Comparative analysis of the testis and ovary transcriptomes in zebrafish by combining experimental and computational tools.

Abstract

Studies on the zebrafish model have contributed to our understanding of several important developmental processes, especially those that can be easily studied in the embryo. However, our knowledge on late events such as gonad differentiation in the zebrafish is still limited. Here we provide an analysis on the gene sets expressed in the adult zebrafish testis and ovary in an attempt to identify genes with potential role in (zebra)fish gonad development and function. We produced 10,533 expressed sequence tags (ESTs) from zebrafish testis or ovary and downloaded an additional 23,642 gonad-derived sequences from the zebrafish EST database. We clustered these sequences together with over 13,000 kidney-derived zebrafish ESTs to study partial transcriptomes for these three organs. We searched for genes with gonad-specific expression by screening macroarrays containing at least 2600 unique cDNA inserts with testis-, ovary- and kidney-derived cDNA probes. Clones hybridizing to only one of the two gonad probes were selected, and subsequently screened with computational tools to identify 72 genes with potentially testis-specific and 97 genes with potentially ovary-specific expression, respectively. PCR-amplification confirmed gonad-specificity for 21 of the 45 clones tested (all without known function). Our study, which involves over 47,000 EST sequences and specialized cDNA arrays, is the first analysis of adult organ transcriptomes of zebrafish at such a scale. The study of genes expressed in adult zebrafish testis and ovary will provide useful information on regulation of gene expression in teleost gonads and might also contribute to our understanding of the development and differentiation of reproductive organs in vertebrates.

Full text

Page 1

Comparative and Functional Genomics
Comp Funct Genom 2004; 5: 403–418.
Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.418
Research Article
Comparative analysis of the testis and ovary
transcriptomes in zebrafish by combining
experimental and computational tools
Yang Li1#, Jer Ming Chia2,3#, Richard Bartfai1,4, Alan Christoffels3, Gen Hua Yue1, Ke Ding1, Mei Yin Ho1,
James A. Hill1, Elia Stupka5* and Laszlo Orban1,4*
1Reproductive Genomics Group, Temasek Lifesciences Laboratory, Singapore
2Genome Institute of Singapore, Singapore
3Institute of Molecular and Cell Biology, Singapore
4Department of Biological Sciences, National University of Singapore, Singapore
5Computational Biology, Temasek Lifesciences Laboratory, Singapore
*Correspondence to:
Laszlo Orban, Reproductive
Genomics Group, Temasek
Lifesciences Laboratory,
Singapore.
E-mail: laszlo@tll.org.sg
Elia Stupka, Computational
Biology Group, Temasek
Lifesciences Laboratory,
Singapore. E-mail: elia@tll.org.sg.
#These two authors contributed
equally to the results published in
the manuscript..
Received: 4 May 2004
Revised: 25 June 2004
Accepted: 28 June 2004
Abstract
Studies on the zebrafish model have contributed to our understanding of several
important developmental processes, especially those that can be easily studied in the
embryo. However, our knowledge on late events such as gonad differentiation in the
zebrafish is still limited. Here we provide an analysis on the gene sets expressed in
the adult zebrafish testis and ovary in an attempt to identify genes with potential
role in (zebra)fish gonad development and function. We produced 10533 expressed
sequence tags (ESTs) from zebrafish testis or ovary and downloaded an additional
23642 gonad-derived sequences from the zebrafish EST database. We clustered these
sequences together with over 13000 kidney-derived zebrafish ESTs to study partial
transcriptomes for these three organs. We searched for genes with gonad-specific
expression by screening macroarrays containing at least 2600 unique cDNA inserts
with testis-, ovary- and kidney-derived cDNA probes. Clones hybridizing to only one
of the two gonad probes were selected, and subsequently screened with computational
tools to identify 72 genes with potentially testis-specific and 97 genes with potentially
ovary-specific expression, respectively. PCR-amplification confirmed gonad-specificity
for 21 of the 45 clones tested (all without known function). Our study, which involves
over 47000 EST sequences and specialized cDNA arrays, is the first analysis of adult
organ transcriptomes of zebrafish at such a scale. The study of genes expressed in
adult zebrafish testis and ovary will provide useful information on regulation of gene
expression in teleost gonads and might also contribute to our understanding of the
development and differentiation of reproductive organs in vertebrates. Copyright 
2004 John Wiley & Sons, Ltd.
Keywords:gonad; reproduction; Danio rerio; fish; teleost; EST; cDNA; macroarray
Supplementary material for this article can be found at http://www.interscience.wiley.
com/jpages/1531-6912/suppmat
Introduction
During the past 30 years zebrafish (Danio rerio)
has become one of the major vertebrate models
for molecular genetics and developmental biology.
The start of the Zebrafish Genome Project at
the Sanger Center finally catapulted the species
onto the platform of vertebrate genomics. The
tool-set of zebrafish genomics — which includes
an integrated genetic map based on four meiotic
Copyright  2004 John Wiley & Sons, Ltd.

Page 2

404Y. Li et al.
panels (e.g. Knapik et al., 1998; Woods et al.,
2000) and two radiation hybrid panels (Geisler
et al., 1999; Hukriede et al., 2001) among other
tools — has been complemented with a genome
assembly (www.ensembl.org/Danio rerio), easing
the task of those trying to decipher gene functions
in zebrafish.
The analysis of expressed zebrafish sequences is
still in the expansion phase. At the time of our
‘data freeze’ (at the end of January 2003, when
the data were compared with those in GenBank),
the number of zebrafish EST sequences in the
dbEST database has exceeded 300000 and sev-
eral cDNA/oligonucleotide arrays (e.g. Clark et al.,
2001; Ton et al., 2002) have become available dur-
ing the past couple of years. On the other hand, a
limited amount of data is available at present on the
tissue-, organ- or developmental stage-specific tran-
scriptomes of zebrafish. According to our knowl-
edge, there are only three published reports on
organ-specific EST data sets from zebrafish in
the peer-reviewed literature: from embryonic heart
(5102 ESTs; Ton et al., 2000), from embryonic
inner ear (18000 ESTs; Coimbra et al., 2002), and
from adult gonads (1025 ESTs; Zeng and Gong,
2002).
Our knowledge about the genetic regulation of
zebrafish reproduction is scarce. Sex chromosomes
could not be identified in the zebrafish karyotypes
(Pijnacker and Ferwerda, 1995; Sola and Gornung,
2001) and the molecular regulation of gonad dif-
ferentiation is far from being understood. On the
basis of a handful of studies the process seems to
be complex, involving intense rearrangement from
an ovary-like organ into the testis in males (Maack
and Segner, 2003; Takahashi, 1977; Uchida et al.,
2002). Our primary interest is to understand the
genetic regulation of the gonad differentiation pro-
cess in zebrafish by using the tools of functional
genomics.
Here we report on the analysis of adult zebrafish
gonad transcriptomes and their comparison to that
of the kidney, by computational and experimental
tools in lieu of identifying genes potentially useful
for the analysis of (zebra)fish gonad development
and differentiation (see Figure 1 for the flowchart
Figure 1. A flow chart depicting the order and connection of the experimental and computational procedures used
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 3

