Exploiting nucleotide composition to engineer promoters.

Abstract

The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

Full text

Page 1

Exploiting Nucleotide Composition to Engineer
Promoters
Manfred G. Grabherr1., Jens Pontiller2., Evan Mauceli1*, Wolfgang Ernst2, Martina Baumann2, Tara
Biagi1, Ross Swofford1, Pamela Russell1, Michael C. Zody1,3, Federica Di Palma1, Kerstin Lindblad-Toh1,3,
Reingard M. Grabherr2
1Broad Institute, Cambridge, Massachusetts, United States of America, 2Department of Biotechnology, University of Natural Resources and Life Sciences, Vienna, Austria,
3Department of Medical Biochemistry and Microbiology, Uppsala University, Uppsala, Sweden
Abstract
The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in
mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired
strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly
active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping
motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both
features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100
base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in
protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both
being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the
viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts
of GC and CpGs in localized regions. These results constitute a ‘‘proof-of-concept’’ for custom-designing promoters that are
suitable for biotechnological and medical applications.
Citation: Grabherr MG, Pontiller J, Mauceli E, Ernst W, Baumann M, et al. (2011) Exploiting Nucleotide Composition to Engineer Promoters. PLoS ONE 6(5): e20136.
doi:10.1371/journal.pone.0020136
Editor: Arkady B. Khodursky, University of Minnesota, United States of America
Received December 1, 2010; Accepted April 26, 2011; Published May 18, 2011
Copyright: ? 2011 Grabherr et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was in part supported by a grant from the National Human Genome Research Institute (Large Scale Sequencing and Analysis of Genomes,
Grant No. NIH 1 U54 HG03067, Lander), and by the Department of Biotechnology, University of Natural Resources and Life Sciences Vienna. KLT is an ESF EURYI
award recipient. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No additional external
funding was received for this study.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: evan@broadinstitute.org
. These authors contributed equally to this work.
Introduction
Artificially engineered promoter sequences have the potential
for use in industrial and biotechnological applications, such as
recombinant protein production of biopharmaceuticals. Some
human proteins require mammalian cell lines for proper
production, with e.g. the Chinese hamster ovary (CHO) cell line
being a widely used system for EPO, Interferon-b, Factor VIII,
IX, etc [1–3]. A crucial step in this process is the choice of an
appropriate promoter, which, in the case of CHO, is complicated
by the fact that the hamster genome is not available in its entirety.
But even if it were, selecting existing mammalian promoters and
screening them for activity is laborious and time consuming, and
thus not viable on a large scale. A widely used alternative are viral
promoters, such as the cytomegalovirus early promoter (CMV).
However, these sequences have the disadvantage that they are
fairly strong and fixed in strength, so that the stress imposed on the
cells by producing foreign proteins sometimes leads to hampered
growth and cell death. A more desirable solution are ‘artificial’
promoters, i.e. ‘made-up’ sequences that are not found in living
organisms, that can be engineered to the required behaviour and
expression levels. The more predictable these sequences, the easier
it is to optimize a system for recombinant protein production.
Avoiding viral sequences can also increase product safety. In this
work, we devise methods to distil sequence features that allow for
constructing such sequences, guided by observations gathered
from real promoters, but without using their actual sequences.
The promoter is the genomic region around the transcription
start site (TSS) of a gene, and acts as an essential component in
gene regulation and transcription, its role being to interface with
transcription factors (TFs) through protein-DNA binding. The TFs
anchor the pre-initiation complex (PIC), specifying the exact point
of initiation, and recruit RNA polymerase (Pol) II to start
transcription [4–6]. A eukaryotic genome typically contains
thousands of genes encoding TFs [7], which belong to several
families. While the rest of the protein can vary considerably, the
structure of their DNA-binding domains is often conserved [8]. As
a consequence, many TFs, such as the homeodomain factors,
exhibit sequence preference to similar sites, but the binding affinity
varies on a continuous scale, sometimes involving a number of
different, short (8 bp and less) DNA motifs [9–11]. To increase
recognition specificity required for robust regulation beyond
interaction between one single TF and the site it binds to, some
TFs can form complexes that are pre-assembled prior to DNA
PLoS ONE | www.plosone.org1 May 2011 | Volume 6 | Issue 5 | e20136

