Article

Pygo1 and Pygo2 roles in Wnt signaling in mammalian kidney development

Division of Developmental Biology, Children's Hospital Medical Center, Cincinnati, OH 45229, USA.
BMC Biology (Impact Factor: 7.98). 04/2007; 5:15. DOI: 10.1186/1741-7007-5-15
Source: PubMed

ABSTRACT The pygopus gene of Drosophila encodes an essential component of the Armadillo (beta-catenin) transcription factor complex of canonical Wnt signaling. To better understand the functions of Pygopus-mediated canonical Wnt signaling in kidney development, targeted mutations were made in the two mammalian orthologs, Pygo1 and Pygo2.
Each mutation deleted >80% of the coding sequence, including the critical PHD domain, and almost certainly resulted in null function. Pygo2 homozygous mutants, with rare exception, died shortly after birth, with a phenotype including lens agenesis, growth retardation, altered kidney development, and in some cases exencephaly and cleft palate. Pygo1 homozygous mutants, however, were viable and fertile, with no detectable developmental defects. Double Pygo1/Pygo2 homozygous mutants showed no apparent synergy in phenotype severity. The BAT-gal transgene reporter of canonical Wnt signaling showed reduced levels of expression in Pygo1-/-/Pygo2-/- mutants, with tissue-specific variation in degree of diminution. The Pygo1 and Pygo2 genes both showed widespread expression in the developing kidney, with raised levels in the stromal cell compartment. Confocal analysis of the double mutant kidneys showed disturbance of both the ureteric bud and metanephric mesenchyme-derived compartments. Branching morphogenesis of the ureteric bud was altered, with expanded tips and reduced tip density, probably contributing to the smaller size of the mutant kidney. In addition, there was an expansion of the zone of condensed mesenchyme capping the ureteric bud. Nephron formation, however, proceeded normally. Microarray analysis showed changed expression of several genes, including Cxcl13, Slc5a2, Klk5, Ren2 and Timeless, which represent candidate Wnt targets in kidney development.
The mammalian Pygopus genes are required for normal branching morphogenesis of the ureteric bud during kidney development. Nevertheless, the relatively mild phenotype observed in the kidney, as well as other organ systems, indicates a striking evolutionary divergence of Pygopus function between mammals and Drosophila. In mammals, the Pygo1/Pygo2 genes are not absolutely required for canonical Wnt signaling in most developing systems, but rather function as quantitative transducers, or modulators, of Wnt signal intensity.

0 Followers
 · 
113 Views
 · 
48 Downloads
  • Source
    • ", 2009 ; Li et al . , 2007 ; Schwab et al. , 2007 ; Song et al. , 2007 ) and in human colorectal cancer cells with activated b - catenin ( Adachi et al. , 2004 ; Brembeck et al. , 2004 ; de la Roche fingers are enhanced by their binding to HD1 , ascribing a cofactor role to BCL9 / B9L in promoting Pygo ' s histone binding. The underlying mechanism is an allosteric communication , trig - gered by HD1 binding to PHD and relayed to its histone - binding surface through the PHD core ( Miller et al. , 2010 ). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Pygo proteins promote Armadillo- and β-catenin-dependent transcription, by relieving Groucho-dependent repression of Wnt targets. Their PHD fingers bind histone H3 tail methylated at lysine 4, and to the HD1 domain of their Legless/BCL9 cofactors, linking Pygo to Armadillo/β-catenin. Intriguingly, fly Pygo orthologs exhibit a tryptophan > phenylalanine substitution in their histone pocket-divider which reduces their affinity for histones. Here, we use X-ray crystallography and NMR, to discover a conspicuous groove bordering this phenylalanine in the Drosophila PHD-HD1 complex-a semi-aromatic cage recognizing asymmetrically methylated arginine 2 (R2me2a), a chromatin mark of silenced genes. Our structural model of the ternary complex reveals a distinct mode of dimethylarginine recognition, involving a polar interaction between R2me2a and its groove, the structural integrity of which is crucial for normal tissue patterning. Notably, humanized fly Pygo derepresses Notch targets, implying an inherent Notch-related function of classical Pygo orthologs, disabled in fly Pygo, which thus appears dedicated to Wnt signaling.
    Structure 10/2013; 21(12). DOI:10.1016/j.str.2013.09.013 · 6.79 Impact Factor
  • Source
    • "For detection of Wnt1-cre and R26R, the primers and PCR conditions used were exactly as described previously [45]. For detection of the Pygo2(flox/−) allele the following primers (Integrated DNA Technologies) Wnt1-cre(+/−)::Pygo(−/−) allele, forward (F) CCTGGATTCTTGTTGCTGGTATG; reverse (R) AAGGTATTTGGTGCTCCGAGGG; Pygo2 WT or floxed allele, (F) TGTCTTGATGACAGCGTTTAGCC, (R) AGATTCAGTAAGCTGAGCCTGGTG [39]. PCR conditions were as follows: 1 cycle, 94 °C for 3 min, followed by 35 cycles consisting of 30 s denaturation at 94 °C, 30 s annealing at 62 °C, and 45 s extension at 72 °C and a final 10 min extension at 72 °C. "
    [Show abstract] [Hide abstract]
    ABSTRACT: We show that neural crest stem cells affect mouse hair follicle development. During embryogenesis hair follicle induction is regulated by complex reciprocal and functionally redundant signals between epidermis and dermis, which remain to be fully understood. Canonical Wnt signalling is a hallmark of neural crest cells and also a prerequisite for hair follicle induction prior to hair placode formation in the epidermis. As neural crest stem cells invade the epidermis during early embryonic development we aimed at determining whether neural crest cells affect hair follicle development. To attenuate, but not silence, canonical Wnt signalling specifically in neural crest cells, we analyzed Wnt1-cre(+/-)::Pygo2(-/-) mice in which the β-catenin co-activator gene, Pygopus 2 (Pygo2), is deleted specifically in neural crest cells. Both, hair density and hair thickness were reduced in mutant mice. Furthermore, hair development was delayed and the relative ratio of hair types was affected. There was a decrease in zig-zag hairs and an increase in awl hairs. Mouse neural crest stem cells expressed ectodysplasin, an essential effector in the formation of zig-zag hair. Taken together, our data support the novel notion that neural crest cells are involved in the earliest stages of hair follicle development.
    Stem cell reviews 08/2013; 10(1). DOI:10.1007/s12015-013-9466-z · 3.21 Impact Factor
  • Source
    • "Two other components of the TCF/b-catenin complex, Bcl9/ Legless and Pygopus, were first identified in Drosophila (Kramps et al., 2002; Parker et al., 2002; Thompson et al., 2002), and Bcl9 has been proposed to bridge Pygopus to the N terminus of b-catenin. Although most Wnt signaling events in Drosophila appear to depend on Bcl9 and Pygopus, knockout studies in mice suggest that these proteins are largely dispensable in mammals (Brack et al., 2009; Schwab et al., 2007). b-catenin influences gene transcription in several ways. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The WNT signal transduction cascade controls myriad biological phenomena throughout development and adult life of all animals. In parallel, aberrant Wnt signaling underlies a wide range of pathologies in humans. In this Review, we provide an update of the core Wnt/β-catenin signaling pathway, discuss how its various components contribute to disease, and pose outstanding questions to be addressed in the future.
    Cell 06/2012; 149(6):1192-205. DOI:10.1016/j.cell.2012.05.012 · 33.12 Impact Factor
Show more