Gonad transcriptomes in zebrafish405
of experimental and computational procedures used
throughout the study).
Materials and methods
Fish stocks and sample collection
Zebrafish individuals from the AB strain and from
a local strain, called Toh, were kept at our fish facil-
ity at ambient temperature and light cycle (12/12 h)
in AHAB (Aquatic Habitats) recirculation systems.
Sexually mature individuals of at least 3 months of
age were anaesthetized in 0.04% 3-aminobenzoic
acid ethyl-ester methanesulphonate (Sigma). The
gonad (with the gonadal duct) and kidney were col-
lected and transferred into ice-cold Trizol reagent
(Gibco-BRL) and stored at −80◦C separately. For
the generation of testis and kidney libraries, sam-
ples were pooled from 40–60 individuals, whereas
ovary samples were combined from two to four
individuals. Probes for the macroarray hybridiza-
tion were generated from RNA isolated from testis
and ovary collected from six different individuals,
respectively, whereas the two kidney probes were
pooled from two groups of six individuals contain-
ing both sexes.
As all of the gonad samples were isolated from
fully mature individuals; they were expected to
represent all germ cell types (i.e. from oogonia
to fully mature oocyte in the ovary and from
spermatogonia to spermatozoa in the testis) in
addition to the somatic cells representative of the
gonad type.
RNA isolation and cDNA synthesis
Total RNA was isolated from the dissected tis-
sues by Trizol (Gibco BRL) reagent according to
the manufacturer’s recommendation. Samples were
treated with DNase (10 U in 100 µl volume; Roche)
for 30 min at 37◦C, and the RNA was recovered
by isopropyl-alcohol precipitation. The poly(A)+
RNA fraction was isolated using oligo-dT cellulose
chromatography (Stratagene). The quantity and
integrity of the RNA was assessed by spectropho-
tometry and agarose gel electrophoresis, respec-
tively. cDNA was synthesized from total RNA
of Toh strain using SMART PCR cDNA synthe-
sis kit (Clontech) according to the manufacturer’s
protocols.
Construction of subtracted cDNA libraries
Three sets of subtractive hybridizations were per-
formed: adult ovary (driver) from testis (tester),
adult liver (d) from testis (t), and adult testis
(d) from ovary (t). A PCR-Select cDNA subtrac-
tion kit (Clontech) was used to enrich for tissue-
specific fragments from the SMART cDNA tem-
plate (from Toh strain), according to the recom-
mendations of the manufacturer. The selectively
amplified cDNA fragments (in average 400–800
bp in length) from testis and ovary were ligated
into pT-Advantage (Clontech) or to pGEM-T-Easy
(Promega) cloning vector in order to generate sub-
tracted libraries.
Construction of full-length and normalized
cDNA libraries
Full-length cDNA was synthesized from adult
ovary and testis poly(A)+RNA (AB strain), respec-
tively, with ZAP-cDNA Synthesis Kit (Strata-
gene), according to the manufacturer’s protocols.
Size-fractionated cDNAs (flanked by an EcoRI
site at the 5?end and an XhoI site at 3?ends)
were directionally cloned into Uni-ZAP XR vec-
tor and packaged using Gigapack Gold packaging
extracts (Stratagene). The primary packaging mix
was titrated and amplified to establish stable library
stocks.
Phagemid particles were excised from the Uni-
ZAP vector using ExAssist helper phage and
SOLR strain according to the protocols (Strata-
gene). Excised pBluescript phagemids were used to
infect Escherichia coli XL1-Blue cells and selected
by ampicillin resistance and blue-white colour.
White clones with cDNA inserts were randomly
picked and grown overnight in LB-ampicillin cul-
ture.
Normalization of adult testis cDNA library
was done by using a reassociation kinetics-based
approach (Bonaldo et al., 1996) with some modifi-
cations. Purified covalently closed single-stranded
library DNA was produced in vitro by using
GENETRAPPER cDNA Positive Selection Sys-
tem (GibcoBRL) according to the manufacturer’s
instructions. The resulting single-stranded circular
DNA was purified from the remaining double-
stranded plasmid by hydroxyapatite (HAP) chro-
matography (Bonaldo et al., 1996).
PCR amplification of cDNA inserts was per-
formed using the Expand High Fidelity PCR
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 4

406Y. Li et al.
System (Roche) according to the manufacturer’s
instructions; 1 µl (2.5–5.0 ng) DNA template (a
mixture of double-stranded plasmids from a cDNA
library) was mixed with 2 µl dNTP stock (200 µM),
5 µl 20 µM solution of KS primer (5?-TCGAGGTC-
GACGGTATC-3?), and 5 µl 20 µM SK primer (5?-
CGCTCTAGAACTAGTGGATC-3?), 10 µl 10×
Expand High Fidelity buffer, 0.75 µl Expand High
Fidelity enzyme mix (2.6 units) and 76.25 µl
water. The PCR mix was then overlaid with
50 µl mineral oil and subjected to the follow-
ing amplification cycle conditions in a PTC 100
Thermocycler (MJ Research): 7 min while ramp-
ing up from room temperature to 94◦C; 20
cycles of 1 min at 94◦C, 2 min at 55◦C, and
3 min at 72◦C; and finally 7 min at 72◦C. PCR-
amplified fragments were isolated by GFX columns
(Amersham-Pharmacia) and dissolved in 5 µl TE.
Then 3 µl (ca. 500 ng) PCR product was mixed
with 7 µl (50 ng) library DNA (single-stranded cir-
cles prepared in vitro as described above), 15 µl
deionized formamide, 1 µl (10 µg) 5?blocking
oligo (5?-GAGCTCCACCGCGGTGGCGGCCGC-
TCTAGAACTAGTGGATCCCCCGGGCTGCA
GGTTAACGGCACGAGG-3?) and 1 µl (10 µg) 3?
blocking oligo (5?-GTAATACGACTCACTATA-
GGGCGAATTGGGTACCGGGCCCCCCCTC-
GA-3?). This mixture was heated at 80◦C for 3 min
under 10 µl mineral oil. Then 3 µl 10× buffer A
(1.2 M NaCl, 0.1 M Tris pH 8.0 and 50 mM EDTA)
were added, the hybridization was performed at
30◦C for 24 h. The remaining single-stranded cir-
cles were purified by HAP chromatography as
described above, converted to double-strands using
Sequenase version 2.0 (USB), and transformed into
XL10-Gold competent cell (Stratagene).
Generation of ORESTES libraries
ORESTES libraries were generated according to
Neto et al. (1997, 2000). mRNA isolated from
adult zebrafish testis was reverse-transcribed using
oligonucleotide primers designed for amplified
fragment length polymorphism (AFLP) analysis
(Vos et al., 1995) or for amplification of specific
genes from Arabidopsis, yeast or rice. The ampli-
fication mastermix contained 5 µl 10× PCR buffer
(Clontech) with 15 mM MgCl2, 2 µl dNTP stock
(10 mM each), 2 µl primer used for reverse tran-
scription (10 µM), 1 U Advantage cDNA poly-
merase (Clontech), and 1 µl first strand cDNA.
PCR conditions were: an initial cycle of 5 min at
94◦C, 2 min at 37◦C, 2 min at 72◦C followed by
35 cycles of 45 s at 94◦C, 1 min at 45◦C, and
1.5 min at 72◦C. The amplified product (10 µl) was
checked on 2% agarose gel. PCR products with a
single, predominant band reflecting the amplifica-
tion of a highly abundant transcript were not pro-
cessed further. The remaining amplification prod-
ucts with a smear or multiple bands (>500 bp)
were then cloned into pGEM-T vector (Promega)
and transformed into XL-10 Gold competent cell.
Amplification and partial sequencing of cDNA
inserts
White colonies were randomly picked and grown
overnight in deep (2 ml) 96-well plates (Axygen)
containing 1 ml LB-ampicillin medium; 100 µl
O/N culture was mixed with an equal volume of
glycerol and stored at −80◦C in 96-well tissue-
culture plates. O/N culture (1 µl) was used directly
for colony PCR reactions (25 µl final volume)
with M13 forward (–20) and M13 reverse primers.
PCR product (5 µl) was used for alkaline phos-
phatase and exonuclease I treatment: 0.2 µl 10×
SAP buffer (USB) and 2 µl enzyme mix [con-
taining 0.25 U shrimp alkaline phosphatase (USB)
and 0.1 U exonuclease I (both from USB) were
added] and 0.2 µl 10× SAP buffer were added
and the samples were incubated at 37◦C for
30 min in order to eliminate PCR primers. The
reaction mixture was then incubated at 80◦C for
15 min to inactivate the enzymes and then diluted
with distilled water to 20 µl; 3 µl were used for
cycle sequencing using BigDye Terminator v3.0
kit (Applied Biosystems) and M13 reverse primer.
(In the directionally cloned full-length libraries,
5?ends were sequenced. The orientation of the
rest of the clones — subtracted and ORESTES
libraries — was random.) The conditions for cycle
sequencing were as follows: 50◦C for 1 min and
94◦C for 5 min, followed by 30 cycles of amplifi-
cation (94◦C for 30 s, 50◦C for 15 s and 60◦C for
4 min) with 1◦C/sec ramping. Reaction products
were precipitated by ethanol, dissolved in 20 µl dis-
tilled water and separated on an ABI 3700 capillary
electrophoresis machine (Applied Biosystems).
Sequence analysis and EST clustering
Sequences generated in our lab were cleaned from
vector arms and adapters by using the Sequencher
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 5

