Identification of a Streptococcus pyogenes SF370 gene involved in production of c-di-AMP.

Abstract

Here we show that bis(3'-5') cyclic diadenylic acid (c-di-AMP) and a diadenylate cyclase (DAC) domain protein involved in the biosynthesis of c-di-AMP were identified in Streptococcus pyogenes. The matrix-assisted laser desorption ionization (MALDI)-time of flight (TOF) mass spectrum of the cell extract of S. pyogenes, which showed a fragment pattern very similar to that of the authentic sample of c-di-AMP, revealed that S. pyogenes produces c-di-AMP in the cell. Subsequently, we confirmed by an in vitro experiment that the production of c-di-AMP in the cell is due to the action of Spy1036 gene encoding a DAC domain protein named spyDAC, which is a new protein different from a well-known diadenylate cyclase. Moreover, the experiment gave a product with a molecular weight of 657.021, which is consistent with the molecular weight of c-di-AMP. Furthermore, the mass spectral fragment pattern of the product obtained by the in vitro biosynthesis is quite similar to that of the product produced by the above in vivo experiment. This in vitro production of c-di-AMP indicated that spyDAC in S. pyogenes actually catalyzes the in vivo biosynthesis of c-di-AMP from ATP.

Full text

Page 1

49
ORIGINAL PAPER
Nagoya J. Med. Sci. 73. 49 ~ 57, 2011
IDENTIFICATION OF A STREPTOCOCCUS PYOGENES
SF370 GENE INVOLVED IN PRODUCTION OF C-DI-AMP
TAICHI KAMEGAYA1, KENJI KURODA2 and YOSHIHIRO HAYAKAWA2,3
1Graduate School of Medicine, Nagoya University
2Graduate School of Information Science/Human Informatics, Nagoya University
3Faculty of Engineering, Aichi Institute of Technology
ABSTRACT
Here we show that bis(3’–5’) cyclic diadenylic acid (c-di-AMP) and a diadenylate cyclase (DAC)
domain protein involved in the biosynthesis of c-di-AMP were identified in Streptococcus pyogenes.
The matrix-assisted laser desorption ionization (MALDI)-time of flight (TOF) mass spectrum of the cell
extract of S. pyogenes, which showed a fragment pattern very similar to that of the authentic sample of
c-di-AMP, revealed that S. pyogenes produces c-di-AMP in the cell. Subsequently, we confirmed by an
in vitro experiment that the production of c-di-AMP in the cell is due to the action of Spy1036 gene
encoding a DAC domain protein named spyDAC, which is a new protein different from a well-known
diadenylate cyclase. Moreover, the experiment gave a product with a molecular weight of 657.021, which
is consistent with the molecular weight of c-di-AMP. Furthermore, the mass spectral fragment pattern of
the product obtained by the in vitro biosynthesis is quite similar to that of the product produced by the
above in vivo experiment. This in vitro production of c-di-AMP indicated that spyDAC in S. pyogenes
actually catalyzes the in vivo biosynthesis of c-di-AMP from ATP.
Key Words: Streptococcus pyogenes, c-di-AMP, Diadenylate cyclase, spyDAC
INTRODUCTION
The synthesis of c-di-AMP in Bacillus subtilis occurs in the diadenylate cyclase (DAC)
domain of DNA integrity scanning A (DisA) via the condensation of two ATP molecules. The
DisA scouts the chromosome for DNA double-stranded breaks, which has led to the suggestion
that c-di-AMP is involved in the signaling of DNA damage1). Subsequent genomic mining has
revealed that DAC domain proteins are widespread in bacteria and archaea, with many of them
associated with putative sensor domains2).
The binding of DisA to branched nucleic acids through its C-terminal helix-hairpin-helix (HhH)
domain inhibits its diadenylate cyclase activity, whereas binding to the double-stranded DNA is
very weak and has no effect on diadenylate cyclase activity. Branched DNA is formed as an
intermediate structure during the repair of DNA double-strand breaks by homologous recombina-
tion. DNA double-strand breaks occur spontaneously during the cell cycle, for example, during
segregation of chromosomes or when the replication fork is stalled. DNA double-strand breaks
can also be induced by exogenous agents3,4). Upon introduction of a DNA double-strand break,
Corresponding author: Taichi Kamegaya
Graduate School of Medicine, Nagoya University
Phone: +81-52-744-2102, Fax: +81-52-744-2107, E-mail: kamegaya@med.nagoya-u.ac.jp

