gemeinschaft (Forschergruppe 627 ‘Nanohale’, AI 24/
6-1 to A.A.).
References
1. Surawicz TS, Davis F, Freels S, Laws ER, Jr, Menck HR. Brain tumor sur-
vival: results from the National Cancer Data Base. J Neurooncol.
1998;40(2):151–160.
2.Davis FG, Kupelian V, Freels S, McCarthy B, Surawicz T. Prevalence esti-
mates for primary brain tumors in the United States by behavior and
major histology groups. Neuro Oncol. 2001;3(3):152–158.
3.Grossman SA, Batara JF. Current management of glioblastoma multi-
forme. Semin Oncol. 2004;31(5):635–644.
4. Hou LC, Veeravagu A, Hsu AR, Tse VC. Recurrent glioblastoma multi-
forme: a review of natural history and management options. Neurosurg
Focus. 2006;20(4):E5.
5. Quick A, Patel D, Hadziahmetovic M, Chakravarti A, Mehta M. Current
therapeutic paradigms in glioblastoma. Rev Recent Clin Trials.
2010;5(1):14–27.
6. Ashihara E, Kawata E, Maekawa T. Future prospect of RNA interference
for cancer therapies. Curr Drug Targets. 2010;11(3):345–360.
7. Ambrosini G, Adida C, Altieri DC. A novel anti-apoptosis gene, survivin,
expressed in cancer and lymphoma. Nat Med. 1997;3(8):917–921.
8.Velculescu VE, Madden SL, Zhang L, et al. Analysis of human transcrip-
tomes. Nat Genet. 1999;23(4):387–388.
9.Das A, Tan WL, Teo J, Smith DR. Expression of survivin in
primary glioblastomas. J Cancer Res Clin Oncol. 2002;128(6):302–306.
10. Chakravarti A, Noll E, Black PM, et al. Quantitatively determined survi-
vin expression levels are of prognostic value in human gliomas. J Clin
Oncol. 2002;20(4):1063–1068.
11. Kajiwara Y, Yamasaki F, Hama S, et al. Expression of survivin in astrocy-
tic tumors: correlation with malignant grade and prognosis. Cancer.
2003;97(4):1077–1083.
12. Saito T, Arifin MT, Hama S, et al. Survivin subcellular localization in
high-grade astrocytomas: simultaneous expression in both nucleus
andcytoplasm isnegative prognosticmarker.
J Neurooncol.
2007;82(2):193–198.
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1
1087

Page 15

13. O’Connor DS, Schechner JS, Adida C, et al. Control of apoptosis during
angiogenesis by survivin expression in endothelial cells. Am J Pathol.
2000;156(2):393–398.
14. Shin S,SungBJ,Cho YS,et al.An anti-apoptotic protein humansurvivin isa
directinhibitorofcaspase-3and -7.Biochemistry.2001;40(4):1117–1123.
15. Song Z, Yao X, Wu M. Direct interaction between survivin and Smac/
DIABLO is essential for the anti-apoptotic activity of survivin during
taxol-induced apoptosis. J Biol Chem. 2003;278(25):23130–23140.
16. Liu T, Brouha B, Grossman D. Rapid induction of mitochondrial events
and caspase-independent apoptosis in survivin-targeted melanoma
cells. Oncogene. 2004;23(1):39–48.
17. Li F, Ambrosini G, Chu EY, et al. Control of apoptosis and mitotic spindle
checkpoint by survivin. Nature. 1998;396(6711):580–584.
18. Mirza A, McGuirk M, Hockenberry TN, et al. Human survivin is nega-
tively regulated by wild-type p53 and participates in p53-dependent
apoptotic pathway. Oncogene. 2002;21(17):2613–2622.
19. Hoffman WH, Biade S, Zilfou JT, Chen J, Murphy M. Transcriptional
repression of the anti-apoptotic survivin gene by wild type p53. J Biol
Chem. 2002;277(5):3247–3257.
20. Pennati M, Folini M, Zaffaroni N. Targeting survivin in cancer therapy.
Expert Opin Ther Targets. 2008;12(4):463–476.
21. Fraser AG, James C, Evan GI, Hengartner MO. Caenorhabditis elegans
inhibitor of apoptosis protein (IAP) homologue BIR-1 plays a conserved
role in cytokinesis. Curr Biol. 1999;9(6):292–301.
22. Speliotes EK, Uren A, Vaux D, Horvitz HR. The survivin-like C. elegans
BIR-1 protein acts with the Aurora-like kinase AIR-2 to affect chromo-
somes and the spindle midzone. Mol Cell. 2000;6(2):211–223.
23. Uren AG, Wong L, Pakusch M, et al. Survivin and the inner centromere
protein INCENP show similar cell-cycle localization and gene knockout
phenotype. Curr Biol. 2000;10(21):1319–1328.
24. Temme A, Rieger M, Reber F, et al. Localization, dynamics, and function
of survivin revealed by expression of functional survivinDsRed fusion
proteins in the living cell. Mol Biol Cell. 2003;14(1):78–92.
25. Wheatley SP, Carvalho A, Vagnarelli P, Earnshaw WC. INCENP is
required for proper targeting of survivin to the centromeres and the
anaphase spindle during mitosis. Curr Biol. 2001;11(11):886–890.
26. Temme A, Herzig E, Weigle B, et al. Inhibition of malignant glioma cell
growth bya survivinmutant retrovirus.
Hum Gene Ther.
2005;16(2):209–222.