Gonad transcriptomes in zebrafish407
4.05 software (Gene Codes Corp.) in manual mode.
Zebrafish ESTs derived from adult testis, ovary
and kidney cDNA libraries were downloaded from
the dbEST division of GenBank (dataset from 11
September 2002) using the batch Entrez retrieval
system (for details on the origin of clones, see
Table A1 in the Supplementary Material). The
public ESTs were combined with gonad ESTs
generated in our laboratory (the GenBank IDs
are in the following range: CO349711–CO360-
835) and the whole dataset was subjected to a
thorough cleaning procedure, consisting of trim-
ming of vector arms, masking with RepeatMasker
(http://www.repeatmasker.org) and removal of
short (<100 bp) as well as low-quality (>3% N)
sequences.
EST clustering and assembly was carried out
using the STACKPACKclustering tool (Christof-
fels et al., 2001; Miller et al., 1999) on a HP-
Compaq Alpha ES40 architecture. The d2-clus-
tering step was executed with a word size of 6,
a window size and minimum sequence size of 100
bases and a similarity threshold of 96%.
The combined gonad and kidney datasets were
first clustered separately to check for presence of
chimeras. The 18 biggest clusters were screened for
chimeric sequences by searching with the consen-
sus sequences in GenBank using BLAST (Altschul
et al., 1990, 1997) in two repeated steps and
removing those for which the two ends clearly
matched two different genes. The 20 biggest clus-
ters of the kidney set were treated the same
way. Altogether, 226 suspected chimeric ESTs
were identified and removed (see Table A2 in the
Supplementary Material for the list of GenBank-
derived clones suspected to be chimeric).
The resulting final dataset was re-clustered as
described above and used to construct a partial tran-
scriptional profile for the testis, ovary and kidney of
adult zebrafish. The proportion of ORF-containing
sequences was determined by ESTScan (Iseli et al.,
1999) in both the clusters and singletons, respec-
tively. Using the predicted ORFs, BLAST searches
were carried out to identify putative homologues in
Swissprot (ftp.expasy.org), TrEMBL (Boeckmann
et al., 2003) and NCBI’s non-redundant protein
database (http://www.ncbi.nlm.nih.gov/BLAST/
blast databases.shtml). For functional analysis the
translated sequences obtained from ESTScan were
annotated for protein domains and functional sites
by matching them against the PFAM, PROSITE
and PRINTS databases (Attwood et al., 2003; Bate-
man et al., 2002; Sigrist et al., 2002). The anno-
tated domains were assigned to Gene Ontology
(GO) molecular function categories using map-
pings provided by the GO Consortium (Ashburner
et al., 2000).
For the phylogenetic analysis of ZP genes, the
sequences were first aligned using CLUSTALW
(Thompson et al., 1994) and the trees constructed
using the neighbour-joining method, using maxi-
mum likelihood distances (PHYLIP package; http:/
/evolution.genetics.washington.edu/phylip.html).
Bootstrapping was done using 1000 pseudosamples
of the dataset.
Generation and use of ‘Gonad UniClone’
macroarrays
In order to reduce redundancy, we re-arranged our
clone set. Clones representing 1419 clusters and
1342 singletons have been selected from full-length
or normalized libraries (’Gonad UniClone’ set).
Thirty 96-well plates were filled with colony PCR-
amplified inserts from the selected clones.
Two macroarrays were produced by replicat-
ing this ‘Gonad UniClone’ set onto Hybond-N
(Amersham-Pharmacia) nylon membranes in 4 × 4
arrangements, using a Biomek 2000 Workstation
(Beckman). Each membrane contained empty vec-
tors, and clones with viral and plant-derived inserts
(negative controls) as well as cDNA fragments
from 12 zebrafish housekeeping genes (positive
controls). In the upper right corner (A1) of each and
all the four corners of the first, fourth, thirteenth,
and sixteenth plates the PCR product was replaced
with 5 pg/µl DIG-labelled control DNA (Roche) to
help orientation on the arrays after detection. DNA
was then denatured (10 min, 1.5 M NaCl, 0.5 M
NaOH), renatured (10 min, 1.5 M NaCl, 0.5 M Tris,
pH 8.0) and linked to the membrane using UV light
(120 mJ on both sides).
Testis-, ovary- and kidney-derived cDNA probes
(see section on ‘Fish stocks and sample collection’
for detailed origin of probes) were generated by
replacing half of the dNTP in the amplification step
of the SMART cDNA synthesis with DIG-labelling
dNTP mix (Roche). Excess of DIG-labelled dUTP
was removed using GFX columns (Amersham-
Pharmacia). Air-dried ‘Gonad UniClone’ macroar-
rays were pre-hybridized in 5 ml EasyHyb solu-
tion (Roche) at 50◦C for 2–3 h in a SI 20H
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 6

