DNA barcoding revels hidden diversity in the Neotropical freshwater fish Piabina argentea (Characiformes: Characidae) from Upper Paraná Basin of Brazil

Laboratório de Biologia e Genética de Peixes, Instituto de Biociências, Universidade Estadual Paulista, Botucatu, São Paulo, Brazil.
Mitochondrial DNA (Impact Factor: 1.21). 06/2011; 22 Suppl 1(S1):87-96. DOI: 10.3109/19401736.2011.588213
Source: PubMed


We analyzed a small and wide geographically distributed Neotropical freshwater fish, the Piabina argentea from the Upper Paraná Basin, to check the hypothesis that this species is composed of more than one biological unit, since it has a limited dispersion, through the DNA barcode technique.
Partial mitochondrial COI and CytB gene sequences were obtained for 58 specimens drawn from 13 localities.
Phylogenetic analysis revealed six major clusters of P. argentea. Kimura-two-parameter (K2P) genetic divergences among these six P. argentea clusters ranged from 2 to 5.6% and from 2.3 to 5.4% for COI and CytB genes, respectively, and these values were on average approximately nine times greater than intra-cluster K2P divergences. The fixation index (F(ST)) among clusters showed very high values and the haplotype network analysis displayed seven unconnected units.
These results reinforce the hypothesis that the widely distributed P. argentea species concept as currently conceived actually represents more than one species (possibly six). These results demonstrate the efficacy of DNA barcoding for the discovery of hidden diversity in Neotropical freshwater fishes, and we conclude that barcoding is a useful tool for alpha taxonomy.

Download full-text


Available from: Luiz Henrique Garcia Pereira, Oct 05, 2015
61 Reads
  • Source
    • ") , with an average genetic dis - tance of 1 . 73% ( SE 0 . 05% , Fig . S3 , Supporting informa - tion ) . In contrast to P . maculatus , P . argentea does not share haplotypes at different sites , indicating possible population structuring . The existence of more than one biological unit of P . argentea has been suggested in previ - ous studies . Pereira et al . ( 2011b ) studied COI gene dis - tance patterns in P . argentea along the upper Paran a River basin and found six well - structured clusters , sug - gesting that each cluster corresponds to a different bio - logical unit . Morphological and nuclear DNA analyses are required to observe actual taxonomic status and the level of gene flow between t"
  • Source
    • "No investigation has so far been conducted on M. striatum after Suresh Kumar (1998). Even though this species is well described morphologically, being a member of taxonomically confusing group, the necessity for molecular level investigation in support of its current description is inevitable considering the ''error cascades'' occurring due to bad taxonomic studies as reportd by Luiz et al. (2011). Recently, Murphy & Austin (2002, 2003, 2004, 2005) conducted molecular studies on Macrobrachium species with mitochondrial 16S ribosomal RNA gene marker. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Genus Macrobrachium includes freshwater prawns which inhabit most diverse habitats ranging from low saline areas to inland hill streams and impounded water bodies. Being morphologically conserved, this genus has been exposed to severe disputes related to their taxonomy, systematics and phylogeny. Macrobrachium striatum and M. equidens represent two morphologically related congeneric species within this genus. Earlier, M. striatum was considered as a striped form of M. equidens. Though these species are now well-described morphologically and differentiated into two species, no molecular level investigation has been carried out in support of their speciation. We report a study on M. striatum and M. equidens with emphasis to their molecular data through mitochondrial markers (16S ribosomal RNA and cytochrome oxidase subunit I). Results obtained from developed molecular markers of the two species revealed considerable genetic differentiation between them. Phylogram generated using Minimum evolution and Neighbour joining analyses differentiated M. striatum and M. equidens as two independent species. Genetic distance data showed high interspecific divergence (ranging from 3.9% to 17.0% for 16S rRNA sequences and 13.8% to 21.0% for COI sequences) between M. striatum and M. equidens confirming the findings of phylogram. Hence, it could be delineated that M. striatum and M. equidens represent two distinct species within genus Macrobrachium with emphasis to their morphology and genetics.
    Mitochondrial DNA 06/2015; DOI:10.3109/19401736.2015.1041114 · 1.21 Impact Factor
  • Source
    • "The amplifications of CR were performed with F-TTF primer by Sivasundar et al. (2001) and the reverse primer R3-3 0 TGGTAGCATGCGGGAAGAATGTCA5 0 designed in this study. On the other hand, Cytb mitochondrial gene was amplified using the Cytb primers and conditions according to Pereira et al. (2011). Amplified products were checked on 1% agarose gels stained with "
    [Show abstract] [Hide abstract]
    ABSTRACT: Brachyplatystoma platynemumis a catfish species widely distributed in the Amazon basin. Despite being considered of little commercial interest, the decline in other fish populations has contributed to the increase in the catches of this species. The structure, population genetic variability, and evolutionary process that have driven the diversification of this species are presently unknown. Considering that, in order to better understand the genetic structure of this species, we analyzed individuals from seven locations of the Amazon basin using eight molecular markers: control region and cytochrome b mtDNA sequences, and a set of six nuclear microsatellite loci. The results show high levels of haplotype diversity and point to the occurrence of two structured populations (Amazon River and the Madeira River) with high values for FST. Divergence time estimates based on mtDNA indicated that these populations diverged about 1.0 Mya (0.2–2.5 Mya 95% HPD) using cytochrome b and 1.4 Mya (0.2–2.7 Mya 95% HPD) using control region. During that time, the influence of climate changes and hydrological events such as sea level oscillations and drainage isolation as a result of geological processes in the Pleistocene may have contributed to the current structure ofB. platynemumpopulations, as well as of differences in water chemistry in Madeira River. The strong genetic structure and the time of genetic divergence estimated for the groups may indicate the existence of strong structure populations ofB. platynemumin the Amazon basin.
    Ecology and Evolution 04/2015; 5(10). DOI:10.1002/ece3.1486 · 2.32 Impact Factor
Show more