Inhibition of bacterial conjugation by phage M13 and its protein g3p: quantitative analysis and model.
ABSTRACT Conjugation is the main mode of horizontal gene transfer that spreads antibiotic resistance among bacteria. Strategies for inhibiting conjugation may be useful for preserving the effectiveness of antibiotics and preventing the emergence of bacterial strains with multiple resistances. Filamentous bacteriophages were first observed to inhibit conjugation several decades ago. Here we investigate the mechanism of inhibition and find that the primary effect on conjugation is occlusion of the conjugative pilus by phage particles. This interaction is mediated primarily by phage coat protein g3p, and exogenous addition of the soluble fragment of g3p inhibited conjugation at low nanomolar concentrations. Our data are quantitatively consistent with a simple model in which association between the pili and phage particles or g3p prevents transmission of an F plasmid encoding tetracycline resistance. We also observe a decrease in the donor ability of infected cells, which is quantitatively consistent with a reduction in pili elaboration. Since many antibiotic-resistance factors confer susceptibility to phage infection through expression of conjugative pili (the receptor for filamentous phage), these results suggest that phage may be a source of soluble proteins that slow the spread of antibiotic resistance genes.
- Citations (41)
-
Cited In (0)
-
Evolution and dissemination of beta-lactamases accelerated by generations of beta-lactam antibiotics. Medeiros . Clin Infect Dis 24 19-45.
-
A review of the antimicrobial activity of the fluoroquinolones. P Maple, W Brumfitt, Hamilton, Miller . J Chemother 2 280-294.
-
What antimicrobial resistance has taught us about horizontal gene transfer. Barlow . Methods Mol Biol 532 397-411.
Page 1
Inhibition of Bacterial Conjugation by Phage M13 and Its
Protein g3p: Quantitative Analysis and Model
Abraham Lin1, Jose Jimenez1, Julien Derr1, Pedro Vera1, Michael L. Manapat3, Kevin M. Esvelt2, Laura
Villanueva1, David R. Liu2, Irene A. Chen1*
1FAS Center for Systems Biology, Harvard University, Cambridge, Massachusetts, United States of America, 2Howard Hughes Medical Institute and Department of
Chemistry and Chemical Biology, Harvard University, Cambridge, Massachusetts, United States of America, 3School of Engineering and Applied Sciences, and Program for
Evolutionary Dynamics, Harvard University, Cambridge, Massachusetts, United States of America
Abstract
Conjugation is the main mode of horizontal gene transfer that spreads antibiotic resistance among bacteria. Strategies for
inhibiting conjugation may be useful for preserving the effectiveness of antibiotics and preventing the emergence of
bacterial strains with multiple resistances. Filamentous bacteriophages were first observed to inhibit conjugation several
decades ago. Here we investigate the mechanism of inhibition and find that the primary effect on conjugation is occlusion
of the conjugative pilus by phage particles. This interaction is mediated primarily by phage coat protein g3p, and
exogenous addition of the soluble fragment of g3p inhibited conjugation at low nanomolar concentrations. Our data are
quantitatively consistent with a simple model in which association between the pili and phage particles or g3p prevents
transmission of an F plasmid encoding tetracycline resistance. We also observe a decrease in the donor ability of infected
cells, which is quantitatively consistent with a reduction in pili elaboration. Since many antibiotic-resistance factors confer
susceptibility to phage infection through expression of conjugative pili (the receptor for filamentous phage), these results
suggest that phage may be a source of soluble proteins that slow the spread of antibiotic resistance genes.
Citation: Lin A, Jimenez J, Derr J, Vera P, Manapat ML, et al. (2011) Inhibition of Bacterial Conjugation by Phage M13 and Its Protein g3p: Quantitative Analysis
and Model. PLoS ONE 6(5): e19991. doi:10.1371/journal.pone.0019991
Editor: Mark Alexander Webber, University of Birmingham, United Kingdom
Received December 20, 2010; Accepted April 19, 2011; Published May 26, 2011
Copyright: ? 2011 Lin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: AL received support from the Harvard College Research Program (http://www.seo.harvard.edu). JJ and MLM are fellows of the Foundational Questions
in Evolutionary Biology at Harvard University sponsored by the John Templeton Foundation (http://www.fas.harvard.edu/,fqeb/). JD received a fellowship from
the Human Frontiers Science Program (http://www.hfsp.org/). KME received graduate fellowships from the Fannie and John Hertz Foundation (http://www.
hertzfoundation.org/) and the NSF (http://www.nsf.gov/). DRL acknowledges support from the Howard Hughes Medical Institute (http://www.hhmi.org/) and NIH
grant R01GM065400 (http://www.nih.gov/). This work was supported by NIH grant GM068763 to the National Centers of Systems Biology. IAC is a Bauer Fellow at
Harvard University (http://www.sysbio.harvard.edu/csb). The funders had no role in study design, data collection and analysis, decision to publish, or preparation
of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: ichen@post.harvard.edu
Introduction
Widespread bacterial resistance to an antimicrobial agent
typically occurs within three years of the introduction of a new
antibiotic [1,2]. Because mechanisms of resistance already exist for
antibiotics derived from natural sources, horizontal gene transfer
can rapidly transmit these mechanisms to pathogenic bacteria
under selective pressure from the antibiotic. Conjugation is
believed to be the major mechanism of transfer of antibiotic
resistance genes [3,4]. For example, individual cases of infection
by vancomycin-resistant S. aureus are believed to have arisen from
independent conjugation events within patients simultaneously
colonized by vancomycin-resistant enterococcus and methicillin-
resistant S. aureus [5]. The worldwide spread of extended-spectrum
b-lactamases, particularly the widely distributed CTX-M-15
enzyme, is due to mobile genetic elements including conjugative
plasmids from the IncF families (that encode F-like plasmids) [6].
Conjugative plasmids often carry resistance genes for multiple
antibiotics from different classes, such that selection for resistance
to one drug inadvertently selects for resistance to others [7]. For
example, CTX-M-15 is carried on plasmids that also encode
resistance genes against tetracycline and aminoglycosides [6]. In
principle, inhibiting conjugation could potentially prolong the
useful lifetime of antibiotics. For example, small-molecule
inhibitors of enzymes involved in conjugative gene transfer may
be useful in antimicrobial therapy [8].
Plasmids that enable bacterial conjugation encode a pilus that is
expressed from the donor cell and binds to the recipient cell,
mediating DNA transfer. Conjugation itself can occur between
distantly related species, but some plasmids, such as the well-
studied F plasmid, have a narrow host range (Enterobacteriaceae)
due to incompatibilities of the replication system [9,10]. Although
the plasmid may carry genes for antibiotic resistance, the presence
of a conjugative pilus can also confer a substantial disadvantage to
the host cell, since the pilus is used as the site of attachment for
certain DNA and RNA bacteriophages. In particular, the
filamentous phages are a family of single-stranded DNA phages
that attach to the tip of the conjugative pilus. The Ff family of
phages (M13, fd, and f1) attach to the F pilus, which retracts and
brings the phage into contact with the host cell coreceptor TolA,
leading to transfer of the phage genome into the cell. Infectivity is
mediated by the phage minor coat protein g3p, which contains
three domains separated by glycine-rich linkers. In the initial step
of phage infection, one N-terminal domain (N2) binds the tip of
PLoS ONE | www.plosone.org1 May 2011 | Volume 6 | Issue 5 | e19991
Page 2
the F pilus, followed by the other N-terminal domain (N1) binding
TolA, an integral membrane protein that confers colicin
sensitivity. The C-terminal domain anchors the protein in the
capsid and enables release of the phage particle from the host cell
[11]. These phages establish a chronic infection that reduces the
fitness of the host cell by 30–50% as phage particles are released
continually [12].
Several decades ago M13 phage was observed to inhibit
bacterial conjugation [13,14], but the mechanism was unknown.
