The role of the protein kinase A pathway in the response to alkaline pH stress in yeast.

Abstract

Exposure of Saccharomyces cerevisiae to alkaline pH provokes a stress condition that generates a compensatory reaction. In the present study we examined a possible role for the PKA (protein kinase A) pathway in this response. Phenotypic analysis revealed that mutations that activate the PKA pathway (ira1 ira2, bcy1) tend to cause sensitivity to alkaline pH, whereas its deactivation enhances tolerance to this stress. We observed that alkalinization causes a transient decrease in cAMP, the main regulator of the pathway. Alkaline pH causes rapid nuclear localization of the PKA-regulated Msn2 transcription factor which, together with Msn4, mediates a general stress response by binding with STRE (stress response element) sequences in many promoters. Consequently, a synthetic STRE-LacZ reporter shows a rapid induction in response to alkaline stress. A msn2 msn4 mutant is sensitive to alkaline pH, and transcriptomic analysis reveals that after 10 min of alkaline stress, the expression of many induced genes (47%) depends, at least in part, on the presence of Msn2 and Msn4. Taken together, these results demonstrate that inhibition of the PKA pathway by alkaline pH represents a substantial part of the adaptive response to this kind of stress and that this response involves Msn2/Msn4-mediated genome expression remodelling. However, the relevance of attenuation of PKA in high pH tolerance is probably not restricted to regulation of Msn2 function.

Full text

Page 1

Biochem. J. (2011) 438, 523–533 (Printed in Great Britain)doi:10.1042/BJ20110607
523
The role of the protein kinase A pathway in the response to alkaline pH
stress in yeast
Carlos CASADO, Asier GONZ´ALEZ, Maria PLATARA, Amparo RUIZ1and Joaqu´ ın ARI˜NO2
InstitutdeBiotecnologiaiBiomedicina&DepartamentdeBioqu´ ımicaiBiologiaMolecular,UniversitatAut` onomadeBarcelona,CerdanyoladelVall` es,Bellaterra08193,Barcelona,Spain
Exposure of Saccharomyces cerevisiae to alkaline pH provokes
a stress condition that generates a compensatory reaction. In the
present study we examined a possible role for the PKA (protein
kinase A) pathway in this response. Phenotypic analysis revealed
that mutations that activate the PKA pathway (ira1 ira2, bcy1)
tend to cause sensitivity to alkaline pH, whereas its deactivation
enhances tolerance to this stress. We observed that alkalinization
causes a transient decrease in cAMP, the main regulator
of the pathway. Alkaline pH causes rapid nuclear localization of
the PKA-regulated Msn2 transcription factor which, together
with Msn4, mediates a general stress response by binding with
STRE (stress response element) sequences in many promoters.
Consequently, a synthetic STRE–LacZ reporter shows a rapid
induction in response to alkaline stress. A msn2 msn4 mutant is
sensitive to alkaline pH, and transcriptomic analysis reveals that
after 10 min of alkaline stress, the expression of many induced
genes(47%)depends,atleastinpart,onthepresenceofMsn2and
Msn4. Taken together, these results demonstrate that inhibition
ofthePKApathwaybyalkalinepHrepresentsasubstantialpartof
the adaptive response to this kind of stress and that this response
involves Msn2/Msn4-mediated genome expression remodelling.
However,therelevanceofattenuationofPKAinhighpHtolerance
is probably not restricted to regulation of Msn2 function.
Key words: alkaline stress, gene expression, Msn2, Msn4, protein
kinase A (PKA), Saccharomyces cerevisiae, transcription factor.
INTRODUCTION
TheregulationoftheactivityofthecAMP/PKA(proteinkinaseA)
pathway plays a major role in the control of metabolism and cell
proliferationinyeastcells,linkedprimarilytotheavailablecarbon
source. In Saccharomyces cerevisiae, for instance, in response to
a rapidly fermentable carbon source such as glucose the pathway
activates the Cyr1 adenylate cyclase, which results in a transient
increase in cAMP levels. PKA is a heterotetramer composed of
two catalytic subunits and two regulatory subunits. The catalytic
subunits can be encoded by three largely redundant genes (TPK1,
TPK2 and TPK3), whereas the regulatory subunits are encoded
by a single gene (BCY1). Binding of a second messenger cAMP
to the regulatory subunits results in dissociation of the complex
and activation of PKA. Restoration of cAMP levels is controlled
by the low- and high-affinity phosphodiesterases encoded by
PDE1 and PDE2 respectively, which hydrolyse cAMP to AMP.
Sequentially, PKA affects diverse downstream targets often at the
gene transcription level, including the stimulation of cell growth
and cell cycle progression, up-regulation of glycolysis, down-
regulation of gluconeogenesis, and mobilization of glycogen and
trehalose [1–5].
PKA can be activated in response to glucose by two parallel
signalling pathways. The first involves the Ras1 and Ras2
small GTPases, which are activated by glucose uptake and
phosphorylation. The active (GTP-bound) Ras proteins increase
the activity of the adenylate cyclase. In turn, the GDP/GTP
exchange on the Ras proteins is controlled by the GEFs (guanine-
nucleotide-exchange factors) Cdc25 and Sdc25 (S. cerevisiae
homologue of Cdc25). The reverse process is accelerated by the
Ira proteins (encoded by the IRA1 and IRA2 genes), which act
as Ras GAPs (GTPase-activating proteins) and maintain Ras in
theGDP-boundinactivestate.ThesecondpathwayinvolvesGpr1
(a putative G-protein-coupled receptor) and its Gα protein Gpa2.
Both pathways converge to activate adenylate cyclase, resulting
in the generation of cAMP [1–3].
Activation of PKA has a major impact on gene expression.
Consequently, several transcription factors are among the known
PKA targets. Two of those are Msn2 and Msn4, which
mediate the transcription of the so-called STRE (stress response
element)-controlled genes [6–8]. STRE-regulated genes are
involved in important processes such as carbohydrate metabolism
and growth regulation, as well as in adaption to diverse
types of stress, including heat, DNA damage, and oxidative
and osmotic stresses [9–12]. Under growth-promoting conditions
(growth on glucose with the absence of stress), Msn2 and
Msn4 are phosphorylated and reside in the cytosol. Upon
glucose exhaustion or other stress conditions [13], they become
hypophosphorylated and translocate to the nucleus, where they
induce expression of the STRE-controlled genes. PKA plays a
very important role inhibiting nuclear import of Msn2/Msn4,
either through direct phosphorylation of their nuclear localization
signal [13–15] or indirectly via the protein kinases Yak1 and
Rim15.
S. cerevisiae grows far better at acidic than neutral
or alkaline pH and consequently even a modest alkalinization of
the medium represents a stress situation that is able to trigger
a compensatory multifactorial response (for a review see [16]).
Alkaline stress activates diverse signalling pathways, including
the Rim101/Nrg1 [17,18], the calcium/calcineurin [19–21]
and the Wsc1/Pkc1/Slt2 MAPK (mitogen-activated protein
kinase) pathways [22]. Alkalinization of the environment also
Abbreviations used: CDRE, calcineurin-dependent response element; Cy3, indocarbocyanine; Cy5, indodicarbocyanine; GAP, GTPase activating
proteins; GEF, guanine-nucleotide-exchange factor; GFP, green fluorescent protein; GO, Gene Ontology; PKA, protein kinase A; STRE, stress response
element; TOR, target of rapamycin.
1Present address: Department of Genetics & Development and Microbiology & Immunology, Columbia University, New York, NY 10027, U.S.A.
2To whom correspondence should be addressed (email Joaquin.Arino@uab.es).
c ?The Authors Journal compilation c ?2011 Biochemical Society
www.biochemj.org
Biochemical Journal
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.