Page 2

interaction, requiring a specific organization of the promoter and
exact spacing of elements that certain factors can bind to [12–13].
For example, it has been shown that the tandem orientation of two
identical (or almost identical) binding sites in a promoter enables
binding of a homo-dimer, to the effect that expression levels
increase dramatically [14].
General transcription factors (GTFs), organized in complexes
TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH and TFIIJ, form a
special class of TFs, in that they are ubiquitously present and both
necessary and sufficient to enable Pol II transcription at significant
levels, making these proteins desirable candidates as drivers of
expression of artificial promoters. Only TFIIB and TFIID have
been shown to exhibit sequence preference: the TATA-Binding
Protein(TBP, a TFIID protein) is most well characterizedand binds
to the TATA-Box, thereby establishing the TSS 25–30 base pairs
downstream of its location. However, only about 10% of human
promoters rely on a TATA-Box [15], while the rest are reported to
use other elements instead, such as the more degenerate initiator
element [16]. While TBP and the TBP associated factors (TAFs) are
generally attracted to motifs composed of the nucleotides Adenine
(A) and Thymine (T), the TFIIB proteins prefer sequences rich in
Cytosine (C) and Guanine (G), with the di-nucleotide CpG at its
core (consensus sequence ‘SSRCGCC’ [17]). About half of the
human promoters are rich in these features and are commonly
characterized as CpG-islands [18,19]. Highly active promoters
show even higher enrichment, with 88% of promoters of genes
present in IMR90 cells exhibiting this feature [20]. Since CpG is
subject to spontaneous deamination, making it more vulnerable to
mutation than other di-nucleotides, it is the most infrequent di-
nucleotide genome-wide [21].
Designing artificial sequences that attract TFIIB and TFIID
requires determining the features that capture the interactions
between these proteins and the DNA. Generally, a complicating
factor is the lack of a one-to-one relationship between TFs and exact
instances of binding motifs, so that neither motif consensus of short
sequences nor Position Weight Matrices (PWM) are ideal represen-
tations of binding sites [10]. Instead, we use the concept of nucleotide
composition, rather than sequence motifs, where we define the term
‘‘nucleotide composition’’ as the frequency patterns of mono-
nucleotides, di-nucleotides, tri-nucleotides etc. This composition
varies over the human genome on a large scale, recognizable as
isochores[22],aswellasonasmallerscaleasCpGislands[18].CpG-
containing motifs have been reported to be both necessary and
sufficient to bind Pol II abundantly in more than one tissue to
transcribe both housekeeping genes and genes with tissue-specific
expression in multiple cell types [23]. Here, we show that artificial
sequences that model the CpG richness of active promoters can drive
gene expression in vitro in mammalian cells, as well as how expression
levels depend on highly localized features in these sequences.
Results
Highly active promoters exhibit nucleotide patterns that are
different from the majority of the genome [21], most notably the
abundance of GC and the di-nucleotide CpG. Assuming that these
are features of active elements rather than a byproduct of other
evolutionary mechanisms, it should be possible to construct
artificial sequences that mimic these characteristics and function
as promoters for in vitro expression. Here, we first recapitulate how
highly active promoters (mostly associated with both housekeeping
and strong tissue-specific genes) differ from the genome-wide
distribution in GC and CpG, as well as in other di-nucleotides. We
then exploit these ‘‘un-genomic’’ features by devising a measure
that tracks the genome-wide frequency of each short motif: the less
common genome-wide, the more likely it is to reflect properties of
a promoter. We subsequently overlap a set of uncommon motifs to
build ‘‘promoter-like’’ contiguous sequence, which allows for
editing existing promoters, as well as to construct entirely artificial
ones that work in a number of mammalian cells. We last show that
TFIIB and TFIID bind to these promoters, which is reflected in
their stability of expression level across multiple cell lines.
Nucleotide distribution in highly active promoters
To capture a set of highly active promoters, we sequenced the
mRNA of the most highly expressed genes in human cerebellum
tissue. We constructed two cDNA libraries, one normalized and one
un-normalized library (both filtered for poly-A tails), and sequenced
bothlibraries onone lane of Illumina each, yielding a totalof 2 billion
base pairs in 71 bp long reads. We then assembled the reads from
both libraries into contiguous transcripts using the transcriptome
assembly program Trinity (Grabherr et al., in revision). The resulting
assembly consists of 38 Mb of sequence, residing in 27,000 disjoint
transcripts.Weeliminated non-full-length transcript assemblies ofless
prominently expressed genes by requiring sequences to contain open
reading frames of 500 bp or more, aligned the remaining sequences
to the human genome, and selected only transcripts with the 59 end
falling within 50 bp of an annotated TSS [24]. This resulted in 1,746
highly expressed transcripts of known TSS, from each of which we
defined 300 bp of promoter sequence (200 bp upstream of TSS and
100 bp downstream). These transcripts correspond to both tissue-
specific genes as well as housekeeping ones: the two most highly
expressed genes are the tissue-specific synaptosomal-associated
protein 25 isoform (SNAP25), followed by housekeeping genes beta
actin (ACTB), glial fibrillary acidic protein (GFAP), and ribosomal
protein L3 (RPL3). The least expressed genes in this set have ,300-
fold less coverage than the top ones, and include haloacid
dehalogenase-like hydrolase domain (HDHD1A), coiled-coil domain
containing 134 (CCDC134), actin related protein 2/3 complex
subunit 1B (ARPC1B), and amyloid beta (A4) precursor protein-
binding (APBA3). In the complete set, ,10% of the genes are up-
regulated in cerebellum compared to other tissues according to Gene
Expression Atlas 2 [25] (threshold=+1), indicating that this set
captures a variety of genes involved in different cellular processes.
Whileonly127(7.3%)ofthe1,746promotersequencescontainone
or more instances of a TATA-Box in the correct orientation, the
sequences are clearly distinct from the genome-wide average by their
high G/C content (66% vs. 40% genome-wide) as well as the average
frequency of CpGs (9% vs. 1% genome-wide). Figure 1a shows the
receiver-operator characteristics for G/C content, as well as all di-
nucleotides with their frequency as the discrimination threshold,
distinguishing promoter sequences from a negative control set (1,746
randomly chosen, non-interspersed-repeat human sequences of equal
length).ThecountofCpG’sisthebestdiscriminator:atafalsepositive
(FP) prediction rate of 2%, the false negative (FN) rate is 13.5%,
followed by GpC (FN=25.1%), G/C content (FN=30.6%) and
CpC/GpC (FN=53.9%). The di-nucleotides ApT, TpA and ApA/
TpT act as negative predictors, with the remaining nucleotides being
negative predictors as well, but at much lower sensitivity and
specificity. CpG islands [18,26], as binary classifiers, are specific
discriminators, but much less sensitive than CG content and CpG,
GpCandCpC/GpG,yieldingaFNrateof35%atanFPrateof0.6%.
Creating artificial sequences with nucleotide
composition mimicking that found in highly active
promoters
We defined a measure that tracks with G/C and CpG content
(see Figure 1), incorporates contributions from other nucleotides,
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org2 May 2011 | Volume 6 | Issue 5 | e20136

Page 3

Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org3May 2011 | Volume 6 | Issue 5 | e20136