408Y. Li et al.
hybridization oven (Stuart Scientific). The solu-
tion was replaced with 5 ml fresh EasyHyb solu-
tion containing 0.3–0.6 µl probe (depending on
the relative strength of the probe determined in
a titration experiment) and hybridization was per-
formed at the conditions listed above. Washing
of membranes was conducted at 68◦C, 2 × 5 min
with 40 ml buffer #1 (2× SSC, 0.1% SDS) and
twice with 40 ml buffer #5 (0.05× SSC, 0.1%
SDS) for 15 min each. Non-isotopic detection of
the hybridized probe was conducted according
to the Roche manual. Chemiluminescent signal
(from dephosphorylated CPD-Star substrate) was
recorded on BioMax ML film (Kodak) by taking
multiple exposures for every membrane.
The best images were captured with FluorS-
Multiimager (BioRad) and signal/background int-
ensities were quantified using ImaGene 4.0 (Bio-
Discovery) software. Data was further processed
in Microsoft Excel. After defining relative signal
intensity for each spot on the separate membranes
(signal median minus local background median),
values were normalized across membranes based
on the values measured from housekeeping genes.
(Mean signal intensity for the 12 × 3 positive
spots have been defined for each membrane, and
also across membranes. Each intensity value from
a given membrane was then multiplied by the
quotient of the membrane average and the mean
of the membrane averages.) A gene was con-
sidered to be expressed in a given tissue if the
median of normalized values from six indepen-
dent hybridizations exceeded the mean value of the
negative controls plus twice their standard devia-
tion (threshold = mean + 2 × SD of the negative
controls). The expression of a clone was labelled
as potentially tissue-specific when: (a) the median
value for a clone in one tissue was higher than
threshold, but from the other two tissues fell below
that; and (b) there was a significant difference
between the mean of the values from the given and
the two other tissues (assessed by Student’s t-test).
Confirming the specificity of expression by PCR
In order to validate the tissue-specific genes
obtained from the combinatorial ‘wet-and-dry’
approach, 45 such clones were selected and their
expression pattern in adult zebrafish tissues were
analysed. ‘Smart cDNA’ samples (Clontech) were
generated from adult zebrafish testis, ovary, kid-
ney and rest of body. The expression pattern of the
selected genes was re-tested by PCR-amplification
using specific primers designed (Primer Select,
DNAStar) to their sequences and using the ‘Smart
cDNAs’ as templates. The reaction mixtures con-
tained the following in 12.5 µl total volume:
1.25 µl 10× reaction buffer, 50 µM dNTP mix, 5
pmol forward and reverse primers (see Table A6 in
the Supplementary Material for full list of primers
used), 10–90 ng template and 0.25 U Advantage
cDNA polymerase (Clontech). As a positive con-
trol, 1 µl PCR-amplified insert from the appropriate
cDNA clone was used for every primer pair. The
thermal cycle profile consisted of an initial denat-
uration at 95◦C for 1 min, followed by 26 cycles
of 94◦C for 10 s, annealing for 15 s and 68◦C for
1 min, and a final extension step of 68◦C for 3 min.
6 µl PCR product was separated on 2% agarose gel.
Results
Libraries and sequencing
We have generated four different kinds of cDNA
libraries from adult zebrafish gonads for the isola-
tion of testis- or ovary-derived clones: three sub-
tracted libraries, two non-normalized and two nor-
malized full-length libraries as well as 27 ORF
expressed sequence tag (ORESTES) mini-libraries
(see Table A1 in the Supplementary Material for
complete list of sources used). Over 14000 clones
were picked randomly, their insert was amplified by
colony PCR and end-sequenced from one direction
(5?or random, depending on the library of origin).
The resulting sequences were trimmed, masked
and cleaned by removing low-quality/short reads as
well as repeat sequences, resulting in 7674 testis-
derived and 2859 ovary-derived EST sequences.
We have also downloaded from the dbEST
database nearly 10000 testis-derived, over 15000
ovary-derived and over 14000 kidney-derived
zebrafish EST sequences (Table A1 in the Sup-
plementary Material). (Kidney was chosen as a
somatic comparison, since clone sets in GenBank
for all other major organs of adult zebrafish either
contained a limited number of clones or origi-
nated from mixed sources.) Following the removal
of 226 suspected chimeric EST sequences (see
Table A2 in the Supplementary Material for sus-
pected chimeric ESTs among public sequences), we
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 7

Gonad transcriptomes in zebrafish409
merged the public ESTs with the testis and ovary
clone sets derived from our libraries to form a com-
bined dataset with a total of 47593 ESTs. This
final dataset contained 16479 testis-derived ESTs,
17696 from the ovary and 13418 from the kidney
(Table 1).
EST clustering
Gene indices — built by grouping together ESTs
derived from the same transcript — provided us
a picture on the unique and common transcripts
expressed in the three organs. After masking the
low complexity regions and repetitive elements
in the sequences, we clustered the dataset. The
consensus sequences for each of the clusters were
then classified according to the tissue origin of their
component ESTs. To account for the possibility of
low-level contamination from other organs during
the isolation process, clusters with at least 95%
ESTs originating from a single organ were still
considered as putative organ-specific (‘5% rule’).
A total of 402 clusters (incorporating 7569 ESTs)
contained sequences from all three organs, 2132
clusters (14879 ESTs) from two organs, whereas
the remaining 3673 clusters (14419 ESTs) from
only one (Figure 2). The proportion of poten-
tially organ-specific ESTs was similar for the three
organs tested: testis, 19.4% of all ESTs (5038
unique sequences); ovary, 17.6% (3939); and kid-
ney, 15.8% (5422).
All ‘non-GenBank’ singletons derived from our
study and those clusters without a single GenBank-
derived EST were BLAST-searched against the
proteins and ESTs present in GenBank at the time
of the ‘data-freeze’ (January 2003). Of the 2845
singletons that were of acceptable quality, 1068
had no hits, whereas 125 of the 477 clusters did not
find a similar sequence in GenBank. Therefore, we
Table 1. Generation of the final EST dataset from adult
zebrafish testis, ovary and kidney
Testis OvaryKidney Total
Sequences
Removed∗
Chimeric
Final EST set
17726
1204
18382
528
158
17696
14034
591
50142
2323
226
47593
43 25
1647913418
∗Low quality sequences, repeat sequences or <100 bp follow-
ing masking.
Figure 2. Distribution of clusters and singletons according
to the origin of the EST sequences. Following the removal
of suspected chimeric sequences, the resulting final EST
dataset containing sequences both from GenBank and our
laboratory was subjected to a thorough cleaning procedure.
EST clustering and assembly was carried out using the
STACKPACKclustering tool, producing a transcriptional
profile for the testis, ovary and kidney of adult zebrafish.
The clusters were classified according to the tissue origin
of their component ESTs. To account for the possibility
of low-level contamination from other organs during the
isolation process, clusters with at least 95% ESTs originating
from a single organ were still considered as putative
organ-specific (‘5% rule’). See Materials and methods for
additional details
have added novel sequence information on 1193
zebrafish transcripts to the public database.
Sequence analysis
Single pass ESTs are error-prone and often con-
tain artifacts such as genomic DNA contamina-
tion (Hillier et al., 1996). We used the combina-
tion of ESTScan (Iseli et al., 1999) and BLAST
(Altschul et al., 1990, 1997) to evaluate the gene
content of our sequences (see Materials and meth-
ods for details). About 62% of the total num-
ber of sequences — from all three organs com-
bined — had a significant sequence similarity with
a known gene or protein (with an e-value of less
than 1e−5), and the vast majority of these contained
a predicted ORF (Table 2).
Among the unknown genes (no significant sequ-
ence similarity to any of the databases) the per-
centage of ORF-containing sequences was higher
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 8