Page 2

524
C. Casado and others
Table 1Yeast strains used
Except otherwise indicated, single BY4741-derived kanMX disruptans that are not listed here correspond to the systematic gene disruption project [25].
NameRelevant genotype Source/reference
BY4741
MAR231
W303-1A
SC7
SC8
PM903
W?N1
W?N2
CCV35
PM942
CCV36
MCY5278
CCV174
CCV175
tpk123 msn2 msn4
CCV37
CCV38
BY4742
DC90
DBY746
AGS66
MATa his3?1 leu2? met15? ura3?
BY4741 bcy1::kanMX4
MATa ade2-1, can1-100, his3-112, leu2-3, trp1-1, ura3-1
W303-1A ira1::LEU2
W303-1A ira2::URA3
W303-1A ira1::LEU2 ira2::URA3
W303-1A cdc25::CDC25 aa907-1589/URA3
W303-1A cdc25::CDC25 aa1147-1589/URA3
W303-1A pde1::kanMX4
W303-1A pde2::URA3
W303-1A pde1::kanMX4 pde2::URA3
W303-1A msn2::kanMX4 msn4::hphMX4
W303-1A nrg1::nat1
W303-1A msn2::kanMX4 msn4::hphMX4 nrg1::nat1
W303-1A tpk1::URA3 tpk2::HIS3 tpk3::TRP1 msn2::HIS3 msn4::TRP1
W303-1A snf1::LEU2
W303-1A msn2::kanMX4 msn4::hphMX4 snf1::LEU2
MATα his3?1 leu2? met15? ura3?
BY4742 tpk1::kanMX::HIS3 tpk2w3tpk3::LEU2
MATa ura3-52 leu2-3112 his3-1 trp1-239
DBY746 URA3-STRE(7×)–lacZ
[25]
The present paper
[52]
[42]
[42]
[42]
[53]
[53]
The present paper
[27]
The present paper
M. Carlson
The present paper
The present paper
[14]
The present paper
The present paper
[25]
J.M. Thevelein
D. Botstein
[29]
disturbs nutrient homoeostasis, as deduced from its impact on
iron/copper and phosphate uptake/utilization pathways [19,23].
Work in our laboratory in previous years has shown that alkaline
pH stress also has a profound impact on the expression of genes
encodingglucoseuptakeandmetabolism-relatedproteins,finding
that exposure to high pH would mimic a situation of glucose
starvation [20,21]. Given the strong link between carbohydrate
metabolism and the PKA pathway, we speculated that alkaline
stress might involve changes in the activity of this pathway and
specifically that the correct adaptation to high pH could entail
its down-regulation. Indeed, in the present paper we showed that
alkaline pH stress causes a transient decrease in cAMP levels and
that change in the activity of the PKA pathway alters tolerance
to alkaline pH. The results of the present paper also indicate
that the adaptive response to high pH involves PKA-regulated
Msn2/Msn4-mediated gene remodelling.
MATERIAL AND METHODS
Yeast strains and growth conditions
Yeast cells (the strains are listed in Table 1) were grown at
28◦C in YPD medium (10 g/l yeast extract, 20 g/l peptone and
20 g/l dextrose) or when carrying plasmids in synthetic complete
medium [24] containing 2% glucose and lacking the appropriate
selection requirements. Single kanMX deletion mutants on
the BY4741 background, except MAR231, were generated in the
context of the Saccharomyces Genome Deletion Project [25].
The MAR231 strain was made by transforming BY4741
with a bcy1::kanMX4 cassette obtained from the KKY385
strain [26] by PCR amplification using the primers 5?-
bcy1_disr (GAGGAGCATACGACTTCGGC) and 3?-bcy1_disr
(CTGTCTTGTAGATCCTTTGG). The CCV35 and CCV36
strains were constructed as follows. A 1.6 kbp pde1::kanMX4
cassette was amplified from genomic DNA of the BY4741
pde1::kanMX4
strainwith
(CAAGGATCGTTACCCGGTA) and 3?-pde1 (GACTTATGT-
TGGGATAGGGG). The purified DNA fragment was used to
transform the W303 or PM942 strains [27], to yield the CCV35
theoligonucleotides5?-pde1
and CCV36 strains respectively. The CCV37 and CCV38 strains
were obtained transforming W303-1A wild-type and MCY5278
strains with a SNF1::LEU2 disruption cassette [21] and the
CCV174 and CCV175 strains were generated by transforming
W303-1A and MCY5278 strains with the 2.1 kbp nrg1::nat1
cassette from the plasmid pBS-nrg1::nat1 as described previously
[28]. The AGS66 strain contained an integrated STRE(7×)–lacZ
reporter system at the URA3 locus [29].
Plasmids
The reporter plasmid pHXK1-lacZ was generated as follows. The
HXK1 upstream DNA region containing −624 and +39 relative
tothestartingATGwasamplifiedbyPCRwithaddedBamHI/PstI
restrictionsitesandclonedintothesamesitesofYEp357[30].The
plasmid YCp50-RAS2Ala18Val19[31] expressed the RAS2Ala18Val19
hyperactive Ras2 allele [32] from the centromeric YCp50.
The plasmid pG2CT-112.2 expressed the constitutively active
GPA2R273Aallele from the episomal YEplac112 backbone [31].
The plasmid pAMS366 contains a tandem of four CDREs
(calcineurin-dependent response elements) from the GSC2/FKS2
gene fused to the lacZ reporter [33]. pPHO84-LacZ contains
a PHO84-LacZ reporter fusion as described in [19]. pKC201
contains the ENA1 promoter fused to LacZ [34,35].
Growth tests
ThesensitivityofdifferentyeaststrainstoalkalinepHwasassayed
by drop test on YPD plates containing 50 mM Taps adjusted
with KOH at different pH values. Growth in liquid medium at
high pH was performed in 5 ml cultures or in 96-well plates
(250 μl),at28◦CinYPDmediumbufferedwith50 mMTapsand
adjusted with KOH at the pH values indicated below. Growth was
monitored by measuring the absorbance (A) at 660 nm. BY4742
and DC90 cells at an initial A660 of 0.001 were grown for 17
and 24 h respectively. The strains prepared from the W303-1A
genetic background were grown from an initial A660of 0.01 for
c ?The Authors Journal compilation c ?2011 Biochemical Society
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2011 The Author(s)