Page 4

and can be computed for very short sequences so that these can be
quantified as ‘‘promoter-like’’ on a sliding scale. To this end, we
equate ‘‘promoter-like’’ with the extent to which they are ‘‘un-
genomic’’, i.e. unlike the majority of the genome. We computed a
score (the ‘‘a score’’, see Methods) over 12 consecutive base pairs
(‘‘12-mer’’), based on the frequencies of di-nucleotides, tri-
nucleotides etc. compared to the genome-wide expectation. To
verify that this measure predominantly captures promoter-like
features and not other ungenomic sequences, we scored all 12-
mers in each of the 1,746 highly active promoters (see above) and
used the sum of scores over the sequence as the discriminating
function. We found that the receiver-operator characteristic of this
method is close to, or slightly better than CpG counts (Figure 1a),
with an FP rate of 2% on the control set (see above) yielding a FN
rate of 11.5%. In addition to matching the discriminative power of
CpG counts over hundreds of base pairs, a yields a potential
spatial resolution of tens of nucleotides. Figure 1b shows a
histogram of the 1,746 active promoter regions (i), and the
distribution of regions based on 4,000 randomly selected annotated
TSS [24] (ii), as well as the random control set for comparison (iii).
Distribution (ii) is bi-modal with one peak coinciding with the
experimentally found regions of active promoters (i), and a second
peak more similar to the negative control (iii). We thus note that
this method is not suitable to universally characterize all
promoters, but rather models features of promoters associated
with highly active genes.
To create longer, contiguous artificial promoter sequences, we
began by calculating the a score for each possible 12-mer, including
those not present in the human genome. We selected sequences from
two quintiles: (a) the top 5% represent the most ‘‘un-genomic’’ (or
promoter-like) 12-mers; and (b) the percentile between 45–50%,
which contains 12-mers with di-, tri-nucleotide etc. frequencies close
to the genomic median, representing more ‘‘normal’’ (or non-
promoter-like) sequences. The 12-mers from each set were then
independently assembled into ‘‘concatomers’’ (i.e. flattened 11-mer
De Bruijn graphs [27] of maximum contiguous length to the extent
that11 bpoverlapsexistwithinthe12-merset).Forthepromoter-like
concatomer, this resulted in a contiguous sequence of ,160,000 base
pairs, while the non-promoter-like concatomer was ,180,000 base
pairslong.Concatomer(a)isveryrichinG/C(60%)andCpG(22%),
and contains exact instances of the consensus of known binding sites,
such as the TFIIB Recognition Element (BRE), TATA-Box, CAAT-
Box,andInr,whileconcatomer(b)islowinG/C(38%)anddevoidof
CpG’s. Neither sequence has any homology to the human (or any
other sequenced) genome over more than 18 base pairs.
Modifying in-vitro promoter strength through sequence
alteration
We tested whether we could modulate in-vitro activity by
substituting selected sequences in a known promoter with
sequences chosen from the promoter-like (for up-regulation) and
non-promoter-like (for down-regulation) artificial constructs. As
test case, we chose the promoter upstream of the TSS of the
X-linked gene cancer/testis antigen 1A (CTAG1A), which
exhibited strong in-vitro activity in human cell line HEK293. The
CTAG1A promoter region contains three distinct regions of
elevated a scores (red bars in Figure 2a), of lengths 23, 24 and 37
base pairs respectively (see Methods). As these regions have high a
score, we expect that removal of these sequences will suppress
promoter activity, as will replacement of these sequences with size-
matched snippets from the non-promoter-like concatomer.
Furthermore, we expect to be able to drive promoter activity by
replacement of these (or any other regions within the promoter)
with size-matched, but of higher a score, snippets from the
promoter-like concatomer.
Figure 2b shows that this is in fact the case. Removal of the
three regions without replacement (‘‘hCTAG1A-delta’’) suppresses
in-vitro promoter activity in HEK293 cells relative to the original
sequence, as does replacement with ‘‘non-promoter’’ sequences
with a scores of approximately half the original (‘‘hCTAG1A-
replace’’). Replacement with ‘‘promoter-like’’ sequences with an a
score roughly twice that of the original (‘‘hCTAG1A-UP’’)
increases activity beyond that of the original sequence. This
indicates that highly localized changes in sequence composition
can drive up- and down-regulation of in-vitro gene expression.
Artificial promoter constructs drive in-vitro promoter
activity
To create entirely artificial promoter constructs for in-vitro
expression, we pulled sequences from the promoter-like concato-
mer using different criteria and of different lengths (50, 110, 200,
232 and 300 base pairs; see Methods) to create five artificial
promoters and tested those for in-vitro promoter activity. With the
exception of the shortest construct, all exhibited strong in-vitro
promoter activity (as measured by firefly luciferase expression) in
four mammalian cell lines: CHO (hamster ovary); P19 (mouse
embryo); Vero (monkey kidney); and HEK293 (human kidney).
Promoter strength of most constructs was comparable to, or
exceeded activity of the SV40 core promoter, which is a routinely
used viral promoter for recombinant protein expression in
mammalian cell lines (Figure 3; see Methods). Notably, the longer
constructs showed several fold higher activity in P19 than the
SV40 core promoter, which shows only weak activity, indicating
that the artificial sequences are rather unspecific to the cell type
and/or which mammal the cells were derived from. By contrast,
no activity was detected in the insect cell line Sf9 (Spodoptera
frugiperda) for any of the constructs, suggesting fundamental
differences in promoter mechanisms between insects and mam-
mals (or perhaps, more widely, vertebrates).
All constructs contain at least one instance of a TATA-Box. In
addition to two TATA-Boxes, ArS232 contains one perfect, and
12 imperfect (1 mismatch allowed) instances of BRE, and one Inr.
To examine to what extent the TATA-box is needed to drive
expression, we constructed three variations (Figure 3f): (i) removal
TATA-Box2, which had no effect; (ii) removal of TATA-Box1,
which completely reduced expression; and (ii) removal of both
TATA-Box1 and TATA-Box2, which, again, showed strong
expression (for sequences, see Methods). We explain this behaviour
by TBP binding to the TATA-Box taking precedence over other
GTFs in defining TSS ,25 bp downstream of TATA-Box1, thus
Figure 1. Receiver operator characteristics (ROC) of mono- and di-nucleotides (a), and histogram of a-score in promoter regions (b).
(a) Several di-nucleotides are positive or negative classifiers distinguishing 1,746 experimentally confirmed promoters of genes active in human
cerebellum tissue from random sequences, with CpG, GpC and CpC/GpG the strongest positive predictors and ApT, TpA, and ApA/TpT the strongest
negative ones. Shown are also G/C content, as well as the a-scores summed over the promoter regions. (b) Shown is the distribution of regions over
the sums of a-scores: 1,746 experimentally confirmed promoters of genes active in human cerebellum tissue in red (i), promoters chosen from the
UCSC gene set [24] in blue (ii), randomly chosen sequences as negative control in green (iii), and the respective overlaps between the distributions in
purple, dark chartreuse and black.
doi:10.1371/journal.pone.0020136.g001
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org4 May 2011 | Volume 6 | Issue 5 | e20136