Several possible explanations exist. First, phage reduce the fitness
of cells and therefore may cause F+ cells to decrease in relative
proportion over time, thereby eliminating conjugation donors.
Second, infection appears to cause pilus retraction, so the F+ cells
might not be competent as donors. Infection does reduce the
average number of pili per cell, but infected cells still possess pili
(from an average of 3.4 to 0.73 pili per cell) [15]. Third, the N-
terminal domains of g3p may block contact with a recipient cell
through physical occlusion of the F pilus or TolA. Overexpression
of the N-terminal domains of g3p, which leads to periplasmic
localization of the protein, was found to inhibit conjugation and
infection by Ff phage, indicating that g3p plays an important role
and that infection itself is not required for inhibition of conjugation
[16]. Furthermore, although tolA mutants are resistant to colicin
and filamentous phage infection, they do produce pili and
conjugate normally [17], suggesting that interference with TolA
is not the primary mechanism.
In this study, we demonstrate that non-replicating phage
particles inhibit conjugation at similar concentrations to replicat-
ing phage, indicating that expression of phage genes is not
necessary for phage-mediated inhibition of conjugation. Further-
more, exogenous addition of the soluble N-terminal domains of
g3p (g3p-N), a minor coat protein of M13, results in nearly
complete inhibition of conjugation at low nanomolar concentra-
tions, suggesting that interaction with the F pilus is the primary
mechanism of inhibition. Another effect, pili retraction upon
infection, plays a lesser but measurable role. We present a
quantitative model for conjugation in the presence of phage, in
which a simple binding equilibrium between phage (or g3p-N) and
F+ cells accurately describes the major effect of inhibition of
conjugation.
Results
Conjugation without phage
To determine the rate of conjugation, we mixed F+ cells
(TOP10F9; F9[lacIqTn10(tetR)]) expressing CFP (cyan fluorescent
protein) with a large excess of F2 cells (TOP10) expressing eYFP
(enhanced yellow fluorescent protein). We followed the appear-
ance of transconjugants over time during exponential growth in
liquid culture as the transconjugant fraction (i.e., fraction of F+
cells exhibiting yellow fluorescence). Without phage, this fraction
began at 0 after mixing and approached 1 during the course of the
experiment due to the large excess of F2 cells (Figure 1).
The simplest model that fits the data contains two parameters,
growth rate (kg) and conjugation rate (kc), based on the mass-action
model by Levin et al. [18], and can be described by the following
reactions:
cell
{
kg? 2 cells
Fz
cyanzF{
yellow{
kc? Fz
cyanzFz
yellow
Fz
yellowzF{
yellow{
kc? 2Fz
yellow
In this model, we assume that the growth rate of all cells is
identical. We measured growth rates of F+ and F2 cells in liquid
media and found that there is only a slight difference, if any
(Table 1). In our experiments, the high concentration of F2 cells
also permits the assumption that conjugation is zeroth-order with
respect to F2 cells [19]. This results in the following expression for
the transconjugant fraction over time (t) (Text S1):
Fzyellow
??
FzyellowzFzcyan
??~ 1{e{kc(t{t0)
The growth rate does not appear in this equation. The first-order
rate constant kccan be determined by fitting the data to this form
(Figure 1), resulting in an estimate of kc=0.42 /hr in the absence
of phage (t0=0.02 hr).
Figure 1. Conjugation without phage: Fraction of F+ + cells that
are transconjugants over time in the absence of phage. The line
is a fit to the model of conjugation (kc=0.42 /hr, t0=0.02 hr,
RMSD=0.05). Data were pooled from several independent replicates.
doi:10.1371/journal.pone.0019991.g001
Table 1. Exponential growth rates of cells in liquid media.
Cell typeFluorescence Phage or proteinkg(hr21)
F+
cyan none1.0960.03
F2
yellownone1.1860.11
F+
F+
F+
F+
cyan M13-kmR
0.7460.07
cyan M13-kmR
* 0.7360.09
yellownone 1.0960.11
cyan100 nM g3p 1.1160.09
F2
yellow100 nM g3p1.2560.20
F+
yellow100 nM g3p 1.1360.06
Growth rate was measured by OD over time, except in row four (*) in which
tetracycline-resistant colony counts were taken over time during conjugation
experiments.
doi:10.1371/journal.pone.0019991.t001
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org2 May 2011 | Volume 6 | Issue 5 | e19991
Page 3
Inhibition of conjugation by replicating M13 phage
We modified the commercially available phage M13KE by
inserting a kanamycin resistance cassette into the multiple cloning
site, thus enabling selection for infected cells when desired. As
expected, cells infected with M13-kmRexhibited a slower growth
rate (Table 1). To verify that M13-kmRinhibits conjugation, we
grew a culture of F+ cells infected by M13-kmRunder selection for
kanamycin resistance to prevent loss of infection (donor cells). We
further added varying amounts of purified M13-kmRphage to the
media at the beginning of the conjugation experiment. We found
that infected F+ cells conjugated with slightly reduced but still
good efficiency at low levels of externally added phage (e.g., 107
particles/mL), but the conjugation rate decreased as the phage
concentration increased, such that almost no transconjugants were
detected if the concentration of phage was $1011particles/mL
(Figure 2A). To check that this effect was not dependent on the
specific plasmids carrying fluorescent markers or on kanamycin
resistance, we also performed these experiments with F+ and F2
cells carrying marker plasmids based on pRG5, with the F+ cells
infected by M13-ampR. Similar results were obtained in this
alternative system (Figure 2B).
The observation that infected cells were still competent donor
cells suggested that most of the inhibition of conjugation is due to
the external addition of phage rather than the effects of phage on
the physiology of infected host cells. However, infected cells were
also somewhat poorer donors than uninfected cells (compare
Figure 2A and 2C; see Results: Model of inhibition of conjugation
by replicating phage). We further verified that external addition of
M13-kmRto initially uninfected cells also nearly totally inhibited
conjugation at high phage concentrations (Figure 2C).
Inhibition of conjugation by non-replicating phagemid
particles lacking phage genes
If expression of phage genes (e.g., g3p) in the host cell is not the
primary cause of reduced conjugation, then we expect that phage
capsids bearing g3p but encapsulating a non-replicating phagemid
lacking phage genes would also inhibit conjugation. We assayed
conjugation in the presence of varying concentrations of the non-
replicating phage (see Methods). We found that these particles
inhibit conjugation to a similar extent as M13-kmR, suggesting
that a component of the phage capsid, rather than phage gene
expression, is primarily responsible for inhibition (Figure 2D).
We hypothesized that the phagemid particles inhibit conjuga-
tion by simply binding to the tip of the F pilus and rendering
them incapable of contacting potential recipient cells. We
modeled this as a binding equilibrium between F+ cells and
phagemid particles, with dissociation constant Kd, in which the
complex formedis incapable
ge][F+]=Kd[complex]). This effectively reduces the concentra-
tion of competent donor F+ cells, such that the ratio a of the
conjugation rate in the presence of phage particles (kcphage) to the
basal conjugation rate (kc) is given by a=[F+]/([F+]+[com-
plex])=1/(1+[phage]/Kd). We fit the conjugation data in the
presence of the phagemid particles to the simple model of
conjugation and determined kcphagefor several phage concentra-
tions. The relationship between relative conjugation rate and
phage concentration could be fit using the binding equilibrium
(Figure 3), with apparent Kd=2 pM. This model could also be
naively applied to conjugation kinetics in the presence of
replicating phage (apparent Kd=2.4 pM; Figure S1). However,
the concentration of phage increases over time due to infection
and replication, so this procedure is likely to underestimate the
true affinity of the interaction.
of conjugation(i.e., [pha-
Inhibition of conjugation by minor coat protein g3p from
M13
Because most of the inhibition of conjugation could be
described well by a binding equilibrium between phage and host
cell, we hypothesized that the major effect was caused by g3p, the
N-terminal domains of which interact with the host receptor (F
pilus) and co-receptor (TolA), while the C-terminal domain is a
structural element of the phage coat [20]. To test the necessity of
the N-terminal domains of g3p for inhibition of conjugation, we
replaced these domains of M13-kmRwith the homologous
sequence from the related filamentous phage If1, which binds to
I pili rather than F pili [21]. This experiment therefore created a
functional knockout of g3p-N. The purified chimeric phage
formed a clear stock solution in TBS buffer, suggesting that
aggregation was minimal, and these phage also inhibited
conjugation mediated by the I plasmid (Figure S2). As expected,
the chimeric phage was not able to infect F+ cells, as assayed by
transmission of kanamycin resistance, and the chimeric phage did
not inhibit conjugation (Figure 4A).