Page 3

PKA pathway in high pH response
525
17 h (wild-type and MCY5278 strains) and for 21 h (CCV37 and
CCV38 strains).
Measurement of cAMP levels
Measurements were made as described in [36]. Briefly, BY4741
cells were grown to an A660value of approximately 1.0 in YPD at
28◦C, and then the culture was centrifuged (5 min at 1220 g at
room temperature) and resuspended in YPD containing 50 mM
Taps (pH 8). Aliquots of 10 ml were filtered at the indicated
times and extracted in the cold with 1 ml of 2 M perchloric acid.
After neutralization with 1 ml of 1.8 M KOH and 0.4 M KHCO3
and centrifugation (5 min at 1220 g at 4◦C), the samples were
purified with Amprep SAX minicolumns (Amersham), eluted
with methanol/HCl and dried under vacuum. The assays were
performed by a competitive binding method with the Amersham
cAMP EIA (enzyme immunoassay) system. For calculation of
yeast concentrations, one unit of absorbance at 660 nm was
equivalent to 2.6 mg of wet weight/ml. In other experiments,
the pH was raised to 8.2 by the addition of KOH (35 mM, final
concentration). The control cells received the same concentration
of KCl.
β-Galactosidase activity assay
Yeast cells were grown to saturation in the appropriate dropout
medium and then inoculated into YPD medium (or YP plus
4% glucose, where indicated) at pH 5.5. Growth was resumed
until A660was 0.5–0.7 and the cultures were centrifuged at room
temperature for 5 min at 1620 g. The cells were resuspended
in YPD or YP 4% glucose where indicated (no induction) or
YPD (or YPD 4% glucose) plus 50 mM Taps adjusted to pH 8.0
(alkaline stress), and growth was resumed for the indicated times.
In all cases, β-galactosidase activity was measured as described
previously [37].
Microscopy techniques
For the Msn2 subcellular localization experiments, the indicated
strains were transformed with the plasmid pMSN2-GFP (given
by Professor Francisco Estruch, University of Valencia, Valencia,
Spain), a YCplac111-based vector that contains a C-terminal
Msn2–GFP(greenfluorescentprotein)fusion[13].Thecellswere
grown in YPD or YP 2% ethanol until an A660 value of 0.8–
1.0 was reached. The cultures (5 ml) were treated by either the
addition of 100 μl of 1 M KCl (control cells, pH 5.5) or of 100 μl
of 1 M KOH (alkaline stress, pH 8.0). Samples (500 μl) were
taken at the appropriate times and fixed for 5 min by adding 30 μl
of 37% formaldehyde. The cells were harvested, washed three
times with PBS and concentrated 10-fold before visualization.
In all cases the cells were visualized with a fluorescein
filter using a Nikon Eclipse E800 fluorescence microscope
(magnification, 1000×). Digital images were captured with an
ORCA-ER4742-80camera(Hamamatsu)usingWasabisoftware.
Intracellular distribution of Msn2–GFP was quantified by scoring
at least in 200 cells per sample into one of three possible
categories: cytoplasmic (fluorescence in the cytoplasm only),
nuclear/cytoplasmic (fluorescence in the cytoplasm and nucleus)
and nuclear (fluorescence in the nucleus only).
RNA purification, cDNA synthesis and DNA microarray experiments
For RNA purification, 50 ml of yeast culture (strains W303-
1A and MCY5278) was grown at 28◦C in YPD medium until
an A660 value of 0.6–0.8 was reached, and then KOH or KCl
was added from a concentrated stock solution (1 M) to reach a
final concentration of 20 mM (pH 8.05 and pH 5.5 respectively).
Yeast cells were harvested by filtration after 10 and 30 min and
washed with ice-cold water; dried cells were kept at −80◦C until
RNA purification was performed. Total RNA was purified using
a RiboPure-Yeast kit (Ambion) following the manufacturer’s in-
structions.RNAqualitywasassessedbydenaturing0.8%agarose
gel electrophoresis, and RNA quantification was performed by
measuringabsorbanceat260 nminaBioPhotometer(Eppendorf).
Transcriptional analyses were performed using DNA microarrays
(printed at the Universitat Aut` onoma de Barcelona Genomics
Facility) containing PCR-amplified fragments from 6014 S.
cerevisiae open reading frames [20,38]. Fluorescent Cy3- and
Cy5-labelled cDNA probes were prepared from 8 μg of purified
totalRNAbytheindirectdUTPlabellingmethodusingaCyScribe
post-labelling kit (Amersham Biosciences).
Pre-hybridization,hybridizationandwasheswerecarriedoutas
recommended by The Institute for Genomic Research with minor
modifications. Briefly, prehybridizations of the DNA microarrays
were carried out at 42◦C for 1 h in a solution containing 5× SSC
(1× SSC is 0.15 M NaCl/0.015 M sodium citrate), 0.1% SDS
and 1% BSA. For hybridization, dried Cy3 (indocarbocyanine)-
and Cy5 (indodicarbocyanine)-labelled probes were resuspended
in 35 μl of hybridization solution (50% formamide, 5× SSC and
0.1% SDS) each and mixed. Salmon sperm DNA (5 μg) was
added to the mix before denaturation for 3 min at 95◦C. DNA
microarrays were hybridized in an ArrayBooster hybridization
station(SunergiaGroup)for14 hat42◦C.ThescannerScanArray
4000 (Packard Instrument) was used to obtain the Cy3 and Cy5
images with a resolution of 10 μm. The fluorescent intensity of
the spots was measured and processed using the GenePix Pro
6.0 software (Molecular Devices). Spots with either a diameter
smaller than 120 μm or fluorescence intensity for Cy3 and Cy5
lower than 150 units were not considered for further analysis.
For each condition assayed, two independent experiments
were performed and dye swapping was carried out for each
experiment. Microarray data was deposited at the GEO (Gene
Expression Omnibus; accession number GSE27925). The results
from different experiments were combined, and the mean was
calculated. A given gene was considered to be induced or
repressed when the mean of the ratios (alkaline stress compared
with no stress) was >2.0 or <0.50 respectively. Software from
theGEPASserver(http://gepas.bioinfo.cipf.es/)wasusedtocarry
out clustering and other data analyses [39]. According to the
expression of these genes in the msn2 msn4 strain, different levels
of dependence on these transcription factors were defined. Thus
genes showing a mutant/wild-type ratio of 0.67 > X > 0.50 were
considered ‘weakly dependent’, those with a ratio 0.50 > X >
0.25 were ranked as ‘strongly dependent’ (SD) and those with a
ratio ? 0.25 were defined as ‘totally dependent’. Likewise, genes
induced more than 2.5-fold in wild-type cells and considered
not induced (i.e. the ratio of alkaline stress/no stress) <1.3) in
msn2 msn4 cells were also considered as totally dependent. This
score is the same employed in our previous report on calcineurin
dependence of high pH response [20].
RESULTS
Manipulation of upstream elements of the PKA pathway affects
growth at alkaline pH
Our starting hypothesis was that adaptation to high pH stress
should entail a decrease in the PKA pathway activity. Therefore
we speculated that mutations increasing the activity of the
c ?The Authors Journal compilation c ?2011 Biochemical Society
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.

Page 4

526
C. Casado and others
Figure 1 Effect of mutations in the upstream components of the PKA pathway on alkaline pH tolerance
(A)AsimplifiedschematicdepictionofthePKAsignallingpathway.SeetheIntroductionsectionforadditionalinformation.(B)Upperpanels:threedilutionsofculturesofwild-typeBY4741cellsand
the isogenic kanMX disruption derivatives ras1, ras2, sds25 and ira2 mutants were spotted on to YPD plates adjusted at the indicated pH values. Middle panels: wild-type strains W303-1A and its
ira1::LEU2 (strainSC7),ira2::URA3 (SC8)andira1::LEU2ira2::URA3 (PM903)derivativeswerespottedasabove.Lowerpanels:wild-typestrainsW303-1AandisogeniccellsexpressingtheW?N1
or W?N2 alleles of CDC25 were spotted. All plates were incubated for 3 days. (C) Wild-type strain W303-1A was transformed with the indicated plasmids. Positive clones were grown overnight in
synthetic selective medium and spotted on to YPD plates adjusted at the indicated pH and growth was monitored after 2days. YCp50-RAS2* expresses a hyperactive allele (Ras2Ala18Val19) of the Ras
protein. YEp-GPA2* generates a constitutively active Gpa2R273Aversion of the protein.
pathway should result in a decreased tolerance to alkaline pH. We
first tested strains lacking components of the Gpr1/Gpa2-sensing
pathway such as gpr1, gpa2, rgs2 (lacking a GAP of Gpa2),
gpb1 or gpb2 (lacking the multistep regulator of cAMP/PKA
signalling) (Figure 1A). However, none of these strains showed
analteredtolerancetoalkalinepH(resultsnotshown).Incontrast,
deletion of ira1 or ira2, the GAPs of Ras1 and Ras2, resulted in
increased sensitivity. This phenotype was enhanced in the double
ira1ira2mutant(Figure1B).Conversely,expressionoftheCdc25
W?N1 allele, which lacks the N-terminal domain of Cdc25 and
elicits constitutive activation of Ras proteins, also results in poor
growth at high pH (Figure 1B). All of these manipulations lead to
increased Ras activity and hyperactivation of the PKA pathway.
In contrast, the effect on high pH tolerance of the expression
of the Cdc25 W?N2 allele which does not lead to an increase in
PKAactivitywasbarelynoticeable.Theseresultswereconfirmed
by expression of the hyperactive Ras allele RAS2Ala18Val19from a
centromericplasmid[31].Amongotherphenotypes,expressionof
this allele decreased heat-shock tolerance. The expression of the
RAS2Ala18Val19allele decreased alkaline pH tolerance (Figure 1C).
In contrast, expression of a constitutively active form of Gpa2
(pG2CT-112.2) constructed by replacing the arginine residue at
position 273 with an alanine residue [31] did not alter high pH
tolerance.
Alkaline pH stress transiently decreases the levels of cAMP
cAMP levels determine the interaction between the regulatory
subunit (Bcy1) and the catalytic subunits (Tpk) of PKA and are
therefore crucial for the activity of the kinase. We have measured
the levels of cAMP after shifting the cells from pH 5.5 to medium
buffered to pH 8.0 and found that this treatment drastically
decreased the concentration of the second messenger cAMP in
the first 5–15min, followed by a recovery to the initial levels after
30 min of stress (Figure 2A). A similar result was obtained when
KOH was added directly to the exponentially growing cultures to
raisethepH.InthiscasethedecreaseincAMPlevelswasapparent
even only 2 min after stress (results not shown). Raising the pH of
the liquid medium up to 8.2 did not result in detectable cell lysis,
as determined by microscopic examination, viability counting or
release of alkaline phosphatase activity to the medium.
The results of the present paper were consistent with the
possibility that a drop in cAMP levels leading to down-regulation
of PKA activity could be an adaptive strategy to confront high pH
stress. Therefore we considered that mutations resulting directly
inincreasedcAMPlevelsshouldbedeleteriousforcellssubjected
to alkaline pH stress. The PDE1 and PDE2 genes encode the
yeastcAMPphosphodiesteraseactivity,whichdegradescAMPto
AMP. When the single mutants are grown on alkaline-pH plates,
a growth defect can be observed for the pde2 mutant (lacking the
high-affinity isoform) that is exacerbated in the double pde1 pde2
mutant strain (Figure 2B).
Lack of Bcy1, the regulatory subunit of PKA, leads to
constitutivePKAactivity,whichresultsinavarietyofphenotypes
(impaired growth on different carbon sources, temperature
sensitivity etc.; see [2] and references therein). Although the
quantification of the effect is difficult because of the relatively
poor growth of the bcy1 mutant even under standard conditions,
we can show that this strain exhibits a dramatic alkaline pH-
sensitive phenotype (Figure 2C). The same effect was observed
c ?The Authors Journal compilation c ?2011 Biochemical Society
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2011 The Author(s)