27. Li F, Ackermann EJ, Bennett CF, et al. Pleiotropic cell-division defects
and apoptosis induced by interference with survivin function. Nat Cell
Biol. 1999;1(8):461–466.
28. Lens SM, Wolthuis RM, Klompmaker R, et al. Survivin is required for a
sustained spindle checkpoint arrest in response to lack of tension.
EMBO J. 2003;22(12):2934–2947.
29. Honda R, Korner R, Nigg EA. Exploring the functional interactions
between Aurora B, INCENP, and survivin in mitosis. Mol Biol Cell.
2003;14(8):3325–3341.
30. Elbashir SM, Harborth J, Weber K, Tuschl T. Analysis of gene function in
somatic mammalian cells using small interfering RNAs. Methods.
2002;26(2):199–213.
31. Soneoka Y, Cannon PM, Ramsdale EE, et al. A transient three-plasmid
expression system for the production of high titer retroviral vectors.
Nucleic Acids Res. 1995;23(4):628–633.
32. Hobel S, Koburger I, John M, et al. Polyethylenimine/small interfering
RNA-mediated knockdown of vascular endothelial growth factor in
vivo exerts anti-tumor effects synergistically with bevacizumab. J
Gene Med. 2010;12(3):287–300.
33. Brockmann MA, Westphal M, Lamszus K. Improved method for the
intracerebral engraftment of tumour cells and intratumoural treatment
using a guide screw system in mice. Acta Neurochir (Wien).
2003;145(9):777–781.
34. Stevenson M. Therapeutic potential of RNA interference. N Engl J Med.
2004;351(17):1772–1777.
35. Shankar P, Manjunath N, Lieberman J. The prospect of silencing disease
using RNA interference. JAMA. 2005;293(11):1367–1373.
36. Croci DO, Cogno IS, Vittar NB, et al. Silencing survivin gene expression
promotesapoptosis of humanbreast cancercellsthrougha
caspase-independent pathway. J Cell Biochem. 2008;105(2):381–390.
37. Uchida H, Tanaka T, Sasaki K, et al. Adenovirus-mediated transfer of
siRNA against survivin induced apoptosis and attenuated tumor cell
growth in vitro and in vivo. Mol Ther. 2004;10(1):162–171.
38. Zhen HN, Li LW, Zhang W, et al. Short hairpin RNA targeting survivin
inhibits growth and angiogenesis of glioma U251 cells. Int J Oncol.
2007;31(5):1111–1117.
39. George J, Banik NL, Ray SK. Survivin knockdown and concurrent 4-HPR
treatment controlled human glioblastoma in vitro and in vivo. Neuro
Oncol. 2010;12(11):1088–1101.
40. Ghosh JC, Dohi T, Kang BH, Altieri DC. Hsp60 regulation of tumor cell
apoptosis. J Biol Chem. 2008;283(8):5188–5194.
41. Wang Y, Zhu H, Quan L, et al. Downregulation of survivin by RNAi inhi-
bits the growth of esophageal carcinoma cells. Cancer Biol Ther.
2005;4(9):974–978.
42. Chen T, Deng C. Inhibitory effect of siRNA targeting survivin in gastric
cancer MGC-803 cells. Int Immunopharmacol. 2008;8(7):1006–1011.
43. Shen YM, Yang XC, Song ML, Qin CH, Yang C, Sun YH. Growth inhi-
bition induced by short hairpin RNA to silence survivin gene in human
pancreatic cancer cells. Hepatobiliary Pancreat Dis Int. 2010;9(1):
69–77.
44. Li QX, Zhao J, Liu JY, et al. Survivin stable knockdown by siRNA inhibits
tumor cell growth and angiogenesis in breast and cervical cancers.
Cancer Biol Ther. 2006;5(7):860–866.
45. CaldasH,Holloway MP, HallBM, QualmanSJ, AlturaRA.
Survivin-directed RNA interference cocktail is a potent suppressor of
tumour growth in vivo. J Med Genet. 2006;43(2):119–128.
46. Zhang R, Ma L, Zheng M, et al. Survivin knockdown by short hairpin
RNA abrogates the growth of human hepatocellular carcinoma xeno-
grafts in nude mice. Cancer Gene Ther. 2010;17(4):275–288.
47. Shen W, Wang CY, Wang XH, Fu ZX. Oncolytic adenovirus mediated
Survivin knockdown by RNA interference suppresses human colorectal
carcinoma growth in vitro and in vivo. J Exp Clin Cancer Res.
2009;28:81.
48. Liu GF, Zhao QG, Si L, Cao YG, Li GY, Wang LX. Effects of survivin
interference RNA on non-small cell lung carcinoma. Clin Invest Med.
2009;32(6):E225.
49. Urban-Klein B, Werth S, Abuharbeid S, Czubayko F, Aigner A.
RNAi-mediated gene-targeting through systemic application of poly-
ethylenimine (PEI)-complexed siRNA in vivo. Gene Ther. 2005;12(5):
461–466.
50. Grzelinski M, Urban-Klein B, Martens T, et al. RNA interference-
mediated gene silencing of pleiotrophin through polyethylenimine-
complexed small interfering RNAs in vivo exerts antitumoral effects in
glioblastoma xenografts. Hum Gene Ther. 2006;17(7):751–766.
51. Aigner A. Delivery systems for the direct application of siRNAs to induce
RNA interference (RNAi) in vivo. J Biomed Biotechnol. 2006;2006(4):
71659.
Hendruschk et al.: PEI-siSurvivin inhibits glioma growth
1088
NEURO-ONCOLOGY
†O C T O B E R 2 0 1 1