To confirm that g3p was the causative factor, we obtained a
purified soluble fragment of g3p comprising the N-terminal
domains (g3p-N) [22]. Addition of this protein to the media
inhibited conjugation (Figure 4B), and the inhibition could be
described well as a simple binding equilibrium between protein
and F+ cells, similar to that described above for the non-
replicating phage particles (Figure 5). The dissociation constant of
this equilibrium was found to be 3 nM. The presence of g3p-N did
not alter the growth rate of cells (Table 1). Addition of bovine
serum albumin to high concentration did not appreciably inhibit
conjugation (Figure 4A, Figure 5).
To test whether surface presentation of g3p would affect the
conjugation rate, we bound g3p-N (His-tagged) to ion metal
affinity chromatography beads. No difference in conjugation rate
was observed at sub-saturating or saturating ratios of protein:bead
(Figure S3).
Replication rate of phage
The conjugative ability of infected cells was qualitatively lower
than that of non-infected cells (Figure 2A,C), especially at low
phage concentrations. To quantify this difference, we first
determined the replication rate of phage in order to model the
phage concentration in the media throughout the experiment. We
then fit the cell and phage concentration over time to a model of
growth and replication, described by the following equations:
Fz
infected
kginfected
2Fz
infected
Fz
infected{
kr? Fz
infectedzphage
We determined kginfectedfrom independent cell density measure-
ments in liquid culture. Therefore, we fit the phage replication
data with a single parameter krto obtain kr=60 /hr (Table 1;
Figure 6A), i.e., about 60 phage particles are produced per hour by
each infected cell.
Because this replication rate was somewhat lower than previously
reported values of $100 /hr [23,24], we checked whether our host
strain produced a lower phage titer than less extensively modified
strains(e.g., Top10F9 is a recA- strain). We grewan overnight culture
of M13-ampRusing a relatively wild-type strain, E. coli ER2738,
purified the phage, and obtained a plaque-forming titer of
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org3May 2011 | Volume 6 | Issue 5 | e19991
Page 4
261011pfu/mL from the original culture. This also established the
conversion factor of 261012pfu/mL per A270unit per cm. We
repeated this experiment for M13-kmR
concentration of 261011pfu/mL of the original culture according
to the absorbance measurement. To compare with E. coli TOP10F9
as the host strain, we measured plaque formation from a saturated
overnight culture, which gave a titer of 561010pfu/mL. We also
measured phage concentration from a saturated culture by ELISA
detecting the major coat protein g8p and found a concentration of
361010particles/mL, indicating that the ELISA assay and plaque-
forming titer give similar estimates. Therefore, the use of TOP10F9
appeared to decrease phage production by approximately 5-fold
(perhaps due to its recA1 genotype), possibly accounting for the
reduced replication rate of our system.
and also found a
Model of inhibition of conjugation by replicating phage
Since we had independently determined the growth rates, effect
of phagemid particles on conjugation rate and the replication rate
of phage, there were only two unknown parameters when
modeling conjugation with replicating phage: the infection rate
of F+ cells by phage (ki) and the relative donor ability (R) of
infected cells vs. uninfected cells. The relevant reactions are as
follows, where F+refers to either yellow or cyan F+ cells, and
a=[1/(1+[phage]/Kd)] as before. Again, the concentration of F2
cells in our experiments was sufficiently high that rate of
conjugation was considered independent of [F2].
Fz
kFz
g
2Fz
Figure 2. Transconjugant fraction over time with varying levels of phage or phagemid particles. For visual clarity, each line represents a
single experiment, although multiple experiments were performed to accurately determine the conjugation rate. Inhibition of conjugation by
replicating M13 phage: (A) M13-kmR(dark blue=not infected; for pre-infected F+ cells, light blue=107pfu/mL, green=108pfu/mL,
yellow=109pfu/mL, orange=1010pfu/mL, red=1011pfu/mL); (B) M13-ampR(dark blue=not infected; for pre-infected F+ cells, light blue=106
pfu/mL, green=108pfu/mL, yellow=109pfu/mL, orange=1010pfu/mL, red=1011pfu/mL); (C) M13-kmR(F+ cells were not pre-infected; blue=not
infected, green=108pfu/mL, yellow=109pfu/mL, orange=1010pfu/mL, red=1011pfu/mL). (D) Inhibition of conjugation by non-replicating
phagemid particles lacking phage genes: phagemid particles (blue=no phagemid particles added, green=108cfu/mL, yellow=109cfu/mL,
orange=1010cfu/mL, red=1011cfu/mL).
doi:10.1371/journal.pone.0019991.g002
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org4 May 2011 | Volume 6 | Issue 5 | e19991
Page 5
F{
yellow
kF{
g
2F{
yellow
FzzF{
yellow
akc
FzzFz
yellow
Fz
infected
kinfected
g
2Fz
infected
Fz
infectedzF{
yellow
Rakc
Fz
infectedzFz
yellow
Fzzphage
ki
Fz
infected
Fz
infected
kr
Fz
infectedzphage
To determine R and ki, the data from multiple conjuga-
tion experiments in the presence of varying concentrations of
M13-kmR were fit to this model (Figure 6B). The values that
minimized the sum of squares of the deviations between model
and experimental data were R=0.2 and ki=1028/hr. Because
the experimental measurement of transconjugants over time is
only an indirect measure of these parameters, we checked the
robustness of the imputed values (see Text S1). The value of R was
found to be robust to error, but kiwas not, indicating that these
data were not suitable to impute ki, and that the model fits were
insensitive to changes in ki.
Relative piliation of infected cells
To determine whether infected cells have reduced piliation in
our system, perhaps accounting for a drop in donor ability upon
M13 infection, we used fluorescently labeled phages specific for
the F pilus (M13 and the RNA phage R17) to quantify the F pili
associated with infected vs. uninfected cells. We found that
infected F+ cells were characterized by approximately 2.5-fold less
fluorescence than uninfected F+ cells, indicating reduced piliation.
Test for loss of F factor
Although mechanisms exist to ensure proper segregation, the F
factor can be lost at a low rate. Previous studies had indicated that F
factor loss may be accelerated in the presence of filamentous phage
Figure 3. Inhibition of conjugation by non-replicating phage-
mid particles lacking phage genes: Inhibition curve for
conjugation reflects the association between phagemid parti-
cles and F+ + cells. The y-axis is the conjugation rate k normalized by
the conjugation rate in the absence of phage (k0); error bars are
standard deviation from replicates. The line represents the fit to a
binding equilibrium (Kd=2 pM; RMSD=0.03).
doi:10.1371/journal.pone.0019991.g003
Figure 4. Inhibition of conjugation by minor coat protein g3p from M13. (A) Negative controls do not show inhibition of conjugation. Red
line: BSA (100 nM). Blue line: chimeric phage (1011pfu/mL). Replicates are shown. (B) Inhibition of conjugation by the soluble fragment of g3p. For
visual clarity, each line represents one experiment, and error bars are standard deviation calculated from different platings in the same experiment.