Page 5

PKA pathway in high pH response
527
Figure 2Changes in PKA pathway activity influences high pH tolerance
(A) Wild-type BY4741 cells were subjected to alkaline pH stress as described in the Materials and methods section and cultures were processed for cAMP determination. Results are means+
of at least four independent experiments. (B) Wild-type (WT) W303-1A cells and their derivatives pde1 (CCV35), pde2 (PM942) and pde1 pde2 (CCV36) were spotted on to YPD plates adjusted
at the indicated pH values. Growth was monitored after 2 days. (C) The BY4741 strain (WT) and its bcy1 derivative (MAR231) were grown on YPD plates adjusted at the indicated pH for 3 days.
(D) Wild-type strain BY4742 (open bars) and its derivative DC90 (tpk1 tpk2w3tpk3, closed bars) were grown on liquid YPD medium as described in the Materials and methods section. Growth is
represented as the percentage over the same strain at initial pH5.5. Results are the average+
−S.E.M
−S.E.M. from two independent experiments.
in the W303-1A background (results not shown). Similarly,
we tested whether a decrease in PKA activity could improve
growth at high pH. Since complete lack of PKA activity is not
compatible with survival, for this experiment we resorted to a
strain lacking TPK1 and TPK3 and carrying an attenuated allele
of TPK2 (tpk2w3) as the sole source of PKA activity. As shown
in Figure 2(D), the relative growth of this strain in alkaline pH
medium compared with non-restrictive conditions is higher than
the wild-type strain. In essence, the results presented so far show
thatyeastcellsrespondtothealkalinizationoftheirmediumwitha
sharpdecreaseintheintracellularlevelofcAMP.Theobservation
that when PKA activity is attenuated cells grow better at high
pH, whereas any situation resulting in increased PKA activity
makes cells more sensitive to this condition, supports the notion
that down-regulating PKA activity contributes to adaptation to
alkaline pH stress.
Alkaline pH stress promotes entry of Msn2 in the nucleus and
STRE-dependent promoter activation
Nuclear localization of Msn2, a transcription factor that together
with Msn4 regulates the general stress response of S. cerevisiae,
is controlled by PKA activity [13,14,40]. We considered that
alkaline pH-triggered down-regulation of the PKA activity could
result in the translocation of Msn2 to the nucleus and that
this transition might have a relevant effect in the pH-induced
adaptive response. To test this possibility, an Msn2–GFP fusion
was introduced into wild-type cells and the cultures subjected to
alkaline treatment. As shown in Figures 3(A) and 3(B), exposure
tohighpH(8.0)triggeredanalmostimmediateentryofMsn2into
the nucleus, which reached a maximum after 5 min (Figure 3B).
Nuclear localization of Msn2 was transient and after 10–15 min
the transcription factor was again mostly cytosolic. Interestingly,
when the same experiment was carried out in a strain lacking the
IRA2gene(sensitivetoalkalinepH,seeFigure1B),entryofMsn2
into the nucleus was somewhat delayed and nuclear localization
was a less general effect than in the wild-type strain. Nuclear
translocation of Msn2 was also evaluated in cells subjected to
alkaline stress (pH 8.0) growing in the presence of ethanol as
a carbon source (Figure 3B). Under these conditions, Msn2
showed both cytoplasmic and nuclear/cytoplasmic distribution in
unstressed cells. Interestingly, exposure of cells to alkalinization
resulted in only a modest increase in the percentage of cells
showing nuclear/cytoplasmic distribution, but very few cells with
only nuclear Msn2. Therefore subcellular distribution of Msn2
in response to alkaline stress is affected by the carbon source in
which cells are grown.
We then investigated whether the Msn2 and Msn4 transcription
factors are necessary for a normal tolerance to high pH stress. As
showninFigure4(A),lackofthesetranscriptionfactorssomewhat
reducestolerancetohighpH,suggestingthattheyarecomponents
of the adaptive response to alkalinization. Remarkably, additional
deletion of all three PKA catalytic subunits (which is feasible
in the absence of the transcription factors) yields cells that are
even more sensitive than the msn2 msn4 mutant. It should be
noted that in this case the msn2 msn4 strain was transformed
with a centromeric plasmid which contains a TRP1 marker.
The introduction of this marker in the reference strain was
necessary for accurate comparison because the tpk msn2,4 strain
was constructed using the TRP1 gene as a marker, and it has
been reported that the absence of this gene somewhat decreases
tolerance to high pH [41]. These results suggested that, besides
its role in Msn2,4 function, regulation of PKA activity may exert
additionaleffectsonhighpHtolerance.Thisnotionwasreinforced
by the results shown in Figure 4(B). We observed that expression
of the hyperactive form of RAS2 further decreased high pH
toleranceevenintheabsenceofMsn2/Msn4transcriptionfactors,
c ?The Authors Journal compilation c ?2011 Biochemical Society
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.