Page 5

TBP binding to TATA-Box2 becomes irrelevant. In absence of
TATA-Box1, TFIIB can define TSS through binding to CpG-rich
motifs, possibly at Inr, but TBP bound to TATA-Box2 blocks
transcription initiation, likely because of being located too close to
the end, not allowing for a sufficiently long 59 un-translated region
(we also observe lack of activity in construct ArS50, which has a
TATA-Box approximately as close to the end as ArS232).
Subsequent removal of TATA-Box2 thus clears the way for
transcription. We further note that all constructs including the
original ArS232, with the exception of construct (ii), act as a
promoter in both directions.
General Transcription Factors bind to the artificial
constructs
The general transcription factors TFIIB and TBP bind to the
artificial promoter constructs: we monitored real-time binding of
TFIIB to constructs ArS110, ArS300, ArS201 and ArS232 through
measurement of quantitative protein kinetics (Figure 4, see
Methods). Figure 4a shows the respective real-time binding chart,
clearly indicating TFIIB association with the constructs (seconds
520–920), followed by dissociation (for the binding constants, see
Table 1). To quantify the role of TBP, we conducted a similar assay
for constructs ArS232 and its derived constructs with the TATA-
Box deletions (Figure 4b). Here, we found that the original sequence
with both TATA-Boxes showed the highest level of association,
while binding to construct ArS232 dT1&dT2, which lacks TATA-
Boxes, was weaker in comparison. Unlike in case of TFIIB, binding
increased linearly over time with little or no dissociation, possibly
because of aggregation of TBP to protein already bound to DNA.
We note that the linearity did not allow for computing appropriate
KDvalues, and that these readings are thus somewhat more difficult
to interpret than the TFIIB binding results.
Discussion
Artificially engineered promoter sequences have potential for
use in industrial, biotechnological and medical applications
involving recombinant protein production and gene therapy,
since they can be designed to have different activities and be
Figure 2. Human promoter CTAG1A and modified constructs. (a) The 535 base pair long promoter region of human gene CTAG1A is rich in
CpGs and exhibits a-scores higher than the genomic distribution with pronounced peaks. Shown are the composite ak-scores (top), the individual ak-
scores for different sizes of k in the middle graph (colour coded, blue=negative, red/orange=positive), and CpGs in yellow (bottom). The three
strongest regions are marked by red bars. (b) In-vitro activity of the original CTAG1A promoter (hCTAG1A Promoter), the three strongest a-score
regions deleted (hCTAG1A delta), the three strongest a-score regions replaced with sequences from the genomic concatomer (hCTAG1A replace),
and the three strongest a-score regions replaced with sequences from the promoter-like concatomer (hCTAG1A UP). Also shown are results without
any promoter (Negative CO) and the SV40 core promoter (SV40 Promoter AVG).
doi:10.1371/journal.pone.0020136.g002
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org5 May 2011 | Volume 6 | Issue 5 | e20136

Page 6

adapted to the specific requirements (strong or weak expression).
The method proposed here yields constructs that appear less
variable and species specifically regulated than the viral promoter
SV40, a feature that would increase stability across cell types and
conditions. By extension, it should be possible to build artificial test
beds to determine the behavior of known binding sites, and
subsequently design promoters that are targeted and regulated by
specific transcription factors. Preliminary results already show
promise that this is, in fact, the case, and future experiments will
help expand our ‘‘vocabulary’’ of promoter elements, and to
predict their effect on in vitro transcription depending of the
abundance of the binding proteins that drive the promoter.
We do not address here how these results translate to in vivo
expression, in presence of additional factors, such as methylation,
degradation by miRNAs etc. While it might not be possible to
accurately predict the behavior of artificially designed promoters
in living organisms in the immediate short term, modifying short
sub-sequences to adjust relative expression levels should be. In
addition, emerging fields such as Synthetic Biology [28–30] that
aim to create functioning, regulated systems from scratch in
controlled environments might benefit from the results presented
here.
This work might also be relevant for the study of expression
regulation on a more general level: our findings suggest that
different sequences can respond to transcription factors in very
similar ways, even though they share no nucleotide sequence
similarity; this would provide an explanation as to why promoters
are generally not conserved across species over their entire length,
but exhibit a pattern of conservation peaks and troughs [20].
Moreover, if promoter strength can easily be adjusted by changes
in a few small regions, this mechanism provides an obvious
approach for genome evolution, supplying natural selection with a
fertile playground for experiments.
Materials and Methods
Computing the a score
The a score measures the ‘‘un-genomicness’’ of short (12
nucleotides long) sequences, taking into account the genome-wide
frequencies of di-nucleotides, tri-nucleotides etc. within the
Figure 3. In-vitro promoter activity driven by artificial constructs. Artificial constructs ArS110, ArS300, ArS201 and ArS232 exhibit strong
promoter activity driving a reporter gene (firefly luciferase, internally normalized by renilla luciferase) in mammalian cell lines: (a) CHO/hamster, (b) P19/
mouse, (c) VERO/monkey, (d) HEK293/human, but not in (e) the insect cell line Sf9/army worm. Also shown are the negative control (2) and the SV40
core promoter activity (+). (f) TATA-boxes 1 (left) and 2 (right) were deleted from construct ArS232: deletion of TATA-box 1 only (dT1) results in lack of
activity, deletion of TATA-box 2 (dT2) does not change expression levels, while deletion of both (dT1&2) results in slightly increased expression levels.
doi:10.1371/journal.pone.0020136.g003
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org6 May 2011 | Volume 6 | Issue 5 | e20136