Multiple experiments were performed to estimate the conjugation rate. Dark purple=no protein; light purple=0.1 nM g3p-N, dark blue=0.5 nM,
light blue=1 nM, green=5 nM, yellow=10 nM, orange=100 nM, red=250 nM.
doi:10.1371/journal.pone.0019991.g004
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org5 May 2011 | Volume 6 | Issue 5 | e19991
Page 6
[25]. To determine whether F factor loss occurred in our
experiments, we measured the apparent growth rate of the original
F+ cells during our conjugation experiments by counting cyan
fluorescent colonies on media containing tetracycline (Table 1). If
there had been substantial plasmid loss, the growth rate measured
for tetracycline-resistant colonies would be lower than the growth
rate measured by optical density in bulk solution. We found no
significant difference between these measurements, suggesting that
F factorlossdid not occur to a substantial extent inour experiments.
Discussion
The rapid increase in prevalence of bacterial pathogens that are
resistant to multiple antibiotics has sparked investigation of new
strategies for controlling infection. Conjugative plasmids have
attracted attention as potential targets because of the high
frequency of antibiotic resistance arising from conjugation, which
can be .105times as frequent as spontaneous chromosomal
mutation conferring resistance, and indeed resistance against b-
lactams and aminoglycosides has been largely spread by
conjugative transfer [26]. In addition, conjugative plasmids readily
transmit multiple resistance genes. For example, Klebsiella pneumo-
niae EK105, a gram-negative pathogen that can cause refractory
neonatal meningitis, carries resistance against 10 antibiotics on
two plasmids (one conjugative and one mobilizable plasmid) [27].
Since conjugation can occur between closely related (e.g., within
Enterobacteriaceae) or distantly related organisms (e.g., gram-
positive to gram-negative), inhibiting conjugation has been
suggested as a strategy to prevent or slow the spread of antibiotic
resistance genes to dangerous pathogens [28]. Work in this
direction has previously focused on inhibiting apparatus involved
in DNA transfer [8]. In this work, we instead study a mechanism
for blocking the formation of conjugal pairs. We expand upon a
classic observation that filamentous phage inhibit conjugation and
demonstrate that g3p, a coat protein of M13, can essentially
completely block conjugation in liquid media.
We developed a simple mass-action model conjugation based on
that of Levin et al. [18]. This simple model neglects two lags that
are known to occur: 1) the donor cell takes some time to recover
before it can act as a donor again, and 2) the transconjugant does
not act as a donor cell immediately [29,30]. Nevertheless, the
model fit the kinetic data of transconjugant appearance well,
suggesting that the simplifying assumptions of the mass-action
model are reasonable within the experimental noise under these
conditions. Under our experimental conditions of high F2 cell
concentration and exponential phase growth, the rate of
conjugation could be assumed to be independent of F2 (recipient)
concentration. We further extended the mass-action model to
include the effect of replicating and non-replicating bacteriophage
M13 derivatives and minor coat protein g3p on conjugation and
growth rate.
Figure 6. Model and experimental data for phage replication in F+ + culture (all cells infected). (A) Replication rate of phage. The y-axis
is the phage (red) or cell (blue) concentration over time. Experimental data are shown with the dotted lines; model fit is shown with the solid lines
(kr=60 /hr, RMSD=36109units/mL). (B) Model of inhibition of conjugation by replicating phage: Example of conjugation data (in this
example, M13-kmRwas added to 109pfu/mL; cells were pre-infected), with fit to determine R and ki. Data are shown in red and purple (two
replicates), with model fit shown in blue (R=0.2, ki=1028 /hr; RMSD over all conjugation trials=0.32).
doi:10.1371/journal.pone.0019991.g006
Figure 5. Inhibition of conjugation by minor coat protein g3p
from M13: Inhibition curve for conjugation in the presence of
g3p-N protein (red) or BSA (blue). Line represents model fit to a
binding equilibrium (Kd=3 nM; RMSD=0.1). Error bars indicate
standard deviation from experimental replicates.
doi:10.1371/journal.pone.0019991.g005
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org6 May 2011 | Volume 6 | Issue 5 | e19991
Page 7
The parameters resulting from fitting our data appear to be
reasonable given what is known about conjugation and infection.
The apparent first-order conjugation rate constant of 0.42/hr was
calculated from the simple mass action model applied to
conjugation in the presence of a large excess of F2 cells (.107
cells/mL), without phage. Levin et al. determined a second-order
conjugation rate constant of 261029mL/cell/hr for F-lac-pro
exponentially growing cultures with cell densities in the order of
magnitude of 108cells/mL, which corresponds to an apparent
first-order rate constant of roughly 0.2 /hr [18]. Our assumption
of apparent first-order kinetics that depend on F+ concentration
but not F2 concentration was based on the saturation phenom-
enon observed previously [19], in which the conjugation rate was
found to be independent of recipient concentration at recipient
densities .86106cells/mL. The good fit to our data indicates this
is a reasonable assumption.
To model experiments including replicating phage, we also
determined the phage replication rate (kr) and the relative donor
ability (R) of infected vs. non-infected cells. The replication rate kr
was found to be 60/hr. This value is lower than that reported in
the literature ($100 /hr) for wild-type Ff phage [23,24]. We
believe this discrepancy is due in large part to the choice of host
strain, since TOP10F9, a DH10B strain optimized for cloning,
gave a 5-fold lower maximum titer than ER2738, a K12 E. coli
strain used for phage propagation, thereby accounting for the
difference between our measured replication rate and that
reported previously. Another possible source of difference is the
phage construct, since insertion of genes is likely to reduce
efficiency of phage production.
We found that infection alone did indeed decrease donor ability
by a factor of ,5, independent of the external concentration of
phage (R=0.2). This effect quantitatively matches the effect that
would be expected from the previously observed 4 to 5-fold
decrease in F pili elaboration in infected cells (from an average of
3.4 to 0.73 pili per cell) [15]. We also quantified piliation in our
system using fluorescently labeled F-specific phages (R17 or M13).
This assay showed that infected Top10F9 cells have approximately
2.5-fold less pili than uninfected cells, in reasonable agreement
with the observed effect on donor ability, although additional
physiological factors reducing donor ability cannot be ruled out.
As resistance to antibiotics becomes more widespread among
pathogenic bacteria, research into the potential medical utility of
bacteriophages and their protein products is of particular interest.
For example, a lytic enzyme isolated from a streptococcal phage
can eliminate pneumococcal infection in a mouse model [31], and
T7 phage expressing an enzyme that digests a component of
extracellular polymeric substances, dispersin B, can effectively
penetrate E. coli biofilms and lyse the cells contained within [32].
Filamentous phage in particular have been used recently to deliver
genes that enhance the effect of antibiotics by blocking the SOS
pathway in bacterial cells [33], and the addition of filamentous
phage inhibits formation of bacterial biofilms due to interference
with the formation of mating pairs [34]. The inhibition of
conjugation by filamentous Ff phage was first observed several
decades ago [13], but the dose-response curve and mechanism
were not determined. Because conjugation is believed to be a
major route of transfer of antibiotic resistance genes, we quantified
the effect of phage M13 on conjugation and found that the
mechanism of inhibition appears to be primarily a physical
interaction between minor coat protein g3p and the host cell. This
is particularly important at higher phage concentrations (i.e.,
above the Kd, or .2 pM or 109particles/mL). At sufficiently high
concentrations of phage, conjugation is essentially completely
blocked.
An additional likely mechanism is the reduction in pili per cell
after phage infection. This is in quantitative agreement with our
observation that infection itself decreases donor ability by a factor
of ,5 (R=0.2). Although this is a small contribution at high
phage concentrations, it could be an important factor at low
phage concentrations. In other words, at low levels of phage
infection, the donor ability of the infected cells would be
somewhat decreased but conjugation would continue. As infected
cells secrete phage particles and the extracellular concentration
approaches 109particles/mL, then conjugation would rapidly
become nearly completely inhibited through occlusion of the F
pili. Another possible mechanism of inhibition is the decreased
fitness of infected F+ cells; if this fitness cost were high enough,
the F+ cells would die out and thus stop conjugation. However,
phage particles that transmit a phagemid that is incapable of
replicating inside the host cells show a similar level of inhibition
as M13-kmRphage, indicating that infection is not required for
inhibition.