Page 6

528
C. Casado and others
Figure 3 Alkaline pH triggers nuclear entry of the Msn2 transcription factor
Cultures of wild-type BY4741 (WT) and its ira2::kanMX derivative (right-hand panels) were transformed with plasmid pMsn2-GFP and subjected to pH stress (8.0) on YPD medium. Samples were
collected at the specified times and fixed for fluorescence microscopy. (B) BY4741 cells carrying the pMsn2-GFP construct were grown to exponential phase (A660of 0.8) on YPD medium or
YP medium containing ethanol (2%) as the carbon source, shifted to pH8.0. The subcellular distribution of the Msn2–GFP fusion was monitored for at least 200 cells per time point. Open bars
denote full cytoplasmic, closed bars denote nuclear/cytoplasmic and crossed bars denote full nuclear localization. The results shown correspond to a representative experiment. Three independent
experiments were performed with similar results.
suggesting again that not all of the effects relevant for alkaline
tolerancemediatedbyPKAarebasednecessarilyontheactivation
of Msn2/Msn4. On the other hand, cells lacking the Snf1 kinase
are sensitive to alkaline pH and Snf1 has been reported to repress
Msn2 function. Therefore we considered whether the sensitive
phenotype of snf1 cells could be due to deregulation of Msn2
function. As shown in Figure 4(C), snf1 cells are more sensitive
than the msn2 msn4 mutant to alkaline pH. In addition, deletion
of msn2 msn4 further increases sensitivity to alkaline pH of the
snf1 mutant. Therefore deregulation of Msn2/Msn4 is not
the basis of the snf1 alkali-sensitive phenotype.
Because Msn2 is known to bind with STRE elements in
response to glucose shortage and other forms of stress, we tested
the activation of a synthetic promoter containing a tandem of
seven STRE elements fused to the LacZ reporter (the AGS66
strain). As shown in Figure 5(A), this promoter exhibited a very
fast activation with a peak of activity 15 min after moving the
cells to a pH 8.0 environment. This activation was much faster
than that observed when the LacZ gene is expressed from a
PHO84promoter,whichisconsideredagenewitharelativelylate
responsetohighpHstress[19]anditwascompletelyabolishedin
a msn2 msn4 strain (results not shown). Remarkably, the response
was also faster than that obtained from a synthetic promoter
based in a cluster of four copies of the CDRE motif from the
calcineurin-responsive GSC2/FKS2 gene. It must be noted that
the calcineurin/Crz1-mediated response is considered to be an
early response to alkaline pH stress [19,20]. We also tested
the response to alkaline pH of the HXK1 gene which encodes
hexokinase, a gene with predicted STRE elements in its promoter
[10] and known to be induced by high temperature (37◦C) and
oxidative stress in a msn2 msn4-dependent way [12]. As shown in
Figure5(B),expressionoftheHXK1promoterinducedbyhighpH
stresswasasfastastheoneinducedbyexposureto37◦C,although
the level of β-galactosidase activity declined faster (probably
due to yeast-promoted acidification of the medium). Remarkably,
in the msn2 msn4 strain the basal activity of the promoter, as
well as the response to both stress conditions, is dramatically
reduced. However, a small increase can still be detected after
30 min of exposure to high pH stress, suggesting an Msn2/Msn4-
independent input to the promoter, which could be attributed to
activation of calcineurin as this gene was demonstrated to be
induced by calcium as well as by high pH [21].
Relevance of Msn2/Msn4 transcription factors in the
transcriptional response to high pH stress
SincetheseresultsindicatedthatMsn2/Msn4couldberesponsible
for the response of certain genes to alkaline pH stress, we
considered it necessary to evaluate to what extent this pathway
is responsible for the remodelling of gene expression observed
upon exposure to high pH. To this end, DNA microarray analysis
was conducted using wild-type and msn2 msn4 strains subjected
to pH 8.0 for 10 and 30 min. After 10 min of exposure to high
pH, in the wild-type cells 331 genes had a magnitude of induced
expression at least 2-fold greater, whereas only 186 genes found
in the msn2 msn4 cells strain (from a total number of 3463
genes with valid data; Figure 6 and Supplementary Table S1 at
http://www.BiochemJ.org/bj/438/bj4380523add.htm).
GO (Gene Ontology) analysis of the genes induced in the
wild-type strain yielded, as expected, an excess of genes related
to carbohydrate metabolism (P<7.74×10−9), in particular to
trehalose (P<5.05×10−8) and glucose (P<1.42×10−6) and
glycogen (P<1.61×10−3) metabolism. Analysis of the msn2
msn4 dependence for induction revealed that 157 genes required
the presence of the transcription factors for full induction
(Figure 6). Although dependence was limited in some cases (62
c ?The Authors Journal compilation c ?2011 Biochemical Society
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2011 The Author(s)

Page 7

PKA pathway in high pH response
529
Figure 4
pH tolerance
Effect of the lack of Msn2 and Msn4 transcription factors on high
(A) Upper panels: wild-type W303-1A alone (WT) was plated along with strain MCY5278, a
W303-1A-derived strain lacking both MSN2 and MSN4 genes. Lower panels: the MCY5278
strainwastransformedwithcentromericplasmidYCp22(whichcarriesaTRP1genemarker,see
the main text for an explanation) and plated with the equivalent strain but lacking all three TPK
genes[14].Dilutionsoftheculturesweregrownfor2daysattheindicatedpH.(B)TheW303-1A
strain (WT) and the msn2 msn4 derivative transformed with the empty plasmid YCp50 or the
sameplasmidcarryingahyperactiveRAS2Ala18Val19allele(RAS2*).Dilutionsofthecultureswere
spotted on to YPD plates at the indicated pH values and growth was monitored after 2 days.
(C) The W303-1A strain (open bars) and its msn2 msn4 derivative (closed bars) carrying a
wild-type allele of SNF1 (+) or a snf1 deletion (−) were grown at the indicated pH values.
GrowthisdenotedasthepercentagecomparedwiththesamestrainsculturedatpH5.5.Results
are means+
−S.E.M. from two independent experiments performed in triplicate.
genes were rated as weakly dependent), the majority of the short-
term induced genes were strongly (57) or totally (38) dependent
of the presence of Msn2 and Msn4. GO analysis of the 95 genes
definedasstronglyortotallydependentrevealedastrongexcessof
genes encoding proteins involved in trehalose (P<9.40×10−9)
andglycogen(P<1.46×10−7)metabolism.Asimilaranalysisof
genes showing weak dependence provided no distinctive profile.
Exposure of cells to pH 8.0 for 30 min resulted in 241 genes
induced in the wild-type strain, whereas 296 genes increased
expression at least 2-fold in the msn2 msn4 mutant (Figure 6). In
this case, the level of dependence of the transcription factors was
much lower (only 50 genes). In addition, the vast majority (40)
were weakly dependent; nine were ranked as strongly dependent
and only one as totally dependent. GO analysis of the set of
strongly dependent plus totally dependent genes did not produce
any specific profile. Therefore Msn2 and Msn4 transcription
factors are responsible for the induction of a substantial subset
of the early alkali-responsive genes. Analysis of repressed genes
showed 146 and 279 genes repressed at least 0.5-fold in the wild-
type strain 10 and 30 min after a shift to high pH respectively.
The absence of msn2 msn4 did not result in activation of any of
these genes.
The ENA1 gene encodes a Na+-ATPase that has been reported
repeatedly to be strongly induced upon alkaline pH stimulation.
Interestingly, our microarray results indicate that deletion of
MSN2/MSN4 does not affect the induction of this ATPase gene
in the short-term (10 min), but results in higher-than-normal
expression after 30 min of stress (Figure 7A). In an attempt to
identify a possible cause for this behaviour we searched our
microarray raw data for changes in the expression of genes
encoding known regulatory components of ENA1. We observed
thatafter10minafteralkalinizationofthemedium,theexpression
of NRG1, a known repressor of ENA1 expression, was essentially
identical in the wild-type and msn2 msn4 cells. However, after
30 min the expression of NRG1 was decreased by 37% in the
msn2 msn4 strain compared with the wild-type. To explore a
possible influence of this change on the response of ENA1,
we evaluated the expression from the ATPase gene promoter
in wild-type and msn2 msn4 cells deleted for NRG1 by means
of a LacZ reporter. As it can be observed (Figure 7B), high-
pH-dependent expression from the ENA1 promoter is stronger
in the msn2 msn4 mutant than in the wild-type strain, thus
confirming the microarray results. Moreover, the induction
observed upon alkaline pH stimulation in the nrg1 strain is
virtually identical with that observedin the msn2msn4 nrg1triple
mutant, suggesting that changes in the Nrg1 levels could be at the
basisoftheabnormalresponseofENA1inthemsn2msn4mutant.
DISCUSSION
Exposure to alkaline stress triggers a set of responses that are
known to be mediated by different signalling pathways, such as
the calcineurin/Crz1, the Rim101 and the Slt2 pathways [16].
PKA mediates a major signalling pathway that is crucial for
linkingstressresponsesandcellproliferation.Thereforethemajor
goal of the present study was to evaluate the relevance of the
PKA pathway in the adaptive response to high pH stress. We
observed that mutations leading to activation of PKA resulted
in decreased alkaline pH tolerance, whereas those that lead to
inhibition of the pathway yield cells with increased tolerance.
Our results also show that exposure to high pH provokes a sharp
and transient decrease in the cAMP levels, which may lead to
down-regulation of PKA activity. In this regard, a previous study
reportedatransitoryincreaseofcAMPlevelsasaresultofsudden
acidification of the cytosol [42]. It is worth noting that these
authors noticed that Gpa2 was not required for the stimulation
of cAMP accumulation in response to intracellular acidification.
Remarkably, we observe that only alterations in the small G-
proteinsRas1andRas2branchofthepathwaydoresultinchanges
in tolerance to alkaline pH, whereas mutations in diverse genes
involved in the Gpr1/Gpa2 glucose sensor system do not produce
phenotypic effects. This suggests that the observed changes are
due to alteration of intracellular glucose metabolism and not to
c ?The Authors Journal compilation c ?2011 Biochemical Society
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.