Page 7

Figure 4. Binding affinity of artificial promoter constructs to the transcription factors TFIIB and TBP. The binding expressed as Dnm on
the y-axis was monitored in real time as sec (x-axis), using the ForteBio Octet QK instrument. Binding was conducted in four phases: (i) loading of
biotinylated DNA fragments to the streptavidin biosensor tip, (ii) washing in Kinetics Buffer, (iii) association of the transcription factor and (iii)
dissociation of the transcription factor. (a) The promoter constructs ArS110, ArS201, ArS232 and ArS300 show similar binding affinities to the TFIIB
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org7 May 2011 | Volume 6 | Issue 5 | e20136

Page 8

sequence. Let N denote the number of k-mers (k consecutive
nucleotides, k=2, 3…12) in the genome, and Qkithe genome wide
occurrence count of the k-mer starting at position i (using zero-
based counting) in the 12 base pair (bp) long sequence, then the
score akis
ak~{lnQk0
N{
X
12{k
i~0
ln
Qki
Qk{1i
and the composite score for all k
a~
X
12
k~2
ak
For existing promoter templates as well as the CTAG1A
promoter, we computed the scores for all overlapping 12 bp long
sequences within, and assigned the score to the base at position 6.
Defining the regions for sequence substitution in the
CTAG1A promoter
We defined the regions of the CTAG1A promoter for sequence
substitution by selecting the three positions in the promoter with
the highest composite a score, and extended the boundaries of
each until its composite a score became negative, which yields a
2% false positive rate on the promoter template set (position 0 in
Figure 1).
Construction of synthetic promoter elements
Constructs ArS 50, 110, 201, 232 and 300 (50, 110, 201, 232,
and 300 base pairs in length) were selected from the 160,000
nucleotide (nt) long promoter-like concatomer. For identifica-
tion and spacing of TATA Boxes, we used a promoter
prediction tool trained on fruit fly [31]. For ArS110, we selected
three regions with high score hits, region one spans 24
consecutive nts, followed by 34 consecutive nts of region two,
and region three is comprised of 52 nts. ArS 50 is a 50 bp
fragment containing one of the program’s top high-scores.
ArS201 is derived from ArS300 after deletion events caused by
plasmid amplification in E. coli. ArS200 and ArS232 consist of
contiguous sequences out of the concatomer, containing 2 high-
scores each. ArS300 consists of six 50 bp hits resulting in nine
high-scores when stringed together. Constructs dT1, dT2 and
dT12 comprise the sequence of ArS232, excluding the first, the
second, and both TATA-Boxes respectively. The hCTAG1A
promoter construct consists of the original 535 bp sequence
upstream of the TSS of the X-linked human gene CTAG1A.
Three more modified hCTAG1A constructs (CTAG1A-delta,
CTAG1A-replace and CTAG1A-UP) were designed as de-
scribed in the results section.
Experimental quantification of promoter activity
All inserts have been assembled either by oligo synthesis (Sigma
Aldrich, Austria) followed by annealing and PCR or by gene
synthesis (Geneart, Germany) and cloning into the reporter
vector pGL3 Basic (Promega, Madison, Wisconsin) upstream of a
firefly luciferase gene. After propagation in E. coli and purification
using NucleoSpin Extrakt II (Macherey-Nagel, Germany) all
plasmids were sequenced to confirm the original sequence. In
case of CHO dhfr-, HEK293 and P19, 4610‘6 cells were
transfected with 10 mg of the firefly luciferase plasmids and co-
transfected with 1 mg of the Renilla luciferase reporter vector
pRL-SV40 (Promega, Madison, Wisconsin) as an internal
standard using Amaxa’s Nucleofector Kit V (Lonza, Switzerland)
according to the manufacturer’s instructions. 3610‘5 VERO and
MDCK cells were transfected with 1 mg DNA of the firefly
luciferase constructs and co-transfected with 0,25 mg pRL-SV40
usingDreamfectGoldand
Marseille, France). 3610‘6 Sf9 cells were transfected with 1 mg
of the firefly luciferase constructs using Cellfectin II (Invitrogen,
Carlsbad, CA) according to the manufacturer’s instructions.
Instead of the SV40 promoter the baculovirus derived immediate
early promoter OplE2, which is active in insect cells was used for
the positive control. Luciferase expression was measured 48 h
post transfection on a Synergy 2 microplate reader (Biotek,
Vermont, USA) with the Gen5 software using the Dual-Glo
luciferase assay system (Promega, Madison, Wisconsin). To
normalize transfection efficiency, promoter activities are ex-
pressed as the ratio of firefly and Renilla luciferase activity. The
pGL3-Promoter plasmid (Promega, Madison, Wisconsin), con-
taining the SV40 promoter served as positive control. The
promoter activity of this viral promoter was set to 100%. All
other measurements refer to this value within the same cell-line.
The promoterless pGL3-Basic Vector (Promega, Madison,
Wisconsin) was used as a negative control.
CombiMag (OZBiosciences,
Binding assays
For the identification of sequence-specific DNA binding of the
transcription factors TFIIB and TBP the binding kinetics were
measured by biolayer interferometry on an Octet QK instrument
(ForteBio Inc.), which provides continuous real-time display of
biomolecular interactions. Streptavidin biosensors were loaded
with biotinylated DNA fragments (25 mg/ml) of the promoter
constructs ArS110, ArS201, ArS232 and ArS300, or with the
promoter constructs ArS232, ArS232 dT1, ArS232 dT2 and
ArS232 dT12, generated by PCR amplification using 59
biotinylated primer (Sigma-Aldrich). Binding was conducted in
16Kinetics Buffer (ForteBio Inc.) with a protein concentration of
285 nM for TBP (catalog # ab81897, Abcam) and 270 nM for
TFIIB (catalog # ab1898, Abcam). Kinetic parameters (konand
koff) and affinities (KD) were calculated using the Octet Data
Analysis Software Version 6.3.
Table 1. Calculation of the binding constants kon, koff, and KD
for the TFIIB binding assays.
DNAKD(M)kon(1/Ms)koff(1/s)
ArS 1106.37E-08 3.03E+04
2.94E+04
2.73E+04
3.06E+04
1.93E-03
ArS 2017.76E-082.28E-03
ArS 2328.45E-082.31E-03
ArS 3006.46E-08 1.98E-03
doi:10.1371/journal.pone.0020136.t001
protein. (b) The promoter constructs ArS232, ArS232 dT1, ArS232 dT2 and ArS232 dT12 exhibit sequence-specific binding to the TBP protein. ArS232
dT12 lacking two TATA-Boxes shows the lowest binding affinity compared to the other constructs. (c) TFIIB binding vs. a negative control, for which
we chose a 85 bp long sequence from inside the coding region of the luciferase gene (pGL3-Basic Promoter Promega: 1314 bp–1399 bp).
doi:10.1371/journal.pone.0020136.g004
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org8 May 2011 | Volume 6 | Issue 5 | e20136