Finally, overexpression of the N-terminal domains of g3p in E.
coli has been found to cause several membrane-related defects,
including increased permeability, tolerance to colicins, and
reduced conjugative ability [16]. We found that phage infection
itself reduced the conjugation rate by a relatively small factor,
suggesting that expression of g3p in its usual physiological context
does not show the same phenotype as overexpression in isolation,
possibly because g3p is normally sequestered by packaging into
phage particles. In particular, the overexpressed N-terminal
fragment of g3p is transported through the inner membrane to
the periplasmic space, where it may interact with the F pilus,
whereas full-length g3p is trapped in the membrane until it is
packaged and released.
We hypothesized that g3p inhibited conjugation by physical
occlusion since g3p is known to interact with the F pilus, and a
soluble fragment of g3p delays infection by phage fd when added
exogenously [35]. The N-terminal domains of g3p confer
infectivity by binding to the host receptor (F pilus) and coreceptor
(TolA) [20]. Indeed, exogenous addition of the soluble fragment of
g3p comprising the N-terminal domains inhibited conjugation,
while addition of a non-specific protein, BSA, did not.
The apparent Kd of whole phage (2 pM) differed from the
apparent Kdof the soluble fragment of g3p (3 nM) by a factor of
approximately 1000. One important distinction between the
phage and g3p protein is that phage binding is essentially
irreversible [36], likely due to events downstream of g3p binding,
when the phage capsid fuses with the cell membrane and the
phage genome is transferred into the cytoplasm of the host cell.
Since Kdreflects the balance between the binding and dissociation
reactions, the very low reversibility of phage binding could account
for the large difference between phage and soluble protein.
Another contributing factor could be avidity through cooperativity
among several g3p molecules in the same capsid, since each phage
particle contains 3–5 copies of g3p in close proximity at one end of
the filament [37]. We attempted to mimic an avidity effect using
beads saturated with immobilized g3p-N, but this presentation did
not affect the conjugation rate. Since the geometry of phage-
bound g3p is not necessarily correctly modeled by bead-bound
g3p, this result does not exclude the possibility that avidity may be
an important effect. Finally, a technical possibility is that the
purified soluble fragment of g3p differs in conformation from g3p
in its native context. However, this fragment of g3p has been
previously crystallized and found to be structurally similar to
homologous proteins from other filamentous phage [22].
We have demonstrated that conjugation mediated by the F
factor can be effectively inhibited by exogenous addition of
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org7 May 2011 | Volume 6 | Issue 5 | e19991
Page 8
nanomolar concentrations of a soluble protein derived from M13,
and by picomolar concentrations of a non-replicating phage. This
result suggests that the filamentous bacteriophages that target the
conjugative pili may be a source of candidate biomolecules for
slowing the spread of antibiotic resistance genes. A large
proportion of conjugative resistance (R) factors from natural
isolates are related to the F plasmid (i.e., fi+ plasmids), and the F-
specific phages infect many strains bearing R factors [38]. As with
the F factor, infection by M13 has been observed to lead to loss of
an R factor in the cell population [25,39].
While the F factor is the most well-studied conjugative system,
others exist and can be responsible for the dissemination of
medically important resistances [3]. More work is required to
determine if this strategy could be applied in a realistic setting
and whether it would be possible to extend this strategy to cover
the most common conjugative systems. This strategy does
present challenges. For example, cells may shed F pili into the
media, requiring additional phage to bind free pili. The severity
of this problem would presumably depend on the environmental
conditions as well as the host strain. As with any negative
selective pressure, cells may evolve to resist the inhibition of
conjugation. Indeed, one advantage of g3p and phage proteins
in general is that, in contrast to small organic molecules, a large
number of variants could be readily evolved or engineered in
the laboratory, potentially countering bacterial evolution.
Another possible challenge is that conjugation may occur in
environments or bacterial life-cycle stages that are not easily
accessible to therapeutic intervention, although some important
scenarios may be appropriate targets. For example, genotyping
of R factors in two outbreaks of b-lactam resistant infections in
the same burn unit was highly suggestive of conjugative transfer
of R factor from Pseudomonas aeruginosa to Klebsiella aerogenes within
a patient simultaneously harboring both organisms in his
wounds [40]; such wounds might present an opportunity for
conjugation inhibitors to curb antibiotic-resistant outbreaks. On
the other hand, granulomatous infections might be inaccessible
to similar therapy. Finally, other mechanisms for gene transfer
may compensate for reduced conjugation, limiting the utility of
this strategy. Nevertheless, the inhibition of bacterial conjuga-
tion may be worthy of further investigation as the use of
antibiotics continues to favor the acquisition of resistance genes
by pathogenic bacteria.
Methods
Bacterial strains, culture conditions, phage propagation
and titering (Table 2)
E. coli TOP10F9 and TOP10F (Invitrogen; mcrA D(mrr-
hsdRMS-mcrBC) w80lacZDM15 DlacX74 recA1 araD 139 (ara leu)
7697 galU galK rpsL (StrR) endA1 nupG) were used as a donor (F+)
or recipient (F2), respectively (F9 plasmid: [lacIq, Tn10(TetR)]). E.
coli TG1 [41] (supE hsdD5 thi D(lac-proAB) F9(traD36 proAB+lacIq
lacZ DM15)) and E. coli ER2738 (New England Biolabs;
F9proA+B+lacIqD(lacZ)M15 zzf::Tn10(TetR)/fhuA2 glnV D(lac-
proAB) thi-1 D(hsdS-mcrB)5) were used for cloning and phage
propagation, respectively. DH10B with the pir116 gene replacing
the proBA locus was used for R6K replication to produce non-
replicating phagemid particles (helper phage/phagemid system).
This strain was recombineered using the protocol of Datsenko
and Wanner [42].
Standard protocols were used for common bacterial and phage-
related procedures [41]. All strains were grown in LB medium on
a regular basis. Medium 26TY was used for conjugation
experiments. When needed, media were supplemented with
ampicillin or carbenicillin (100 mg/mL), tetracycline (12 mg/mL),
kanamycin (50 mg/mL) and isopropyl-b-D-1-thiogalactopyrano-
side (IPTG) (1 mM).
Cells used for M13 phage propagation were cultured in
400 mL of LB and phages were recovered from the culture
supernatant after removing cells debris by two successive
precipitations with a 2.5 M NaCl/20% w/w PEG 8000 solution
and resuspension in TBS buffer. In the case of R17 propagation,
Table 2. Strains, plasmids, and phages used in this study.
Type NameSourceNotes
Bacterial strainE. coli TOP10F9
Invitrogen Donor strain, F+
E. coli TOP10Invitrogen Recipient strain, F2
E. coli TG1StratagenePhage cloning, protein production
E. coli ER2738New England BiolabsPhage propagation
E. coli DH10B/pir116This work Production of non-replicating phage
E. coli ATCC 27065ATCCI+ strain
PlasmidpRG5D. Lovley [43]Marker plasmid
pRG5_gfpD. Lovley [43] Fluorescent marker plasmid
pTrc99A-eYFPH. Berg Fluorescent marker plasmid
pTrc99A-eCFPH. Berg Fluorescent marker plasmid
pET21(g3p-N)This work [22,45]Protein expression
Phage M13-ampR
This work
M13-kmR
This work
Chimeric phage This workM13-kmR(If1-g3p-N) D.(M13
,–g3p-N)
HPdOUnpublished; GenBank HQ440210 Helper phage with deleted f1 ori
R17P. M. Silverman [46]F-specific RNA phage
PhagemidpJC126bUnpublished; GenBank HQ440211 pir-dependent replication
doi:10.1371/journal.pone.0019991.t002
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org8 May 2011 | Volume 6 | Issue 5 | e19991
Page 9
250 ml of host cells E. coli TG1 were grown until they reached
OD600=1 and were infected with 109pfu of phage; the culture
was incubated overnight at 37 degrees. Lysates were generated by
adding 1 ml of lysis solution (0.1 mg/ml lysozyme, 0.01 M
EDTA, 1 M Tris-HCl pH 7.5) and chloroform 1% v/v and
incubating for one hour at room temperature with agitation.