410Y. Li et al.
Table 2. Analysis of sequences (clusters and singletons) in
the final dataset by BLAST and ESTScan
Testis OvaryKidney
Total
ORF-containing
Known∗
ORF-containing
Unknown∗∗
ORF-containing
6788
(83.8%)
4078
(98.1%)
2710
(62.4%)
6001
(85.8%)
3991
(98.1%)
2010
(61.4%)
7080
(78.7%)
4187
(97.1%)
2893
(52.0%)
∗Known: singletons and clusters that show a significant BLAST match
(at least an e-value of 1e−5) to Swissprot, TrEMBL, NCBI’s non-
redundant protein or NCBI’s non-redundant nucleotide data set.
∗∗Unknown: those without a significant BLAST match
in the testis (62.4%) and ovary (61.4%) than in the
kidney (52.0%) (Table 2).
The most abundant ESTs from adult zebrafish
testis, ovary and kidney
We analysed the distribution of contributing ESTs
between testis, ovary and kidney in the 100 biggest
clusters of the final dataset (Table A3 in the Sup-
plementary Material). The majority of these com-
prised of ESTs from at least two organs and showed
similarity to known genes, e.g. elongation factor
1α, β-actin or β-tubulin. In contrast, there were 24
clusters with ESTs derived from a single organ (5%
rule applied). Five of these clusters contained testis-
derived sequences, 18 constituted ovary-derived
ones, whereas the remaining one contained exclu-
sively kidney-derived ESTs (Table A3 in the Sup-
plementary Material).
Twenty-two consensus sequences encoded for
zebrafish orthologues of genes with functions
related to reproduction in other organisms, e.g.
prostaglandin E synthase (Jakobsson et al., 1999),
rhamnose-binding lectin (Tateno et al., 1998) or
zygote arrest 1 (Wu et al., 2003). On the other
hand, the list also included several genes (e.g. dihy-
dropteridine reductase, septin, dim1p homologue
and cystein proteinase) for which enhanced expres-
sion in the gonad has not been described previ-
ously.
Functional classification of the clusters
The translated sequences obtained from ESTScan
were annotated for protein domains and functional
sites. Domains were then assigned to GO molecular
function categories and the relative proportions
of these categories were compared in the testis,
ovary and kidney. The frequency of the 100 most
frequent domains in the three organs, together with
their GO categories, is shown in Table A4 in the
Supplementary Material.
Surprisingly, the overall domain distribution was
very similar for all three organs. Nearly half of
the clusters fell into the category of unknown
molecular functions, whereas the second and third
most populous groups were ‘binding activity’ and
‘enzyme activity’ (Table 3; see Figure 3A for a
typical result).
The categories of ‘binding activity’ and ‘enzyme
activity’ were then analysed in further detail by
assigning their genes into more specific sub-
categories for all three organs (Figure 3B). At this
level more differences were found. Testis had fewer
genes with ‘transferase activity’, than the other two
organs. Ovary, on the other hand, had more genes
with ‘carbohydrate-binding activity’, probably due
to high-level expression of the rhamnose-binding
lectins. Both gonads had many more genes with
‘nucleic acid binding ability’ and less with ‘lyase
ability’ than the kidney.
Table 3. Comparison on the molecular functions of genes
in testis-, ovary- and kidney-derived EST clusters
Molecular function∗
Testis
(%)
Ovary
(%)
Kidney
(%)
Unknown
Binding activity
Enzyme activity
Transporter activity
Signal transduction activity
Transcription regulator activity
Structural molecule activity
Enzyme regulator activity
Motor activity
Chaperone activity
Translation regulator activity
Defence/immunity protein activity
Toxin activity
Apoptosis regulator activity
Cell adhesion molecular activity
Nutrient reservoir activity
Anticoagulant activity
Protein tagging activity
Antioxidant activity
Cytoskeletal regulator activity
48.59
18.51
14.35
4.08
3.85
2.99
2.75
1.39
0.84
0.80
0.60
0.36
0.35
0.26
0.15
0.07
0.04
0.04
0.00
0.00
44.26
20.12
15.95
5.08
4.14
3.53
2.59
1.50
0.20
0.62
0.67
0.25
0.54
0.42
0.07
0.02
0.00
0.02
0.02
0.00
48.77
18.11
15.16
4.09
4.40
3.10
1.72
1.22
0.33
0.56
1.08
0.41
0.27
0.38
0.29
0.02
0.02
0.03
0.03
0.02
∗Molecular functions were assigned to Gene Ontology molecular
function categories using mappings provided by the GO Consortium
(Ashburner et al., 2000).
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 9

Gonad transcriptomes in zebrafish 411
A
B
Figure 3. Domain distributions in the adult zebrafish testis, ovary and kidney. The translated sequences obtained from
ESTScan were annotated for protein domains and functional sites. The annotated domains were assigned to GO molecular
function categories, using mappings provided by the GO Consortium, and the relative proportion of the functional
categories in the testis, ovary and kidney were compared. (A) GO molecular functions of clusters specific to testis (pie
charts for ovary- and kidney-specific domains are very similar); (B) detailed classification of the categories of ‘binding
activity’ and ‘enzyme activity’, comparing the relative proportions in the three organs
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 10

412Y. Li et al.
Identification of novel genes with testis- and
ovary-specific expression
Experimental and computational tools were applied
in succession for the identification of genes with
gonad-specific expression in adults (Figure 1). Two
‘Gonad UniClone’ macroarrays were produced,
they contained adult testis- and ovary-derived
full-length cDNA clones. The 2761 clones spot-
ted onto the two membranes were selected from
our cDNA collection on the basis of the ‘in sil-
ico’ normalization results. Three different kinds of
cDNA probes (from adult testis, adult ovary and
adult kidney) were hybridized onto the membranes
in six parallels for each organ. The resulting pat-
terns were analysed and compared to each other
(see Figure 4 for typical examples of hybridization
patterns).
Clones showing significant signal with one of
the gonad probes, but not with the other two,
were considered as potentially testis- or ovary-
specific, and matched to clusters to identify a
unique clone set. Clusters with more than 5% ESTs
from the other two organs were removed from the
dataset. The consensus sequence of the remain-
ing clusters was then used to search the dbEST
database in GenBank to eliminate those clones,
which show clear homology to ESTs derived
from any other adult zebrafish organ, leaving
169 clones (Figure 1; Table 4). A total of 77 of
these clones were with known functions and some
(e.g. histone 2A, piwi and tektin 1) with gonad-
specific or gonad-enhanced expression in other
organisms (Table A5 in the Supplementary Mate-
rial). The rest were novel genes: 53 with poten-
tially testis-specific and 39 with potentially ovary-
specific expression patterns in the adult zebrafish
(Table 4).
The expression pattern of 45 novel clones
(mostly those with potential orthologues with
unknown function in other vertebrate classes) was
re-tested by PCR-amplification analysis using spe-
cific PCR primers and templates from a cDNA
Figure 4. Typical results from ‘Gonad UniClone’ macroarrays hybridized with three different kinds of organ-derived,
DIG-labelled probes. Two macroarrays were produced by replicating our ‘Gonad UniClone’ cDNA set containing adult
zebrafish testis- or ovary-derived, PCR-amplified cDNA inserts from full-length cDNA library onto nylon membranes in a
4 × 4 arrangement with the appropriate controls. Following hybridization with digoxigenin-labelled organ-derived cDNA
probes, washing and non-isotopic detection of the hybridized probe chemiluminescent signal was recorded on film. Relative
signal intensity values were normalized across membranes based on the values measured from housekeeping genes. A gene
was considered to be expressed in a given tissue if the median of normalized values from six independent hybridizations
exceeded the mean value of the negative controls plus twice their standard deviation. The type of probe is indicated at one
of the upper corners of each image
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 11