Page 8

530
C. Casado and others
Figure 5 Alkaline pH stress induces STRE-mediated transcriptional activation
(A) The wild-type strain DBY746 was transformed with episomal plasmids pPHO84-LacZ (pPHO84) and pAMS366 (pCDRE). These strains, together with strain AGS66 [carrying a STRE(7×)–LacZ
reporter system integrated at the URA3 locus] were grown and subjected to high pH stress (pH8.0). β-Galactosidase activity was measured as described and it is represented as the percentage over
the maximum value for each strain. (B) The wild-type strain W303-1A (continuous lines) and its msn2 msn4 derivative (broken lines) were transformed with the HXK1–LacZ reporter. Cultures grown
on YP medium (plus 4% glucose) were subjected to high pH (8.0,?) or high temperature (37◦C,?) and samples taken at different times for β-galactosidase activity measurements. Non-induced
cultures are denoted by circles. Results are means+
−S.E.M. from six independent experiments.
Figure 6
alkaline stress
Msn2/Msn4 dependence of the transcriptional response to
Upper panel: number of genes induced in the wild-type and the msn2 msn4 strains after 10 or
30 min of alkaline stress deduced from the DNA microarray analysis. Lower panel: evaluation
of the Msn2/Msn4 level of dependence of the transcriptional response to high pH after 10 min
(open bars) and 30 min (closed bars). Ind, Independent; WD, weakly dependent; SD, strongly
dependent; TD, totally dependent.
defectsintheextracellularglucosedetectionsystem,andreinforce
the notion that changes in cytosolic pH may result in fluctuations
in cAMP levels and consequent regulation of PKA activity. In the
caseofsuddenalkalinizationofthemedium,thesharpdecreasein
cAMP levels would inhibit PKA activity and allow cells to adapt
to the stress.
The results of the present study show that alkalinization of
the medium triggers a very fast entry of the Msn2 transcription
factor to the nucleus (2–5 min). This time frame is very similar
to that observed when cells are shifted to a low-glucose medium
[13,14]. Interestingly, the fact that we observe only a very modest
response in ethanol-grown cells suggested that nuclear transition
ofMsn2isrelatedtoalkalinestress-inducedalterationsinglucose
signalling. We also show that Msn2 and Msn4 are important
for mediating a substantial part of the transcriptional response
induced by alkalinization of the medium. It is conceivable that
this response constitutes one of the factors that allow normal
tolerance to the stress, since the msn2 msn4 mutant is sensitive to
highpH(Figure4A).Moreover,ourresultssuggestthatregulation
of Msn2 function in response to high pH is the result of inhibition
of PKA. It is known that intracellular localization of Msn2 can be
regulated not only by PKA, but also by the Snf1 kinase [43,44]
and the TOR (target of rapamycin) pathway [44,45], thus raising
the possibility that these two pathways could contribute to the
alkaline pH-triggered entry of Msn2 into the nucleus. In fact,
activation of the Snf1 pathway has been previously linked to high
pHstress [21,28,46].However,weobservethatmutation ofSNF1
yields cells even more sensitive to alkaline pH than those lacking
msn2 msn4, and that deletion of both factors in a snf1 background
further decreases tolerance. Furthermore, we have observed that,
within the time-span shown in Figure 3(A), entry into the nucleus
ofMsn2isnotaffectedbythelackoftheproteinkinaseSnf1after
alkaline treatment (results not shown). Finally, comparison of the
dependence level for Msn2,4 of the short-term transcriptional
response to high pH described in the present paper with the de-
pendence on Snf1, evaluated in a parallel project (A. Casamayor,
A. Ruiz, R. Serrano, M. Platara, J. Ferrer-Dalmau and J. Ari˜ no,
unpublished work), indicates low overlap (only 34 of the 157
genes reported as Msn2,4-dependent in the present study are
found to exhibit some degree of dependence for the Snf1 kinase).
As an example, most of the genes encoding enzymes involved in
trehalose metabolism whose expression is increased by alkaliniz-
ation are Msn2,4-dependent, but not Snf1-dependent. Therefore
the results of the present study do not support the notion that
activation of Msn2/4 by high pH is mediated by the Snf1 kinase.
The PKA and TOR pathways illustrate diverse ways of
functional interaction in the regulation of cell growth, showing
some functional overlap [47]. However, a role of the TOR
c ?The Authors Journal compilation c ?2011 Biochemical Society
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2011 The Author(s)

Page 9

PKA pathway in high pH response
531
Figure 7 Dependence of ENA1 expression on the presence of Msn2/Msn4
(A) Fold-change of ENA1 expression deduced from microarray data for W303-1A wild-type cells (WT, empty bars) and MCY5278 (msn2 msn4, filled bars) exposed to pH8.0 for the indicated times.
Results are means+
a LacZ fusion of the ENA1 promoter. Exponential cultures were resuspended in medium buffered at pH5.5 (empty bars) or pH8.0 (filled bars) for 1 h and β-galactosidase activity was measured.
Results are means+
−S.E.M. from four microarray experiments. (B) Strains with the indicated genotype (+, wild type allele; -, deletion mutant) were transformed with plasmid pKC201, which bears
−S.E.M. from six to nine independent experiments.
pathway in regulation of Msn2 function in response to high pH
is questionable because, with the exception of the ure2 strain (a
very pleiotropic strain), mutants in genes of the pathway do not
show altered tolerance to high pH nor does alkalinization trigger
increased expression of well-established readouts for inhibitors
of the TOR pathway, such as GAP1, GLN1 or GDH1 (results not
shown).Twoproteinkinases,Yak1andRim15,havebeenreported
to modulate Msn2 function in response to PKA activation (see [5]
for a review). However, yak1 and rim15 mutant strains are not
sensitive to high pH (results not shown) and furthermore it has
been proposed that Yak1 regulates Msn2 function by an unknown
mechanismthatdoesnotimplicatethecontrolofMsn2subcellular
localization. Therefore the most probable scenario is that Msn2
entry into the nucleus after high pH stress is caused by inhibition
of PKA activity.
Comparison of the time sequence of the events described in
our work is rather coherent, with a very fast decrease in cAMP
levels and subsequent entry of Msn2 in the nucleus, followed by
a massive, fast (10 min) and transient activation of Msn2/Msn4-
dependent genes, as deduced by DNA microarray transcriptomic
analysis. It is remarkable that, after 30 min of high pH stress, the
transcriptionalresponsebecomeslargelymsn2msn4independent.
In fact, our results (Figure 5A) suggest that Msn2/Msn4 may
be responsible for the first chronological set of transcriptional
responses to alkaline stress, even a faster response than that
mediated by the calcineurin/Crz1 pathway, which were currently
defined as early responses [19,20].
It has been widely documented that expression of the ENA1
Na+-ATPase is potently induced by alkaline pH (see [48] and
references therein). An interesting observation derived from our
microarray results is that the increase in ENA1 expression is
virtually identical in wild-type and msn2 msn4 cells at short time
frames(10min),butisfurtherenhancedbythelackofMsn2/Msn4
at 30 min. Interestingly, we observed previously a similar effect
by using a LacZ translational fusion of the ENA1 promoter and a
different msn2 msn4 mutant strain [19], although at that moment
it was not further characterized. Our observations suggest that
lack of Msn2/4 results in either activation of a positive regulatory
element for ENA1 expression or removal of a negative regulator.
It is well known that Nrg1 acts as a repressor of ENA1 expression
by directly binding to the gene promoter, thus participating in
alkaline pH signalling [18,49,50]. We observe in the present
paper that NRG1 levels decrease after 30 min of high pH stress
and that alkaline pH induction of ENA1 is not further increased
by mutation of msn2 msn4 in a nrg1 deletion background. This
suggests that the enhanced expression of the ATPase gene in the
msn2 msn4 mutant can be due to a decrease in the amount of
the Nrg1 repressor. In this regard, it must be noted that the
remarkable effect of lack of RIM101 in the expression of
the ATPase gene [18,19,28], is mediated fully by a rather small
change (2.8-fold) in NRG1 mRNA levels [18].
The results of the present study also suggest involvement of
the PKA pathway in high pH tolerance in way that would be
independent of the Msn2/Msn4 transcription factors. This is
based in the combination of tpk and msn2,4 mutations and in
the observation that hyperactivation of RAS2 in the msn2 msn4
mutant still increases high pH sensitivity (Figure 4B). A possible
explanation could be based in a co-operative role for the PKA and
calcineurin pathways in the adaptive response to high pH stress.
In this regard, it was reported that PKA can phosphorylate Crz1,
promoting its exit from the nucleus and thus opposing the action
of calcineurin [26]. Therefore inhibition of PKA may result in
further enhancement of calcineurin/Crz1-mediated responses. A
further step of complexity may exist in the interaction between
the calcineurin and the PKA pathways, as it was recently reported
that Crz1 may exert a destabilization effect on Msn2 levels upon
calcium treatment [51]. In this context, it is conceivable that
entry of Crz1 in the nucleus, following activation of calcineurin
by high pH may serve, in addition to activate calcineurin/Crz1-
responsive promoters, as a negative-feedback system to avoid
persistent activation of Msn2/Msn4-responsive genes. This
regulatory system may contribute to the transient Msn2/4-
dependent transcriptional effect observed in the present study.
AUTHOR CONTRIBUTION
Carlos Casado performed most of the experiments. Asier Gonz´ alez and Amparo Ruiz
performed cAMP measurements and constructed some strains, and contributed to the
design of the experiments. Maria Platara contributed with diverse lacZ reporter assays.
Joaqu´ ın Ari˜ no conceived the project, supervised its development and wrote the paper.
ACKNOWLEDGEMENTS
We thank Raquel Serrano and Antonio Casamayor for support. The excellent technical
assistance of Montserrat Robledo and Anna Vilalta is acknowledged. We thank Francisco
c ?The Authors Journal compilation c ?2011 Biochemical Society
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.