Next, 1 mg/ml of DNaseI (Sigma) was added to the lysates and
they were incubated for 1 h at 4uC. Cell debris was removed by
two steps of centrifugation at 5000 and 20,000 rpm respectively,
and R17 phages present in the supernatants were recovered as
described for M13. Phage concentration was estimated by
measuring the absorbance of the sample at 273 nm (assuming a
conversion factor of 261012pfu/mL per unit of absorbance per
cm), and by infecting E. coli TOP10F9, TG1 or ER2738 for 1 h at
37uC using an appropriate dilution of the phage. After plating on
selective media and incubating for .16 h at 37uC, the number of
colony-forming units (cfu)/mL was determined. Alternatively,
plaque-forming titers were determined following a standard
protocol. Phage particles were stored at 4uC for up to several
months.
Plasmids, phagemids, and phage genomes used in this
study (Table 2)
DNA was manipulated using standard methods [41]. Plasmids
pRG5 (SpcR) and the variant pRG5_gfp encoding GFP under the
control of a Plac promoter were a kind gift from D. Lovley’s lab at
the University of Massachussetts, Amherst [43]. Plasmids
pTrc99A-eYFP and pTrc99A-eCFP (AmpR) encoding, respective-
ly, eYFP (Q95M; yellow) and eCFP (A206K; cyan) were courtesy
of H. Berg at Harvard University.
Phage genomes were constructed using M13KE (New
England Biolabs) as a scaffold. M13KE-NotI, which has a NotI
restriction site inserted in frame with the g3p gene between the
N and C-terminal domains, was constructed using Stratagene
QuikChange XLII kit for site-directed mutagenesis using
primersNotIplus(59-CCTCCTGTCAATGCGGCCGCAG-
GCTCTGGTGGTGG) and NotIminus (59-CCACCACCAG-
AGCCTGCGGCCGCATTGACAGGAGG). M13-ampRwas
prepared by inserting an ampicillin resistance cassette (bla)
into M13-KE. The bla gene was PCR amplified using primers
bla1 (59-TAGCCCAAGCTTGATGAGTATTCAACATTTC-
CG)and bla2(59-TCGCTGAATTCTTGAGTAAACTT-
GGTCTGAC) and the vector pCyanscriptIIKS(-) (Stratagene)
as a template for the reaction. The PCR product was digested
using EcoRI/HindIII restriction enzymes and cloned in the same
sites present in M13KE-NotI. M13-kmRwas constructed under
the same scheme using oligonucleotides HindIII_Km_F (59-
GACTACAAGCTTTATGAGCCATATTCAACGGGAAAC)
and EcoRI_Kan_R (59-GTAGTCGAATTCGTGTTACAAC-
CAATTAACCAATTCTG), and the transposome EZ-Tn5
,KAN-2. (Epicentre) as a template. The gene fragment
encoding the 250 amino acids of the g3p homolog protein from
If1 phage (NC_001954) comprising A11 through T260 was
cloned into the M13-kmRscaffold. The fragment was amplified
by PCR using the dsDNA from If1 phage as a template and the
oligonucleotides If5 (59- AAGGTACCTTTCTTTACCCATG-
CAACTACAGACGC) and If3 (59-AAGCGGCCGCCGTAA-
CCGTATCAGTTATCAAAACAGC). The resulting 754 bp
DNA fragment was digested using KpnI and NotI restriction
endonucleases and cloned into M13 digested with the same
enzymes, generating a translation fusion between the N-
terminal domain of the g3p homolog from If1 and the C-
terminus of the same protein from M13.
Non-replicating phagemid particles lacking phage genes
(Table 2)
To generate these phages, we used a pir+ bacterial strain
transformed by a helper plasmid encoding all phage genes but
lacking the f1 origin of replication and packaging signal. This
strain was also transformed with the pJC126b phagemid, which
utilizes the R6K and f1 origins of replication and carries genes for
chloramphenicol resistance and YFP. The phagemid is therefore
packaged into particles by a pir+ strain but cannot propagate upon
infection of a pir- host strain, such as TOP10F9. Helper phage
HPdO is an engineered variant of VCSM13 (Stratagene) that lacks
the original f1 phage origin and the packaging signal (GenBank
accession number HQ440210). Phagemid pJC126b (GenBank
accession number HQ440211) also contains the pir-dependent
R6K origin in addition to the f1 origin, catR, and YFP. Both
constructs were made by uracil excision cloning [44]. E. coli
DH10B (pir116 DproBA) cells transformed with helper phage and
phagemid pJC126b were used to produce viral particles that were
unable to replicate in TOP10F9 cells. We purified these phagemid
particles and verified that while the titer of purified stock on pir+
cells was 1012chloramphenicol-resistant cfu/mL, no colonies
formed on our TOP10F9-derived host cells at the tested dilutions
of the stock titer. Therefore, the titer on TOP10F9 was more than
105-fold less than the titer on pir+ cells, indicating a defect of
greater than five orders of magnitude for replication on TOP10F9.
Cloning, expression and purification of the N-terminal
domains of g3p from M13
The protein comprising the N-terminal domains of g3p (g3p-N)
from M13 was expressed following the protocol previously
described by P. Holliger and collaborators [22,45]. Gene synthesis,
expression and purification were carried out by BioBasic Inc.
(Canada). Briefly, the g3p fragment comprising A19 to A237 was
fused at the N-terminus to the 21 amino acids corresponding to the
PelB leader sequence for secretion to the periplasm, and at the C-
terminus to a 6His tag for purification. The sequence of the
engineered gene is given in Text S1. The DNA resulting from the
gene synthesis was cloned using EcoRV restriction endonuclease
into a variant of pUC18 plasmid, pUC57, for sequencing. The
gene was then subcloned using NdeI and XhoI restriction sites into
vector pET21, enabling expression of the gene fused to an ATG
codon in a NdeI site included in the polylinker that harbors a
strong RBS. This plasmid (Table 2) was transferred to E. coli TG1
cells and the protein was expressed and obtained from the
bacterial periplasm by resuspension of cells into ice-cold 5 mM
Mg2SO4 and stirring during 10 min on ice followed by
centrifugation and recovery of the supernatant. The mixture of
proteins was loaded into a Ni2+affinity column and g3p-N was
further purified by gel filtration. The quality of the sample was
verified by BioBasic, Inc. SDS-PAGE analysis showed a single
band, the protein was 98% pure by HPLC, and the correct
molecular weight was found by mass spectrometry.
Conjugation experiment
The rate of conjugation was estimated by co-culturing F+
(donor) and F2(recipient) cells. Separate overnight cultures of
TOP10F9 (transformed by pTrc99A-eCFP) and Top10 (trans-
formed by pTrc99A-eYFP) were inoculated in 3 mL of LB with
ampicillin, IPTG, and tetracycline if appropriate. The fluorescent
markers were expressed from ampRselectable plasmids and
facilitated identification of new transconjugants, which would be
tetRand yellow fluorescent. For experiments using pre-infected F+
cells, the overnight culture was inoculated from an infected colony
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org9May 2011 | Volume 6 | Issue 5 | e19991
Page 10
grown on media with the appropriate antibiotic to select for phage
(carbenicillin or kanamycin), and the overnight culture was also
grown with this antibiotic in the media. The next morning, 30 ml
of the overnight culture was used to inoculate separate tubes
containing 3 mL of 26TY with ampicillin and IPTG. Cells were
grown at 37uC and 200–250 rpm until they reached OD600of
0.2–0.3, determined using an Ultrospec cell density meter (GE
Healthcare). The amount of phage added to the conjugation
experiment due to addition of the infected F+ culture alone was
,106particles/mL, as determined by ELISA assay on the
supernatant. The ELISA assay gave quantitatively similar results
to a plaque-forming assay for M13-kmR(see Results: Replication
rate of phage). The number of physical particles, as opposed to
plaque- or colony-forming units, appeared to be the most
important contributor to the inhibition of conjugation (see Results:
Inhibition of conjugation by non-replicating phagemid particles
lacking phage genes).