Gonad transcriptomes in zebrafish413
Table 4. Organ-specific clones identified by subsequent
application of ‘wet and dry’ genomic tools (differential
hybridizationoncDNAarray,insilicosubtractionandBLAST
analysis)
TestisOvary
Clones on array derived from the organ
Organ-specific hybridization
In silico subtraction∗
No BLAST hit in other adult organ∗∗
Novel
1748
118
1012
312
135 93
72
53
97
39
∗The sum of clusters and singletons specific to a given organ (‘5%
rule’ applied).
∗∗BLASTed against dbEST and removed those with matching
sequence to an EST originating from any non-gonadal adult organ.
panel, containing samples isolated from adult
zebrafish testis, ovary, kidney and rest-of-body
(Figure 5). Primer pairs for seven clones ampli-
fied a product only from the positive control,
but not from any of the organ-derived cDNAs,
whereas eight were expressed in each sample
tested. The remaining 30 reactions all showed
gonad-enhanced or gonad-specific expression: 15
expression patterns were testis-specific, whereas
six of them ovary-specific. The rest showed testis-
enhanced (six clones) or ovary-enhanced (three
clones) expression pattern, with strong product
from one of the two gonads and weak one from
at least one additional organ. Therefore, the results
of the PCR assay confirmed organ-specificity for
21 of the 45 clones analysed.
Discussion
The catalogue of genes expressed in a given organ,
tissue or cell type at a particular developmental
stage (the transcriptome) is important for molecular
biologists for several reasons. It helps to identify
the gene sets transcribed in the selected organ
(tissue, cell), allowing for better understanding of
molecular processes and their genetic regulation by
using cDNA arrays. EST collections and clustered
cDNA sets — especially those with full-length
sequence — produced from these clones also have
an important role in ‘complementing and advancing
identification of genes from annotated genome
sequences’ (Wakimoto, 2000). The progressing
sequencing of the zebrafish genome at the Sanger
Center has reached a 5.3× coverage and provided
the researchers with the third assembly, which
contains over 58000 supercontigs, covering about
86% of the genome.
Our paper describes the analysis of partial
transcriptomes of the adult zebrafish gonads by
comparing clustered cDNA sets (based on an aver-
age of 15000 ESTs/organ) from testis and ovary to
Figure 5. The expression pattern of a selected set of potentially organ-specific genes analysed by PCR amplification by
using cDNA panel generated from total RNAs isolated from adult organs as template. Labels for templates: Te, testis; Ov,
ovary; Ki, kidney; Body, rest of body (all organs, except gonad and kidney); +ve, PCR-amplified cDNA insert from the
clone in question (used as positive control)
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 12

414Y. Li et al.
each other and to a somatic control (kidney). One-
third of the gonad-derived ESTs used in the study
were produced in our laboratory, the rest were
obtained from GenBank. BLAST and ESTScan
analysis of the clustered set of sequences from the
three organs yielded very similar results, with the
exception of the ratio of ORF-containing sequences
among ‘unknown genes’, which was higher in the
two gonads than in the kidney.
Our effort to identify genes with gonad-specific
expression from 2760 cloned inserts spotted onto
our ‘Gonad UniClone’ cDNA array was based on
combining the power of experimental and com-
putational genomic tools. Stepwise application of
an experimental and three computational methods
allowed us to select 72 clones with potentially
testis-specific and 97 clones with potentially ovary-
specific expression. Over 45% of these clones
either show similarity to hypothetical genes from
other vertebrates or are without a BLASTx hit in
GenBank. A subset of 45 clones (all with unknown
function) was analysed by PCR amplification from
organ-specific cDNA templates. The results con-
firmed that the expression for nearly half of them
is restricted either to the adult testis (15 clones) or
the ovary (six clones). These genes will be useful
as markers for the adult gonad in gene expres-
sion studies. Those with testis-specific expression
in adults will be subjected to detailed analysis to
select the ones with early expression in the differen-
tiating testis. Currently the males can only be iden-
tified from dissected samples either by histology
(Maack and Segner, 2003), or by the phenotype of
the dissected gonad 5 weeks post-fertilization (wpf;
R.B., unpublished data). Although stable trans-
genic zebrafish lines with the enhanced expres-
sion of EGFP-containing reporter constructs in the
ovary have been reported (Hsiao and Tsai, 2003;
Onichtchouk et al., 2003), they can only be used
to identify the males following 5–6 wpf. The rea-
son for this is that most individuals seem to pass
through an early phase, where their gonad would
exhibit female-like expression pattern (Hsiao and
Tsai, 2003; Takahashi, 1977). The availability of
markers with an early testis-specific expression pat-
tern would likely advance the study of the gonad
differentiation process in zebrafish and possibly in
related teleost species as well.
Assigning genes to functional categories by
using the criteria provided by the GO Consortium
helps with the understanding of their potential func-
tion, which in turn eases the task of explaining
differences among the gene sets (co-)expressed in
various organs. At the GO functional level, the
domain distributions among the sequences derived
from zebrafish testis, ovary or kidney are nearly
identical and similar to GO pie charts produced
from genes expressed specifically in the mouse
testis (Bono et al., 2003). However, they are differ-
ent from that of mouse kidney (Bono et al., 2003),
as the latter contains substantially more ‘enzymes’
and ‘transporters’, than the mouse testis or any of
the three zebrafish organs studied by us. The reason
for this difference could be a relatively low num-
ber of clones (67) used for the generation of the
mouse kidney GO pie chart. Differences among the
three fish organs in the size of ‘nucleic acid bind-
ing activity’ group might point at increased level
of transcription in the gonads, a fact well known
for certain cell types in the testis (Kleene, 2001),
but not for those of the ovary.
The analysis of the 100 biggest clusters present
on the TOK (testis–ovary–kidney) EST set pro-
vided interesting data. The most abundantly ex-
pressed groups of sequences in our final dataset
are those of the zona pellucida proteins (ZPs; Bleil
and Wassarman, 1980b). These sulphated glyco-
proteins are the main constituents of the envelop-
ing layer surrounding vertebrate eggs (Wassarman
et al., 1999), acting as primary and secondary
sperm receptors in oocytes (Bleil and Wassarman,
1980a, 1983). According to a recently revised clas-
sification, there are four ZP subfamilies in ver-
tebrates: ZPA, ZPX, ZPB and ZPC (Spargo and
Hope, 2003). Fish genomes usually have a vari-
able number of ZPB and ZPC genes (Del Giacco
et al., 2000; Kanamori et al., 2003), and they
are expected to contain at least one ZPX gene
(Kanamori et al., 2003; Spargo and Hope, 2003).
We performed a phylogenetic analysis on the clus-
ters that matched a ZP gene, along with a subset
of the sequences listed by Spargo and Hope (2003;
see Table A7 in the Supplementary Material for the
list). The topology of the resulting consensus tree
(Figure 6) is nearly identical to that described by
Spargo and Hope (2003). It also shows that among
the ZP-homologous clusters in our dataset, one of
them, TOK888, lies within the ZPX subfamily. On
the other hand, no ZPA gene has been identified
here or from other fish species previously (Spargo
and Hope, 2003).
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 13