Page 9

Construct sequences
. .ArS 50
ACGCACGCGGTATAAACGCGCGACCTATTCGCGACCGTATAGCGACC-
GGA
. .ArS 110
CTACGCCGCGTAAATATCGCGCGCTAACGGTGCGCGTTAAAACGCCG-
ACGCGTCATAAAGCGCCGGCGTATAAGCGCGCCGTACGTCGTCGAACCA-
CGTTAGTCCGGACC
. .ArS 201
AACGGTGCGCGTTAAAACGGCCGACGCGTCATAACCGCGACTCGTCG-
ACGCAGCGCCGGCGTATAAGCGCGCCGTACGTCAACCGTCGACGTTAGT-
CCGACGATCGCGGCGTCTATACGCCGCGTCAATCGCGCGCGGTTCAACG-
TCGCGCTACGGGCGCGTATAAGTCGCGCGTATGGACCGCGTACGTCCTA-
CGAGCGT
. .ArS 232
TCGACGCGCGTATAACACGCGAGCGGTTCGAACGTTGGCGCGCTAACG-
CGAGTCGTACGCCCGTCAACGCGGATCAATCGCGCGACTTGTGCGCGACG-
TTAGACCGCCGATCGTCAAGCGCCGATCGGTAATCGGACGATTCGGATAC-
GCGAGTTCGGACGTACGAGCGTGATACGGCGCGTAACGGTGCGCGTTAAA-
ACGCCGACGCGTCATAACCGCGACTCGTCGACGC
. .ArS 300
AACGGTGCGCGTTAAAACGCCGACGCGTCATAACCGCGACTCGTCGA-
CGCAGCGCCGGCGTATAAGCGCGCCGTACGTCAACCGTCGACGTTAGTC-
CGACGATCGCGGCGTCTATACGCCGCGTCAATCGCGCGCGGTTCAACGT-
CGCGCTACGGGCGCGTATAAGTCGCGCGGTTAATACGCGCGGTGTACGC-
GGATGCCGGGGTCGCGTATAATCGGCGCGTATACCTCGCGCGTATACGC-
GGCGTATTACGGCCGCGTATAATTCGCGCGTATGGACCGCGTACGTCCT-
ACGAGCGT
. .CTAG1A_original
TCTCAGAGAGAAGGTCAGGGCCCACGAGGATGCGGAGGCAGAGAGGCT-
GCAGGAAGTTCCGCCCCCTGGCGTGAGATGGGCAGCCCGGGATCCTCAGG-
GCGCCTGCGCACAGGGGCCCTACTTCCGGCCCTGGGAGACCCCGAGTGAG-
CCCCGGAGCACGTGACCGGTTCTCACCAACCCCGCCCCTCCCCAAGAGA-
GCCCGGGCCGGAAGGTGGCCGCAATGCCAGCTTGGACCCCTCACCCCTG-
AGCAGCCGGCTGTCCGCCGGACCCCTGTCCCGGGAGCCCTGCAGGGAGT-
CAGGCACTGCGGGGCCCAGCCTGTCCCATCCCCCGGGTCTCCCTCACA-
TCGAGGAGCAAGACGGGCCTGGGAACACGGGGCCGGGACTGTGCGGCC-
ATCGTCCCGGACCCTGCCTGCCCTGTCCGTCCTTGGGGGAGCGCCCAGG-
ACAGACfCCCGGGGGGCAGGCCTCTAfACTGGGCTCAGCAGCCTCCGTC-
CCTGTCCTGGTCGCCCAGCTGGTGGGGTAGCTGGAACTGCATGTCTGG
. .CTAG1A_replace
TCTCAGAGAGAAGGTCAGGGCCCACGAGGATGCGGAGGCAGAGAGGCT-
GCAGGAAGTTCCGCCCCCTGGCGTGAGATGGGCAGCCCGGGATCCTCAGG-
GCGCCTGCGCACAGGGGCCCTACTTCCGGCCCTGGGAGACCCCGAGTGAG-
CCCTTACCTAAAACAGCCCAAAAGAGCAACCCCGCCCCTCCCCAAGAGA-
GCCCGGGCCGGAAGGTGGCCGCAATGCCAGCTTGGACCCCTCACCCCTG-
AGCCCACCACCACCTCCACCACCACTGTCCCGGGAGCCCTGCAGGGAGT-
CAGGCACTGCGGGGCCCAGCCTGTCCCATCCCCCGGGTCTCCCTCACAT-
CGAGGAGCAAGACGGGCCTGGGAACACGGGGCCGGCCAAAGAAGCCCAA-
AAAGGCCCAGGAAACCCAAACTTTCCGTCCTTGGGGGAGCGCCCAGGAC-
AGACCCCGGGGGGCAGGCCTCTAACTGGGCTCAGCAGCCTCCGTCCCT-
GTCCTGGTCGCCCAGCTGGTGGGGTAGCTGGAACTGCATGTCTGG
. .CTAG1A_delta
TCTCAGAGAGAAGGTCAGGGCCCACGAGGATGCGGAGGCAGAGAGGCT-
GCAGGAAGTTCCGCCCCCTGGCGTGAGATGGGCAGCCCGGGATCCTCAGG-
GCGCCTGCGCACAGGGGCCCTACTTCCGGCCCTGGGAGACCCCGAGTGAG-
CCCCAACCCCGCCCCTCCCCAAGAGAGCCCGGGCCGGAAGGTGGCCGCAA-
TGCCAGCTTGGACCCCTCACCCCTGAGCTCCCGGGAGCCCTGCAGGGAGT-
CAGGCACTGCGGGGCCCAGCCTGTCCCATCCCCCGGGTCTCCCTCACATC-
GAGGAGCAAGACGGGCCTGGGAACACGGGGCCGGTCCGTCCTTGGGGGAG-