The conjugation experiment was initiated by diluting the
exponentially growing F+cells by a factor of 100 in 26TY and
adding 150 ml of this preparation to the 3 mL of exponentially
growing F2cells at OD 0.2–0.3 (1:2000 ratio of donor:recipient).
Phage particles, protein stock or beads coated with protein were
also added at this point if desired. Coated beads were prepared as
follows: Dynabeads His-Tag Isolation&Pulldown (Invitrogen) were
washed with TBS buffer and then incubated with the appropriate
amount of protein for 10 min at RT in the same buffer
supplemented with 0.6 M NaCl. Binding of the proteins to the
beads was confirmed by SDS-PAGE. The mixture was vortexed
briefly and incubated at 37uC at 200 rpm. We verified that
cultures grown under these conditions for 3.5 hours remained in
exponential phase throughout the experiment by following the
OD600in a pilot experiment. Aliquots were removed from this
mixture at different times up to 3.5 hours, diluted appropriately,
and plated into H-agar medium supplemented with tetracycline,
carbenicillin and IPTG, to minimize the effect of plate-to-plate
variation in absolute colony counting. After an overnight
incubation, the plates were scanned on a Typhoon TRIO
variable-mode imager (Piscataway, NJ) using cyan laser excitation
and detection at 488 nm. The colonies on each plate were either
high or low fluorescence, corresponding to yellow and cyan
fluorescence respectively, and the counts were recorded. When
using cells transformed with pRG5 or pRG5_gfp, fluorescent
colonies were detected on a Dark Reader (Clare Chemical
Research, Inc., Dolores, CO).
Enzyme-linked immunosorbent assay (ELISA) for phage
Phage concentration was determined using the Phage Titration
ELISA kit (Progen) as indicated by manufacturer. Briefly, the
phage concentration in a sample was determined by binding them
to ELISA plates coated with a peroxidase-conjugated monoclonal
antibody that specifically recognizes the major coat protein g8p.
After binding and washing, wells were developed by adding
hydrogen peroxide and the substrate tetramethyl benzidine (TMB)
and the amount of phages is estimated by registering the A450of
the sample. A standard curve was generated using kit control
sample. Test samples included supernatants or phage stocks
diluted in TBS.
Phage replication in F+ cells
To determine the replication rate of phage in infected F+ cells,
we grew a culture of F+ cells infected by M13-kmRand measured
the cell density over time by OD600. We also measured the phage
concentration over time by removing an aliquot of the culture,
pelleting the cells, and analyzing the supernatant by ELISA
detecting the major coat protein of M13. F+ cells were inoculated
as given for the conjugation protocol. If the OD600.1, the culture
was diluted with media appropriately to bring the density into the
linear range of the cell density meter. Aliquots were removed at
time points and the cells were spun down, and the supernatant was
stored on ice until the end of the experiment, when ELISA was
performed on all the supernatant samples. An analogous
experiment was performed with a 1:2000 mixture of F+ to F2
cells to simulate the conditions of a conjugation experiment. Data
from this second experiment were used in combination with the
conjugation data to estimate R and ki.
Preparation of fluorescent phages
Fluorescent M13 and R17 phages were prepared using a
modified version of a protocol described in a previous work [46].
Typically, 0.5–1 ml of phages around 1012pfu/ml were dialyzed
for 4 h at 4uC against a solution containing 0.1 M NaHCO3
(pH 8.5)/1 mM MgCl2. The solution was changed once and left
overnight at 4uC. Alexa 488 carboxylic acid (succinimidyl ester;
Invitrogen) (1 mg) was dissolved in 0.1 ml of anhydrous DMSO
and stored in 10 ml aliquots. One aliquot was added to each of the
phage preparations and the mixtures were incubated for 1 hour at
room temperature with agitation. After that, phages were
recovered and washed by two successive steps of precipitation
with PEG/NaCl as described previously.
Fluorescent phage binding and fluorescence
measurements
Cultures (cyan F2, cyan F+ and cyan F+ preinfected with M13)
were grown in LB media until mid-exponential phase, and 0.2 ml
aliquots were incubated with 10 ml of fluorescent phages for
15 min at room temperature. Cells were recovered by centrifu-
gation at 13,000 rpm and resuspended in 0.2 ml of M9 medium.
The relative number of cells was estimated by measuring the
constitutively produced CFP present in all cultures using an
excitation wavelength of 444 nm and emission wavelength of
460 nm. Binding of Alexa 488 fluorescent phages was determined
using an excitation wavelength of 485 nm and emission wave-
length of 530 nm. Measurements from F2 cells were used to
correct for background autofluorescence. All fluorescence mea-
surements were performed in a Spectramax Gemini XS plate
reader (Molecular Devices). The relative piliation was calculated as
the ratio between the signals obtained for Alexa 488 and cyan.
Standard deviations were calculated from three independent
experiments.
Fitting models to experimental data
The differential equations corresponding to the chemical
equations were solved by hand or by Mathematica to obtain the
time evolution of the variables with the appropriate free
parameters. The experimental data were fit by minimizing the
sum of the squares of the deviation between the data and the
model. More modeling details are given in the Text S1.
Supporting Information
Figure S1
phage. The simple binding model can be naively fit to the
conjugation data for replicating phage (no pre-infection). The
model fit is given by the line (Kd=2.4 pM). Experimental data
points are shown with error bars corresponding to standard
deviation among replicates. This model does not take into account
phage replication and infection.
(TIFF)
Inhibition of conjugation by replicating M13
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org 10May 2011 | Volume 6 | Issue 5 | e19991
Page 11
Figure S2
chimeric phage. The number of tetracycline-resistant (I+)
colonies was measured over time during conjugation of E. coli
ATCC27065 and TOP10 in the presence (gray squares) or
absence of chimeric phage (black circles). The chimeric phage was
present at a concentration of 1011pfu/ml.
(TIFF)
Inhibition of I-mediated conjugation by
Figure S3
g3p-N. The transconjugant fraction was measured over time in the
presence of free g3p-N (3.8 nM; yellow line), beads without g3p-N
(red line), or in the presence of an equivalent amount of g3p-N
bound at a sub-saturating density of 104molecules/bead (brown
line) or at a saturating density of 105molecules/bead (blue line).
(TIFF)
Conjugation in the presence of immobilized
Text S1
(DOC)
Acknowledgments
We are grateful to Philipp Holliger, Matthew Waldor, and Andrew Murray
for advice and to Erin O’Shea for use of imaging equipment.
Author Contributions
Conceived and designed the experiments: AL JJ LV DRL IAC. Performed
the experiments: AL JJ PV IAC. Analyzed the data: AL JJ MLM JD.
Contributed reagents/materials/analysis tools: KE JD MLM. Wrote the
paper: IAC JJ DRL.
References
1. Medeiros AA (1997) Evolution and dissemination of beta-lactamases accelerated
by generations of beta-lactam antibiotics. Clin Infect Dis 24 Suppl 1: S19–45.
2. Maple P, Brumfitt W, Hamilton-Miller JM (1990) A review of the antimicrobial
activity of the fluoroquinolones. J Chemother 2: 280–294.
3. Barlow M (2009) What antimicrobial resistance has taught us about horizontal
gene transfer. Methods Mol Biol 532: 397–411.
4. Hawkey PM, Jones AM (2009) The changing epidemiology of resistance.
J Antimicrob Chemother 64 Suppl 1: i3–10.