Gonad transcriptomes in zebrafish 415
Figure 6. Phylogenetic tree of the zona pellucida (zp) gene family, updated by including several clusters from our dataset
(labelled with TOK). All other sequences are from Spargo and Hope (2003)
Sequences coding for sugar-binding proteins,
called lectins (for reviews, see Kilpatrick, 2002;
Loris, 2002) are among the biggest clusters in
our final dataset, showing ovary-specific expres-
sion. Several forms of rhamnose-binding lectins
have been described from the eggs of steelhead
trout (Tateno et al., 1998, 2001) and other fish
species (e.g. Hosono et al., 1999; Tateno et al.,
2002). Their main physiological role is thought
to be protection of the embryos/larvae against
pathogens (review: Ewart et al., 2001). C-type
lectins and pentraxins are also present in large num-
bers among ovary-derived zebrafish ESTs, and they
are implicated in defence mechanisms of verte-
brates (Arason, 1996). Lectins are also expected to
be involved in fertilization and embryonic devel-
opmental processes, as observed in sea urchin
(Ozeki et al., 1995) and in intracellular trans-
port within cells (Hauri et al., 2000, 2002). In
fish they might also have a role in blocking
polyspermy (Murata et al., 2000; Yasumasu et al.,
2000).
Our ‘Gonad UniClone’ array is the second spe-
cialized zebrafish cDNA array — following that
of Ton et al. (2002) — containing clones iso-
lated from one organ type only, in our case
the adult gonads. The use of such organ-derived
arrays permits more efficient analysis of the target
organ(s) due to higher coverage of their transcrip-
tome than that offered by the general arrays (e.g.
Clark et al., 2001; Lo et al., 2003). We used EST
clustering to decrease the redundancy of our orig-
inal dataset: in addition to the singletons, only a
single clone from each cDNA cluster was spot-
ted onto the ‘Gonad UniClone’ macroarray. In the
absence of full-length cDNA sequences for most of
our clones, we were unable to determine the exact
redundancy of our spotted dataset. However, pre-
liminary data from their 3?ESTs (E. Low, personal
communication) indicates redundancy value below
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 14

416Y. Li et al.
5%, which would in turn suggest the presence of
over 2600 unique clones on the two membranes.
The ‘Gonad UniClone’ cDNA set will be extended
to contain approximately 7000–8000 full-length
gonad-derived cDNA clones and converted into
microarrays (in progress). We expect the ‘Gonad
UniClone’ microarrays to be useful for the analysis
of gene sets expressed in gonads, as demonstrated
by others in C. elegans (Jiang et al., 2001; Reinke
et al., 2000), D. melanogaster (Andrews et al.,
2000), mouse (Rockett et al., 2001) and human
(Schummer et al., 1999).
Infertility is causing a problem for 10–15%
of human couples (De Kretser and Baker, 1999;
Maduro and Lamb, 2002) and genetic factors
rank highly among the possible reasons (Lilford
et al., 1994). To date, knockout mouse has been
used exclusively as a model system for study-
ing mutations implicated in human reproductive
disorders (Cooke and Saunders, 2002; Matzuk
and Lamb, 2002). Among the testis- and ovary-
specific zebrafish genes identified in our screen,
over 30 have shown a high level of similarity to
hypothetical genes, cDNAs or proteins described
from the two sequenced mammalian genomes. The
corresponding human and mouse orthologues of
such genes — due to their conserved sequence
and gonad-related function in vertebrates — might
have a potential importance for the study of mam-
malian gonad physiology.
Acknowledgements
The authors thank Professor Warren J. Ewens for advice on
statistical analysis of the data; Balamurugan Kumarasamy,
James Quek and Yina Cai for technical assistance; Elijah
Low for preliminary information on unpublished data; and
Drs Wei-Cai Yang, Zhong-Cao Yin, Naweed Naqvi, Jimmy
Kwang and Mohan Balasubramanian for primers used for
the amplification of ORESTES clones. The help of TLL
Sequencing Facility is also acknowledged. This work was
supported by research grants from the Temasek Lifesciences
Laboratory and the Agency for Science, Technology and
Research (A*STAR).
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990.
Basic local alignment search tool. J Mol Biol 215: 403–410.
Altschul SF, Madden TL, Schaffer AA, et al. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25: 3389–3402.
Andrews J, Bouffard GG, Cheadle C, et al. 2000. Gene discovery
using computational and microarray analysis of transcription
in the Drosophila melanogaster
2030–2043.
Arason GJ. 1996. Lectins as defence molecules in vertebrates and
invertebrates. Fish Shellfish Immunol 6: 277–289.
Ashburner M, Ball CA, Blake JA, et al. 2000. Gene ontology: tool
for the unification of biology. Nature Genet 25: 25–29.
Attwood TK, Bradley P, Flower DR, et al. 2003. PRINTS and
its automatic supplement, prePRINTS. Nucleic Acids Res 31:
400–402.
Bateman A, Birney E, Cerruti L, et al. 2002. The Pfam protein
families database. Nucleic Acids Res 30: 276–280.
Bleil JD, Wassarman PM. 1980a. Mammalian sperm-egg interac-
tion: identification of a glycoprotein in mouse egg zonae pellu-
cidae possessing receptor activity for sperm. Cell 20: 873–882.
Bleil JD, Wassarman PM. 1980b. Structure and function of the
zona pellucida: identification and characterization of the proteins
of the mouse oocyte’s zona pellucida. Dev Biol 76: 185–202.
Bleil JD, Wassarman PM. 1983. Sperm-egg interactions in the
mouse: sequence of events and induction of the acrosome
reaction by a zona pellucida glycoprotein. Dev Biol 95:
317–324.
Boeckmann B, Bairoch A, Apweiler R, et al. 2003. The Swiss-
Prot protein knowledgebase and its supplement TrEMBL in
2003. Nucleic Acids Res 31: 365–370.
Bonaldo MDF, Lennon G, Soares MB. 1996. Normalization and
subtraction: two approaches to facilitate gene discovery.
Genome Res 6: 791–806.
Bono H, Yagi K, Kasukawa T, et al. 2003. Systematic expression
profiling of the mouse transcriptome using RIKEN cDNA
microarrays. Genome Res 13: 1318–1323.
Christoffels A, van Gelder A, Greyling G, et al. 2001. STACK:
Sequence tag alignment and consensus knowledgebase. Nucleic
Acids Res 29: 234–238.
Clark MD, Hennig S, Herwig R, et al. 2001. An oligonucleotide
fingerprint normalized and expressed sequence tag characterized
zebrafish cDNA library. Genome Res 11: 1594–1602.
Coimbra RS, Weil D, Brottier P, et al. 2002. A subtracted cDNA
library from the zebrafish (Danio rerio) embryonic inner ear.
Genome Res 12: 1007–1011.
Cooke HJ, Saunders PT. 2002. Mouse models of male infertility.
Nature Rev Genet 3: 790–801.
De Kretser DM, Baker HW. 1999. Infertility in men: recent
advances and continuing controversies. J Clin Endocrinol Metab
84: 3443–3450.
Del Giacco L, Diani S, Cotelli F. 2000. Identification and spatial
distribution of the mRNA encoding an egg envelope component
of the Cyprinid zebrafish, Danio rerio, homologous to the
mammalian ZP3(ZPC). Dev Genes Evol 210: 41–46.
Ewart KV, Johnson SC, Ross NW. 2001. Lectins of the innate
immune system and their relevance to fish health. Ices J Marine
Sci 58: 380–385.
Geisler R, Rauch GJ, Baier H, et al. 1999. A radiation hybrid map
of the zebrafish genome. Nature Genet 23: 86–89.
Hauri HP, Appenzeller C, Kuhn F, Nufer O. 2000. Lectins and
traffic in the secretory pathway. FEBS Lett 476: 32–37.
Hauri HP, Nufer O, Breuza L, Ben Tekaya H, Liang L. 2002.
Lectins and protein traffic early in the secretory pathway.
In Glycogenomics: The Impact of Genomics and Informatics
testis. Genome Res 10:
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.