CGCCCAGGACAGACCCCGGGGGGCAGGCCTCTAACTGGGCTCAGCAGCCT-
CCGTCCCTGTCCTGGTCGCCCAGCTGGTGGGGTAGCTGGAACTGCATGTC-
TGG
. .CTAG1A_up
TCTCAGAGAGAAGGTCAGGGCCCACGAGGATGCGGAGGCAGAGAGGC-
TGCAGGAAGTTCCGCCCCCTGGCGTGAGATGGGCAGCCCGGGATCCTCA-
GGGCGCCTGCGCACAGGGGCCCTACTTCCGGCCCTGGGAGACCCCGAGT-
GAGCCCCGTTTGACGGACGCCGTTCGCAGTCAACCCCGCCCCTCCCCA-
AGAGAGCCCGGGCCGGAAGGTGGCCGCAATGCCAGCTTGGACCCCTCAC-
CCCTGAGCCGGAGCACGTGACCGGTTCTCACTCCCGGGAGCCCTGCAG-
GGAGTCAGGCACTGCGGGGCCCAGCCTGTCCCATCCCCCGGGTCTCCC-
TCACATCGAGGAGCAAGACGGGCCTGGGAACACGGGGCCGGATCGCGC-
AGCGATCGACGCCGGATCAACGCGATACGGTCCGTCCTTGGGGGAGCG-
CCCAGGACAGACCCCGGGGGGCAGGCCTCTAACTGGGCTCAGCAGCCTC-
CGTCCCTGTCCTGGTCGCCCAGCTGGTGGGGTAGCTGGAACTGCATGTC-
TGG
Alignment of deletion mutants dT1, dT2 dT12 and
parental sequence ArS232
232 TCGACGCGCGTATAACACGCGAGCGGTTCGAACGTTGGCGCGC-
TAACGCGAGTCGTACGC 60
dT1TCGACGCGCG-----CACGCGAGCGGTTCGAACGTTGGCGCGC-
TAACGCGAGTCGTACGC 55
dT2 TCGACGCGCGTATAACACGCGAGCGGTTCGAACGTTGGCGCGC-
TAACGCGAGTCGTACGC 60
dT12TCGACGCGCG-----CACGCGAGCGGTTCGAACGTTGGCGCG-
CTAACGCGAGTCGTACGC 55
**********************************************-
*********
232CCGTCAACGCGGATCAATCGCGCGACTTGTGCGCGACGTTAGA-
CCGCCGATCGTCAAGCG 120
dT1 CCGTCAACGCGGATCAATCGCGCGACTTGTGCGCGACGTTAGA-
CCGCCGATCGTCAAGCG 115
dT2CCGTCAACGCGGATCAATCGCGCGACTTGTGCGCGACGTTAGA-
CCGCCGATCGTCAAGCG 120
dT12 CCGTCAACGCGGATCAATCGCGCGACTTGTGCGCGACGTTAG-
ACCGCCGATCGTCAAGCG 115
************************************************-
************
232CCGATCGGTAATCGGACGATTCGGATACGCGAGTTCGGACGTA-
CGAGCGTGATACGGCGC 180
dT1 CCGATCGGTAATCGGACGATTCGGATACGCGAGTTCGGACGTA-
CGAGCGTGATACGGCGC 175
dT2 CCGATCGGTAATCGGACGATTCGGATACGCGAGTTCGGACGTA-
CGAGCGTGATACGGCGC 180
dT12 CCGATCGGTAATCGGACGATTCGGATACGCGAGTTCGGACGT-
ACGAGCGTGATACGGCGC 175
************************************************-
************
232GTAACGGTGCGCGTTAAAACGCCGACGCGTCATAACCGCGACT-
CGTCGACGC 232
dT1GTAACGGTGCGCGTTAAAACGCCGACGCGTCATAACCGCGACT-
CGTCGACGC 227
dT2GTAACGGTGCGCG------CGCCGACGCGTCATAACCGCGACT-
CGTCGACGC 226
dT12 GTAACGGTGCGCG------CGCCGACGCGTCATAACCGCGAC-
TCGTCGACGC 221
************* *********************************
Acknowledgments
We thank Leslie Gaffney for help with the figures and Katrin Hoffmann
and Philipp Selenko for critical discussion and encouragement.
Author Contributions
Conceived and designed the experiments: MGG RMG WE JP EM PR MB
MCZ KL-T FDP. Performed the experiments: JP MB TB RS. Analyzed
the data: EM PR MCZ MGG. Contributed reagents/materials/analysis
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org9May 2011 | Volume 6 | Issue 5 | e20136