Page 10

532
C. Casado and others
Estruch, Martha Cyert, Jeanne Hirsch, Johan Thevelein, Christoph Sch¨ uller, Marian
Carlson, Renata Tisi and Enzo Martegani for constructs, strains and advice.
FUNDING
This work was supported by the Ministry of Science and Innovation, Spain and FEDER
[grant numbers BFU2008-04188-C03-01, GEN2006-27748-C2-1-E/SYS (SysMo) and
EUI2009-04147 (SysMo2) to (J.A.)]. J.A. was the recipient of an ‘Ajut 2009SGR-1091’
(Generalitat de Catalunya). C.C. was supported by a predoctoral fellowship from the
Spanish Ministry of Science and Technology.
REFERENCES
1 Thevelein, J. M. and de Winde, J. H. (1999) Novel sensing mechanisms and targets for
the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol.
Microbiol. 33, 904–918
2 Santangelo, G. M. (2006) Glucose signaling in Saccharomyces cerevisiae. Microbiol.
Mol. Biol. Rev. 70, 253–282
3 Gancedo, J. M. (2008) The early steps of glucose signalling in yeast. FEMS Microbiol.
Rev. 32, 673–704
4 Tamaki, H. (2007) Glucose-stimulated cAMP-protein kinase A pathway in yeast
Saccharomyces cerevisiae. J. Biosci. Bioeng. 104, 245–250
5 Smets, B., Ghillebert, R., De Snijder, P., Binda, M., Swinnen, E., De Virgilio, C. and
Winderickx, J. (2010) Life in the midst of scarcity: adaptations to nutrient availability in
Saccharomyces cerevisiae. Curr. Genet. 56, 1–32
6 Estruch, F. and Carlson, M. (1993) Two homologous zinc finger genes identified by
multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae.
Mol. Cell. Biol. 13, 3872–3881
7 Martinez-Pastor, M. T., Marchler, G., Schuller, C., Marchler-Bauer, A., Ruis, H. and
Estruch, F. (1996) The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p
are required for transcriptional induction through the stress response element (STRE).
EMBO J. 15, 2227–2235
8 Schmitt, A. P. and McEntee, K. (1996) Msn2p, a zinc finger DNA-binding protein, is the
transcriptional activator of the multistress response in Saccharomyces cerevisiae. Proc.
Natl. Acad. Sci. U.S.A. 93, 5777–5782
9 Mai, B. and Breeden, L. (1997) Xbp1, a stress-induced transcriptional repressor of the
Saccharomyces cerevisiae Swi4/Mbp1 family. Mol. Cell. Biol. 17, 6491–6501
10 Moskvina, E., Schuller, C., Maurer, C. T., Mager, W. H. and Ruis, H. (1998) A search in the
genome of Saccharomyces cerevisiae for genes regulated via stress response elements.
Yeast 14, 1041–1050
11 Smith, A., Ward, M. P. and Garrett, S. (1998) Yeast PKA represses Msn2p/Msn4p-
dependent gene expression to regulate growth, stress response and glycogen
accumulation. EMBO J. 17, 3556–3564
12 Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G.,
Botstein, D. and Brown, P. O. (2000) Genomic expression programs in the response of
yeast cells to environmental changes. Mol. Biol. Cell 11, 4241–4257
13 Gorner, W., Durchschlag, E., Martinez-Pastor, M. T., Estruch, F., Ammerer, G., Hamilton,
B., Ruis, H. and Schuller, C. (1998) Nuclear localization of the C2H2 zinc finger protein
Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 12, 586–597
14 Gorner, W., Durchschlag, E., Wolf, J., Brown, E. L., Ammerer, G., Ruis, H. and Schuller, C.
(2002) Acute glucose starvation activates the nuclear localization signal of a
stress-specific yeast transcription factor. EMBO J. 21, 135–144
15 Garreau, H., Hasan, R. N., Renault, G., Estruch, F., Boy-Marcotte, E. and Jacquet, M.
(2000) Hyperphosphorylation of Msn2p and Msn4p in response to heat shock and the
diauxic shift is inhibited by cAMP in Saccharomyces cerevisiae. Microbiology 146,
2113–2120
16 Arino, J. (2010) Integrative responses to high pH stress in S. cerevisiae. OMICS 14,
517–523
17 Lamb, T. M., Xu, W., Diamond, A. and Mitchell, A. P. (2001) Alkaline response genes of
Saccharomyces cerevisiae and their relationship to the RIM101 pathway. J. Biol. Chem.
276, 1850–1856
18 Lamb, T. M. and Mitchell, A. P. (2003) The transcription factor Rim101p governs ion
tolerance and cell differentiation by direct repression of the regulatory genes NRG1 and
SMP1 in Saccharomyces cerevisiae. Mol. Cell. Biol. 23, 677–686
19 Serrano, R., Ruiz, A., Bernal, D., Chambers, J. R. and Arino, J. (2002) The transcriptional
response to alkaline pH in Saccharomyces cerevisiae: evidence for calcium-mediated
signalling. Mol. Microbiol. 46, 1319–1333
20 Viladevall, L., Serrano, R., Ruiz, A., Domenech, G., Giraldo, J., Barcelo, A. and Arino, J.
(2004) Characterization of the calcium-mediated response to alkaline stress in
Saccharomyces cerevisiae. J. Biol. Chem. 279, 43614–43624
21 Ruiz, A., Serrano, R. and Arino, J. (2008) Direct regulation of genes involved in glucose
utilization by the calcium/calcineurin pathway. J. Biol. Chem. 283, 13923–13933
22 Serrano, R., Martin, H., Casamayor, A. and Arino, J. (2006) Signaling alkaline pH stress
in the yeast Saccharomyces cerevisiae through the Wsc1 cell surface sensor and the Slt2
MAPK pathway. J. Biol. Chem. 281, 39785–39795
23 Serrano, R., Bernal, D., Simon, E. and Arino, J. (2004) Copper and iron are the limiting
factors for growth of the yeast Saccharomyces cerevisiae in an alkaline environment.
J. Biol. Chem. 279, 19698–19704
24 Adams, A., Gottschling, D. E., Kaiser, C. A. and Stearns, T. (1997) Methods in Yeast
Genetics, Cold Spring Harbor Laboratory Press, New York
25 Winzeler, E. A., Shoemaker, D. D., Astromoff, A., Liang, H., Anderson, K., Andre, B.,
Bangham, R., Benito, R., Boeke, J. D., Bussey, H. et al. (1999) Functional characterization
oftheS.cerevisiae genomebygenedeletionandparallelanalysis.Science285,901–906
26 Kafadar, K. A. and Cyert, M. S. (2004) Integration of stress responses: modulation of
calcineurin signaling in Saccharomyces cerevisiae by protein kinase A. Eukaryot. Cell 3,
1147–1153
27 Ma, P., Wera, S., Van, D. P. and Thevelein, J. M. (1999) The PDE1-encoded low-affinity
phosphodiesterase in the yeast Saccharomyces cerevisiae has a specific function in
controlling agonist-induced cAMP signaling. Mol. Biol. Cell 10, 91–104
28 Platara, M., Ruiz, A., Serrano, R., Palomino, A., Moreno, F. and Arino, J. (2006) The
transcriptional response of the yeast Na+-ATPase ENA1 gene to alkaline stress involves
three main signaling pathways. J. Biol. Chem. 281, 36632–36642
29 Gonzalez, A., Ruiz, A., Casamayor, A. and Arino, J. (2009) Normal function of the yeast
TOR pathway requires the type 2C protein phosphatase Ptc1. Mol. Cell Biol. 29,
2876–2888
30 Myers, A. M., Tzagoloff, A., Kinney, D. M. and Lusty, C. J. (1986) Yeast shuttle and
integrative vectors with multiple cloning sites suitable for construction of lacZ fusions.
Gene 45, 299–310
31 Xue, Y., Batlle, M. and Hirsch, J. P. (1998) GPR1 encodes a putative G protein-coupled
receptor that associates with the Gpa2p Galpha subunit and functions in a
Ras-independent pathway. EMBO J. 17, 1996–2007
32 Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D., Cameron, S., Broach, J.,
Matsumoto, K. and Wigler, M. (1985) In yeast, RAS proteins are controlling elements of
adenylate cyclase. Cell 40, 27–36
33 Stathopoulos, A. M. and Cyert, M. S. (1997) Calcineurin acts through the
CRZ1/TCN1-encoded transcription factor to regulate gene expression in yeast. Genes
Dev. 11, 3432–3444
34 Alepuz, P. M., Cunningham, K. W. and Estruch, F. (1997) Glucose repression affects ion
homeostasis in yeast through the regulation of the stress-activated ENA1 gene. Mol.
Microbiol. 26, 91–98
35 Cunningham, K. W. and Fink, G. R. (1996) Calcineurin inhibits VCX1-dependent
H+/Ca2+exchange and induces Ca2+ATPases in Saccharomyces cerevisiae. Mol.
Cell. Biol. 16, 2226–2237
36 Marquez, J. A. and Serrano, R. (1996) Multiple transduction pathways regulate the
sodium-extrusion gene PMR2/ENA1 during salt stress in yeast. FEBS Lett. 382, 89–92
37 Reynolds, A., Lundblad, V., Dorris, D. and Keaveney, M. (1997) Yeast vectors and assays
for expression of cloned genes. In Current Protocols in Molecular Biology (Ausubel, F.
M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K.
eds), pp. 13.6.1–13.6.6, John Wiley & Sons, New York
38 Alberola, T. M., Garcia-Martinez, J., Antunez, O., Viladevall, L., Barcelo, A., Arino, J. and
Perez-Ortin, J. E. (2004) A new set of DNA macrochips for the yeast Saccharomyces
cerevisiae: features and uses. Int. Microbiol. 7, 199–206
39 Herrero, J., Al Shahrour, F., Diaz-Uriarte, R., Mateos, A., Vaquerizas, J. M., Santoyo, J.
and Dopazo, J. (2003) GEPAS: a web-based resource for microarray gene expression data
analysis. Nucleic Acids Res. 31, 3461–3467
40 Jacquet, M., Renault, G., Lallet, S., De, M. J. and Goldbeter, A. (2003) Oscillatory
nucleocytoplasmic shuttling of the general stress response transcriptional activators
Msn2 and Msn4 in Saccharomyces cerevisiae. J. Cell Biol. 161, 497–505
41 Gonzalez, A., Larroy, C., Biosca, J. A. and Arino, J. (2008) Use of the TRP1 auxotrophic
marker for gene disruption and phenotypic analysis in yeast: a note of warning. FEMS
Yeast Res. 8, 2–5
42 Colombo, S., Ma, P., Cauwenberg, L., Winderickx, J., Crauwels, M., Teunissen, A.,
Nauwelaers, D., de Winde, J. H., Gorwa, M. F., Colavizza, D. and Thevelein, J. M. (1998)
Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular
acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae. EMBO J.
17, 3326–3341
43 De Wever, V., Reiter, W., Ballarini, A., Ammerer, G. and Brocard, C. (2005) A dual role for
PP1 in shaping the Msn2-dependent transcriptional response to glucose starvation.
EMBO J. 24, 4115–4123
44 Mayordomo, I., Estruch, F. and Sanz, P. (2002) Convergence of the target of rapamycin
and the Snf1 protein kinase pathways in the regulation of the subcellular localization of
Msn2, a transcriptional activator of STRE (Stress Response Element)-regulated genes.
J. Biol. Chem. 277, 35650–35656
c ?The Authors Journal compilation c ?2011 Biochemical Society
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2011 The Author(s)