Page 15

Gonad transcriptomes in zebrafish417
on Glycobiology, Drickamer K, Dell A (eds), Portland Press:
London; 73–82.
Hillier L, Lennon G, Becker M, et al. 1996. Generation and
analysis of 280000 human expressed sequence tags. Genome
Res 6: 807–828.
Hosono M, Ishikawa K, Mineki R, et al. 1999. Tandem repeat
structure of rhamnose-binding lectin from catfish (Silurus
asotus) eggs. Biochim Biophys Acta Gen Sub 1472: 668–675.
Hsiao CD, Tsai HJ. 2003. Transgenic zebrafish with fluorescent
germ cell: a useful tool to visualize germ cell proliferation and
juvenile hermaphroditism in vivo. Dev Biol 262: 313–323.
Hukriede N, Fisher D, Epstein J, et al. 2001. The LN54 radiation
hybrid map of zebrafish expressed sequences. Genome Res 11:
2127–2132.
Iseli C, Jongeneel CV, Bucher P. 1999. ESTScan: a program
for detecting, evaluating, and reconstructing potential coding
regions in EST sequences. In Proceedings of the Seventh
International Conference on Intelligent Systems for Molecular
Biology. Lengauer T, Schneider R,
Heidelberg, Germany, pp. 138–148.
Jakobsson PJ, Thoren S, Morgenstern R, Samuelsson B. 1999.
Identification of human prostaglandin E synthase: a microsomal,
glutathione-dependent, inducible enzyme, constituting a poten-
tial novel drug target. Proc Natl Acad Sci USA 96: 7220–7225.
Jiang M, Ryu J, Kiraly M, et al. 2001. Genome-wide analysis of
developmental and sex-regulated gene expression profiles in
Caenorhabditis elegans. Proc Natl Acad Sci USA 98: 218–223.
Kanamori A, Naruse K, Mitani H, Shima A, Hori H. 2003.
Genomic organization of ZP domain containing egg envelope
genes in medaka (Oryzias latipes). Gene 305: 35–45.
Kilpatrick DC. 2002. Animal lectins: a historical introduction and
overview. Biochim Biophys Acta Gen Sub 1572: 187–197.
Kleene KC. 2001. A possible meiotic function of the peculiar
patterns of gene expression in mammalian spermatogenic cells.
Mech Dev 106: 3–23.
Knapik EW, Goodman A, Ekker M, et al. 1998. A microsatellite
genetic linkage map for zebrafish (Danio rerio). Nature Genet
18: 338–343.
Lilford R, Jones AM, Bishop DT, Thornton J, Mueller R. 1994.
Case-control study of whether subfertility in men is familial. Br
Med J 309: 570–573.
Lo J, Lee SC, Xu M, et al. 2003. 15000 unique zebrafish EST
clusters and their future use in microarray for profiling gene
expression patterns during embryogenesis. Genome Res 13:
455–466.
Loris R. 2002. Principles of structures of animal and plant lectins.
Biochim Biophys Acta Gen Sub 1572: 198–208.
Maack G, Segner H. 2003. Morphological development of the
gonads in zebrafish. J Fish Biol 62: 895–906.
Maduro MR, Lamb DJ. 2002. Understanding new genetics of male
infertility. J Urol 168: 2197–2205.
Matzuk MM, Lamb DJ. 2002. Genetic dissection of mammalian
fertility pathways. Nature Cell Biol 4(suppl): s41–49.
Miller RT, Christoffels AG, Gopalakrishnan C, et al. 1999. A
comprehensive approach to clustering of expressed human gene
sequence: the sequence tag alignment and consensus knowledge
base. Genome Res 9: 1143–1155.
Murata K, Yasumasu S, Lee YM, Hedrick JL. 2000. Fish egg
lectins; Important factors for a polyspermy block during
fertilization. Mol Biol Cell 11: A405–A405 2103 Suppl.
Bork Pet al. (eds).
Neto ED, Correa RG, Verjovski-Almeida S, et al. 2000. Shotgun
sequencing of the human transcriptome with ORF expressed
sequence tags. Proc Natl Acad Sci USA 97: 3491–3496.
Neto ED, Harrop R, CorreaOliveira R, et al. 1997. Minilibraries
constructed from cDNA generated by arbitrarily primed RT-
PCR: an alternative to normalized libraries for the generation
of ESTs from nanogram quantities of mRNA. Gene 186:
135–142.
Onichtchouk D, Aduroja K, Belting HG, Gnugge L, Driever W.
2003. Transgene driving GFP expression from the promoter of
the zona pellucida gene zpc is expressed in oocytes and provides
an early marker for gonad differentiation in zebrafish. Dev Dyn
228: 393–404.
Ozeki Y,Yokota Y, Kato KH,
Developmental expression of D-galactoside-binding lectin in
sea urchin (Anthocidaris crassispina) eggs. Exp Cell Res 216:
318–324.
Pijnacker LP,Ferwerda MA.
banding. Genome 38: 1052–1055.
Reinke V, Smith HE, Nance J, et al. 2000. A global profile of
germline gene expression in C. elegans. Mol Cell 6: 605–616.
Rockett JC, Luft JC, Garges JB, et al. 2001. Development of a
950-gene DNA array for examining gene expression patterns in
mouse testis. Genome Biol 2: 14.1–14.9.
Schummer M, Ng VLV, Baumgarner RE, et al. 1999. Compara-
tive hybridization of an array of 21500 ovarian cDNAs for the
discovery of genes overexpressed in ovarian carcinomas. Gene
238: 375–385.
Sigrist CJ,Cerutti L,Hulo N,
documented database using patterns and profiles as motif
descriptors. Brief Bioinform 3: 265–274.
Sola L, Gornung E. 2001. Classical and molecular cytogenetics
of the zebrafish, Danio rerio (Cyprinidae, Cypriniformes): an
overview. Genetica 111: 397–412.
Spargo SC, Hope RM. 2003. Evolution and nomenclature of the
zona pellucida gene family. Biol Reprod 68: 358–362.
Takahashi H. 1977. Juvenile hermaphroditism in the zebrafish,
Brachydanio rerio. Bull Fac Fish Hokkaido Univ 28: 57–65.
Tateno H,Ogawa T,Muramoto K,
rhamnose-binding lectin family from eggs of steelhead trout
(Oncorhynchus mykiss) with different structures and tissue dis-
tribution. Biosci Biotechnol Biochem 65: 1328–1338.
Tateno H, Ogawa T, Muramoto K, Kamiya H, Saneyoshi M.
2002. Distribution and molecular evolution of rhamnose-binding
lectins in Salmonidae: isolation and characterization of two
lectins from white-spotted charr (Salvelinus leucomaenis) eggs.
Biosci Biotechnol Biochem 66: 1356–1365.
Tateno H, Saneyoshi A, Ogawa T, et al. 1998. Isolation and
characterization of rhamnose-binding lectins from eggs of
steelhead trout (Oncorhynchus mykiss) homologous to low
density lipoprotein receptor superfamily. J Biol Chem 273:
19190–19197.
ThompsonJD,HigginsDG,
W — improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position- specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:
4673–4680.
Ton C, Hwang DM, Dempsey AA, et al. 2000. Identification,
characterization, and mapping of expressed sequence tags from
an embryonic zebrafish heart cDNA library. Genome Res 10:
1915–1927.
Titani K,Matsui T. 1995.
1995. Zebrafishchromosome
et al.2002. PROSITE:a
et al.2001.Anovel
GibsonTJ.1994. Clustal-
Copyright  2004 John Wiley & Sons, Ltd.
Comp Funct Genom 2004; 5: 403–418.