Identification of the First Human Gyrovirus, a Virus Related to Chicken Anemia Virus

Institut Pasteur, Laboratory for Urgent Responses to Biological Threats, 25 rue du Docteur Roux, F-75015 Paris, France.
Journal of Virology (Impact Factor: 4.44). 06/2011; 85(15):7948-50. DOI: 10.1128/JVI.00639-11
Source: PubMed

ABSTRACT We have identified in a skin swab sample from a healthy donor a new virus that we have named human gyrovirus (HGyV) because of its similarity to the chicken anemia virus (CAV), the only previously known member of the Gyrovirus genus. In particular, this virus encodes a homolog of the CAV apoptin, a protein that selectively induces apoptosis in cancer cells. By PCR screening, HGyV was found in 5 of 115 other nonlesional skin specimens but in 0 of 92 bronchoalveolar lavages or nasopharyngeal aspirates and in 0 of 92 fecal samples.

Download full-text


Available from: Jennifer Richardson, Sep 28, 2015
28 Reads
  • Source
    • "In early 2011 Rijsewijk et al. [3] reported the discovery of a distant relative to CAV, avian gyrovirus 2 (AGV2), in diseased chicken from Brazil, with only 40% homology to CAV. Later that year, Sauvage et al. [4] identified a very closely related gyrovirus on human skin (HGyV1). Subsequently 4 other novel gyroviruses have been described. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Introduction. Chicken anaemia virus, CAV, was until recently the only member of the Gyrovirus genus. 6 novel gyroviruses, AGV2, HGyV1, and GyV3-6, have since been discovered in human and chicken samples. Methods. PCR amplification of the VP2 gene was used to detect AGV2/HGyV1, GyV3, and CAV in a range of clinical samples including stool, respiratory, CSF, and HIV-positive plasma. Screening of fresh local chicken meat was also performed. Results. AGV2/HGyV1 or GyV3 was detected in stools from healthy children (17/49, 34.7%) and patients with diarrhoea (22/149, 14.8%). 1.2% (3/246) nasopharyngeal respiratory samples were positive. No AGV2/HGyV1 or GyV3 was detected in nasal swabs from wheezing patients, in CSF from patients with meningitis, and in HIVpositive plasma. CAV was found in 51% (25/49) of stools from healthy children and 16% (24/149) in diarrhoea samples. Screening of 28 chicken samples showed a higher prevalence of gyrovirus (20/28, 71%) compared to CAV (1/28, 3.6%). Phylogenetic analysis of the CAV VP1 gene showed South African sequences clustering with Brazilian isolates from genotypes D2 and A2. Conclusion. Novel gyroviruses, including CAV, are present in the South African population with diarrhoea and respiratory illness as well as in healthy children. Their presence suggests an origin from chicken meat consumption.
    Advances in Virology 04/2014; 2014(6):321284. DOI:10.1155/2014/321284
  • Source
    • "[7]. In 2011, a novel human virus was identified on the surface of human skin and was designated human gyrovirus (HGyV), due to its homology with the chicken anemia virus [8]. In 2012, another gyrovirus species named GyV3 was detected in diarrhoea and normal faeces from Chilean children in the USA, which may reflect consumption of CAV-infected/vaccinated chickens due to the low sequence similarity with other gyroviruses [9]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The chicken anemia virus (CAV), is a known member of the genus Gyrovirus and was first isolated from chickens in Japan in 1979. Some reports have also demonstrated that CAV can be identified in human stool specimens. In this study, a variant of CAV was detected using PCR with CAV-based primers in fecal samples of stray cats. The genome of CAV variant was sequenced and the results suggest that it could be a recombinant viral strain from parental CAV strains JQ690762 and AF311900. Recombination is an important evolutionary mechanism that contributes to genetic diversification. These findings indicate that CAV variant might have originated from CAV-infected chickens. The epidemiology and pathogenesis of this novel virus remains to be elucidated. This study underscores the importance of CAV surveillance and it presents the first evidence suggesting the possibility of CAV homologous recombination in cat.
    02/2014; 2014:313252. DOI:10.1155/2014/313252
  • Source
    • "CAV isolates were thought to belong to a single serotype and were antigenically indistinguishable by serum neutralization tests5. In 2011, a new human virus, named human gyrovirus (HGyV) due to its homology with CAV, was identified on the surface of human skin6. CAV (JQ690762) was identified in pediatric fecal samples in Beijing, China, in 20127, and the genome had a 21-nt insertion (TCCGTACAGGGGGGTACGTCA) in comparison with the strain named GD-1-12 (accession no. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Chicken anemia virus (CAV) is an important pathogen that causes severe immunosuppression in young chickens. We have characterized 13 CAVs isolated from different commercial farms in southern China between 2011 and 2012. We discovered 92 variable residues compared to 37 other CAV complete genome sequences from other parts of the world listed in GenBank; these residues have not been previously observed. All of the Chinese CAV genomes that were characterized in this study had a glutamine at position 394, a hallmark of highly pathogenic CAVs. We also discovered that intra-group genetic recombination plays a role in generating genetic diversity in natural populations of CAV. The GD-J-12 isolate was a possible recombinant between GD-C-12 and GD-M-12 in the genomic region that encompassed both the coding and non-coding regions.
    Scientific Reports 12/2013; 3:3519. DOI:10.1038/srep03519 · 5.58 Impact Factor
Show more