Page 11

PKA pathway in high pH response
533
45 Beck, T. and Hall, M. N. (1999) The TOR signalling pathway controls nuclear localization
of nutrient-regulated transcription factors. Nature 402, 689–692
46 Hong, S. P. and Carlson, M. (2007) Regulation of snf1 protein kinase in response to
environmental stress. J. Biol. Chem. 282, 16838–16845
47 Chen, J. C. and Powers, T. (2006) Coordinate regulation of multiple and distinct
biosyntheticpathwaysbyTORandPKAkinasesinS.cerevisiae.Curr.Genet.49,281–293
48 Ruiz, A. and Arino, J. (2007) Function and regulation of the Saccharomyces cerevisiae
ENA sodium ATPase system. Eukaryot. Cell 6, 2175–2183
49 Vyas, V. K., Berkey, C. D., Miyao, T. and Carlson, M. (2005) Repressors Nrg1 and Nrg2
regulate a set of stress-responsive genes in Saccharomyces cerevisiae. Eukaryot. Cell 4,
1882–1891
50 Vyas, V. K., Kuchin, S. and Carlson, M. (2001) Interaction of the repressors Nrg1 and
Nrg2 with the Snf1 protein kinase in Saccharomyces cerevisiae. Genetics 158,
563–572
51 Takatsume, Y., Ohdate, T., Maeta, K., Nomura, W., Izawa, S. and Inoue, Y. (2010)
Calcineurin/Crz1 destabilizes Msn2 and Msn4 in the nucleus in response to Ca2+in
Saccharomyces cerevisiae. Biochem. J. 427, 275–287
52 Thomas, B. J. and Rothstein, R. (1989) Elevated recombination rates in transcriptionally
active DNA. Cell 56, 619–630
53 Belotti, F., Tisi, R. and Martegani, E. (2006) The N-terminal region of the Saccharomyces
cerevisiae RasGEF Cdc25 is required for nutrient-dependent cell-size regulation.
Microbiology 152, 1231–1242
Received 4 April 2010/11 July 2011; accepted 13 July 2011
Published as BJ Immediate Publication 13 July 2011, doi:10.1042/BJ20110607
c ?The Authors Journal compilation c ?2011 Biochemical Society
© 2011 The Author(s)
The author(s) has paid for this article to be freely available under the terms of the Creative Commons Attribution Non-Commercial Licence (http://creativecommons.org/licenses/by-nc/2.5/)
which permits unrestricted non-commercial use, distribution and reproduction in any medium, provided the original work is properly cited.