Page 10

tools: EM PR MCZ MGG. Wrote the paper: MGG RMG JP EM WE
MCZ FDP KL-T. Had the idea: MGG RMG. Designed laboratory
experiments: JP WE RMG. Performed all in vitro experiments: JP.
Designed and conducted the protein-DNA binding experiments: MB.
Constructed the RNA library: TB RS. Conceived of and implemented the
computational analyses: EM PR MCZ MGG. Advised on experimental
design, computational analyses, and interpretation: KL-T FDP.
References
1. Wurm FM (2004) Production of recombinant protein therapeutics in cultivated
mammalian cells. Nature Biotechnology 22: 1393–1398.
2. Omasa T, Onitsuka M, Kim W-D (2010) Cell engineering and cultivation of
Chinese hamster ovary (CHO) cells. Curr Pharm Biotechnol 11: 233–240.
3. Hossler P, Khattak SF, Li ZJ (2009) Optimal and consistent protein glycosylation
in mammalian cell culture. Glycobiology 19: 936–949.
4. Butler J, Kadonaga J (2002) The RNA polymerase II core promoter: a key
component in the regulation of gene expression. Genes Dev 16: 2583–2592.
5. Juven-Gershon T, Hsu J, Theisen J, Kadonaga J (2008) The RNA polymerase II
core promoter - the gateway to transcription. Curr Opin Cell Biol 20: 253–259.
6. Smale S, Kadonaga J (2003) The RNA polymerase II core promoter. Annu Rev
Biochem 72: 449–479.
7. Babu MM, Luscombe NM, Aravind L, Gerstein M, Teichmann SA (2004)
Structure and evolution of transcriptional regulatory networks. Curr Opin Struct
Biol 14: 283–91.
8. Stegmaier P, Kel AE, Wingender E (2004) Systematic DNA-binding domain
classification of transcription factors. Genome Inform 15: 276–86.
9. Berger MF, Philippakis AA, Qureshi AM, He FS, Estep PW, et al. (2006)
Compact, universal DNA microarrays to comprehensively determine transcrip-
tion-factor binding site specificities. Nature Biotechnology 24: 1429–1435.
10. Berger MF, Badis G, Gehrke AR, Talukder S, Philippakis AA, et al. (2008)
Variation in homeodomain DNA binding revealed by high-resolution analysis of
sequence preferences. Cell 133: 1266–76.
11. Badis G, Berger MF, Philippakis AA, Talukder S, Gehrke AR, et al. (2009)
Diversity and Complexity in DNA Recognition by Transcription Factors.
Science 324: 1720–1723.
12. Hochheimer A, Tjian R (2003) Diversified transcription initiation complexes
expand promoter selectivity and tissue-specific gene expression. Genes Dev 17:
1309–1320.
13. Georges AB, Benayoun BA, Caburet S, Veitia RA (2010) Generic binding sites,
generic DNA-binding domains: where does specific promoter recognition come
from? FASEB J 2: 346–56.
14. Veitia RAA (2003) Sigmoidal transcriptional response: cooperativity, synergy
and dosage effects. Biol Rev Camb Philos Soc 78: 149–170.
15. Carninci P, Sandelin A, Lenhard B, Katayama S, Shimokawa K, et al. (2006)
Genome-wide analysis of mammalian promoter architecture and evolution. Nat
Genet 38: 626–35.
16. Liston DR, Johnson PJ (1999) Analysis of a Ubiquitous Promoter Element in a
Primitive Eukaryote: Early Evolution of the Initiator Element. Mol Cell Biol 19:
2380–8.
17. Deng W, Roberts SG (2007) TFIIB and the regulation of transcription by RNA
polymerase II. Chromosoma 116: 417–29.
18. Bird A (1986) CpG-rich islands and the function of DNA methylation. Nature
321: 209–213.
19. Gardiner-Garden M, Frommer M (1987) CpG islands in vertebrate genomes.
J Mol Biol 196: 261–282.
20. Kim T, Barrera L, Zheng M, Qu C, Singer M, et al. (2005) A high-resolution
map of active promoters in the human genome. Nature 436: 876–880.
21. Cooper DN, Krawczak M (1989) Cytosine methylation and the fate of CpG
dinucleotides in vertebrate genomes. Hum Genet 83: 181–8.
22. Bernardi G (1993) The Vertebrate Genome: Isochores and Evolution. Mol Biol
Evol 10: 186–204.
23. Rozenberg JM, Shlyakhtenko A, Glass K, Rishi V, Myakishev MV, et al. (2008)
All and only CpG containing sequences are enriched in promoters abundantly
bound by RNA polymerase II in multiple tissues. BMC Genomics 9: 67.
24. Hsu F, Kent WJ, Clawson H, Kuhn RM, Diekhans M, et al. (2006) The UCSC
Known Genes. Bioinformatics 22: 1036–46.
25. Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, et al. (2004) A gene atlas of
the mouse and human protein-encoding transcriptomes. Proc Natl Acad Sci
USA 101: 6062–7.
26. International Human Genome Sequencing Consortium (2001) Initial sequenc-
ing and analysis of the human genome. Nature 409: 860–921.
27. de Bruijn NG (1946) A Combinatorial Problem. Koninklijke Nederlandse
Akademie v Wetenschappen 49: 758–764.
28. Haseloff J, Ajioka J (2009) Synthetic biology: history, challenges and prospects.
J R Soc Interface 6: S389–S391.
29. Benner SA, Sismour AM (2005) Synthetic biology. Nat Rev Genet 6: 533–543.
30. Munteanu A, Constante M, Isalan M, Sole RV (2010) Avoiding transcription
factor competition at promoter level increases the chances of obtaining
oscillation. BMC Systems Biology 4: 66.
31. Reese MG (2001) Application of a time-delay neural network to promoter
annotation in the Drosophila melanogaster genome. Comput Chem 26: 51–6.
Using Nucleotide Composition to Engineer Promoters
PLoS ONE | www.plosone.org 10May 2011 | Volume 6 | Issue 5 | e20136