5. Zhu W, Clark NC, McDougal LK, Hageman J, McDonald LC, et al. (2008)
Vancomycin-resistant Staphylococcus aureus isolates associated with Inc18-like
vanA plasmids in Michigan. Antimicrob Agents Chemother 52: 452–457.
6. Pitout JD (2010) Infections with extended-spectrum beta-lactamase-producing
enterobacteriaceae: changing epidemiology and drug treatment choices. Drugs
70: 313–333.
7. Robicsek A, Jacoby GA, Hooper DC (2006) The worldwide emergence of
plasmid-mediated quinolone resistance. Lancet Infect Dis 6: 629–640.
8. Lujan SA, Guogas LM, Ragonese H, Matson SW, Redinbo MR (2007)
Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA
relaxase. Proc Natl Acad Sci U S A 104: 12282–12287.
9. Guiney DG (1982) Host range of conjugation and replication functions of the
Escherichia coli sex plasmid Flac. Comparison with the broad host-range
plasmid RK2. J Mol Biol 162: 699–703.
10. Frost LS (1993) Conjugative pili and pilus-specific phages. In: Clewell DB, ed.
Bacterial Conjugation. New York: Plenum Press. pp 189–212.
11. Russel M, Model P (2006) Filamentous phage. In: Calendar R, ed. The
Bacteriophages. Oxford: Oxford University Press, Inc. pp 146–160.
12. Webster R (2001) Filamentous phage biology. In: III CB, Burton DR, Scott JK,
Silverman GJ, eds. Phage Display: A laboratory manual. Woodbury: Cold
Spring Harbor Laboratory Press. pp 1.1–1.37.
13. Novotny C, Knight WS, Brinton CC, Jr. (1968) Inhibition of bacterial
conjugation by ribonucleic acid and deoxyribonucleic acid male-specific
bacteriophages. J Bacteriol 95: 314–326.
14. Ou JT (1973) Inhibition of formation of Escherichia coli mating pairs by f1 and
MS2 bacteriophages as determined with a Coulter counter. J Bacteriol 114:
1108–1115.
15. Jacobson A (1972) Role of F pili in the penetration of bacteriophage fl. J Virol
10: 835–843.
16. Boeke JD, Model P, Zinder ND (1982) Effects of bacteriophage f1 gene III
protein on the host cell membrane. Mol Gen Genet 186: 185–192.
17. Sun TP, Webster RE (1986) fii, a bacterial locus required for filamentous phage
infection and its relation to colicin-tolerant tolA and tolB. J Bacteriol 165:
107–115.
18. Levin BR, Stewart FM, Rice VA (1979) The kinetics of conjugative plasmid
transmission: fit of a simple mass action model. Plasmid 2: 247–260.
19. Andrup L, Andersen K (1999) A comparison of the kinetics of plasmid transfer in
the conjugation systems encoded by the F plasmid from Escherichia coli and
plasmid pCF10 from Enterococcus faecalis. Microbiology 145(Pt 8): 2001–2009.
20. Riechmann L, Holliger P (1997) The C-terminal domain of TolA is the
coreceptor for filamentous phage infection of E. coli. Cell 90: 351–360.
21. Meynell GG, Lawn AM (1968) Filamentous phages specific for the I sex factor.
Nature 217: 1184–1186.
22. Holliger P, Riechmann L, Williams RL (1999) Crystal structure of the two N-
terminal domains of g3p from filamentous phage fd at 1.9 A: evidence for
conformational lability. J Mol Biol 288: 649–657.
23. Marvin DA, Hohn B (1969) Filamentous bacterial viruses. Bacteriol Rev 33:
172–209.
24. Salivar WO, Tzagoloff H, Pratt D (1964) Some Physical-Chemical and
Biological Properties of the Rod-Shaped Coliphage M13. Virology 24: 359–371.
25. Palchoudhury SR, Iyer VN (1969) Loss of an episomal fertility factor following
the multiplication of coliphage M13. Mol Gen Genet 105: 131–139.
26. Waters VL (1999) Conjugative transfer in the dissemination of beta-lactam and
aminoglycoside resistance. Front Biosci 4: D433–456.
27. Tolmasky ME, Roberts M, Woloj M, Crosa JH (1986) Molecular cloning of
amikacin resistance determinants from a Klebsiella pneumoniae plasmid.
Antimicrob Agents Chemother 30: 315–320.
28. Williams JJ, Hergenrother PJ (2008) Exposing plasmids as the Achilles’ heel of
drug-resistant bacteria. Curr Opin Chem Biol 12: 389–399.
29. Cullum J, Collins JF, Broda P (1978) Factors affecting the kinetics of progeny
formation with F’lac in Escherichia coli K12. Plasmid 1: 536–544.
30. Andrup L, Smidt L, Andersen K, Boe L (1998) Kinetics of conjugative transfer: a
study of the plasmid pXO16 from Bacillus thuringiensis subsp. israelensis.
Plasmid 40: 30–43.
31. Loeffler JM, Nelson D, Fischetti VA (2001) Rapid killing of Streptococcus
pneumoniae with a bacteriophage cell wall hydrolase. Science 294: 2170–2172.
32. Lu TK, Collins JJ (2007) Dispersing biofilms with engineered enzymatic
bacteriophage. Proc Natl Acad Sci U S A 104: 11197–11202.
33. Lu TK, Collins JJ (2009) Engineered bacteriophage targeting gene networks as
adjuvants for antibiotic therapy. Proc Natl Acad Sci U S A 106: 4629–4634.
34. May T, Tsuruta K, Okabe S (2010) Exposure of conjugative plasmid carrying
Escherichia coli biofilms to male-specific bacteriophages. ISME J.
35. Deng LW, Malik P, Perham RN (1999) Interaction of the globular domains of
pIII protein of filamentous bacteriophage fd with the F-pilus of Escherichia coli.
Virology 253: 271–277.
36. Tzagoloff H, Pratt D (1964) The Initial Steps in Infection with Coliphage M13.
Virology 24: 372–380.
37. Rozinov MN, Nolan GP (1998) Evolution of peptides that modulate the spectral
qualities of bound, small-molecule fluorophores. Chem Biol 5: 713–728.
38. Meynell E, Meynell GG, Datta N (1968) Phylogenetic relationships of drug-
resistance factors and other transmissible bacterial plasmids. Bacteriol Rev 32:
55–83.
39. Russell SE, Iyer VN (1972) Loss of R factors promoted by bacteriophage M13
and the M13 carrier state. J Bacteriol 111: 7–14.
40. Ingram LC, Richmond MH, Sykes RB (1973) Molecular characterization of the
R factors implicated in the carbenicillin resistance of a sequence of Pseudomonas
aeruginosa strains isolated from burns. Antimicrob Agents Chemother 3:
279–288.
41. Sambrook J, Russell D (2001) Molecular Cloning: a laboratory manual. New
York: Cold Spring Harbor Laboratory Press.
42. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes
in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:
6640–6645.
43. Kim BC, Leang C, Ding YH, Glaven RH, Coppi MV, et al. (2005) OmcF, a
putative c-Type monoheme outer membrane cytochrome required for the
expression of other outer membrane cytochromes in Geobacter sulfurreducens.
J Bacteriol 187: 4505–4513.
44. Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, et al. (2007) USER
friendly DNA engineering and cloning method by uracil excision. Nucleic Acids
Res 35: 1992–2002.
45. Holliger P, Riechmann L (1997) A conserved infection pathway for filamentous
bacteriophages is suggested by the structure of the membrane penetration
domain of the minor coat protein g3p from phage fd. Structure 5: 265–275.
46. Daehnel K, Harris R, Maddera L, Silverman P (2005) Fluorescence assays for F-
pili and their application. Microbiology 151: 3541–3548.
Inhibition of Conjugation by M13 and Protein g3p
PLoS ONE | www.plosone.org11 May 2011 | Volume 6 | Issue 5 | e19991