Page 2

50
Taichi Kamegaya et al.
DisA colonizes with the expected site of the lesion. Therefore, the creation of DNA double-strand
breaks interferes with successful c-di-AMP production. In general terms, the regulatory role of
c-di-AMP might also regulate the timing or amplitude of some cellular processes, some of which
may be associated with chromosomal repair and damage signaling. Low c-di-AMP synthesis may
be involved in adaptation failure caused by exceptionable stimuli such as ultra violet (UV) light,
oxidative stress or DNA double-strand breaks2).
Genomic analyses of Firmicutes have revealed that a DisA homolog is widespread in spore-
forming bacteria such as Bacillus spp. and Clostridium spp. Incidentally, S. pyogenes is a human
pathogen that causes a variety of clinical manifestations ranging from non-invasive diseases (e.g.,
pharyngitis and impetigo) to severe invasive infections (e.g., necrotizing fasciitis, sepsis, and toxic
shock-like syndrome)5,6). However, B. subtilis is capable of sporulation, while S. pyogenes is not.
Therefore, it is possible that DAC domain proteins, which would be responsible for different
cellular processes, are present in S. pyogenes, and that their identification will help elucidate
the survival strategy during the transition of S. pyogenes from persistence in the environment to
survival in the human host. Thus, the goal of this study was to determine whether c-di-AMP
is synthesized in S. pyogenes.
MATERIALS AND METHODS
Bacterial strains and growth conditions The bacterial strains used in this study are listed
in Table 1. S. pyogenes SF370 was grown in a brain heart infusion broth (BHI, BD, Franklin
Lakes, New Jersey, U.S.) or on a BHI agar plate supplemented with 0.3 % Yeast extract (YE,
BD) at 37°C without shaking.
Escherichia coli XL-1 blue was used for the host of plasmids. Transformants containing
plasmids were grown at 37°C in Luria-Bertani (LB) broth or on LB agar plates. When required,
LB broth and LB agar plates were supplemented with ampicillin and chloramphenicol to final
concentrations of 100 and 50 μg/ml, respectively.
Table 1 Bacterial strains, plasmids, and primers used in this study
Bacterial strain Characteristic / genotypeReference/source
S. pyogenes strain
SF370
emm1, φSF370.4, mutS+, mutL, ruvA
20
Other strains
E. coli XL-1 blue endA1 gyrA96(nalR) thi-1 recA1 re1A1 lac glnV44 F'[::Tn10 proAB+lacIq D(lacZ)M15] hsdR17(rk
F– ompT hsdSB(rB
E. coli XL-1 blue with pCold-spy1036 vector
– mk
+) laboratory strain
E. coli Rosetta 2
– mB
–) gal dcm pRARE2 (CamR) laboratory strain
XL-pCold-spy1036this study
Rosetta2-pCold-spy1036
E. coli Rosetta 2 with pCold-spy1036 vectorthis study
Rosetta2-pCold
E. coli Rosetta 2 with pCold TF vector (Negative control)this study
plasmid
pCold TF vectorCold-shock expression vector 11,14
PrimersSequencea
exSpy1036FGCCGCATATGAATAATTTATCTAGTATCGATATTAAATTTTTATTAAGthis study
exSpy1036R
GCCGCTCGAGTCATTTAGATTTCCCTCCTAGthis study
pCold-TF-F2 GCGAAAGTGACTGAAAAAGTakarab
pCold-R GGCAGGGATCTTAGATTCTG Takarab
a Newly introduced restriction sites are underlined.
b Primer was referred to manufacturer’s protocol (http://catalog.takara-bio.co.jp/product/manual_info.asp?unitid=U100004634).

Page 3

51
C-DI-AMP PRODUCTION IN STREPTOCOCCUS PYOGENES SF370
DNA manipulation A DNA ligation reaction mixture was introduced by electroporation into E.
coli Rosetta 2 (Merck, Whitehouse Station, New Jersey, U. S.). Electroporation for plasmids into
bacterial cells was carried out according to the manufacturer’s instructions. PCRs were performed
using KOD plus DNA polymerase (TOYOBO, Osaka, Osaka). Restriction endonucleases and
T4 DNA ligase were purchased from New England Biolabs (Ipswich, Massachusetts, U.S.) and
Promega (Madison, Wisconsin, U. S.) respectively. All enzymes were used as recommended by
suppliers. Purification of DNA fragments was carried out with a QIAquick PCR purification kit
and/or a QIAquick gel extraction kit (QIAGEN, Strasse, Hilden, Germany), with the extraction
of plasmid DNA performed using a QIAprep Spin Miniprep Kit (QIAGEN). The primers used
in PCRs and sequencing reactions are listed in Table 1. Selected transformants were confirmed
using PCR and sequence analysis as recommended by suppliers.
Isolation and detection of c-di-AMP from S. pyogenes The Isolation and detection of c-di-AMP
was carried out as described previously7,8), replacing bis (3’–5’) cyclic diguanylic acid (c-di-GMP)
to c-di-AMP. S. pyogenes overnight cultures were inoculated on BHI-YE agar plates. The bacterial
cells were harvested the next day from the BHI-YE plates. For ethanol extraction, the bacterial
cells (approximately 100 mg wet WT) were washed with water and resuspended in 300 μl of
water. The suspension was heated at 100°C for 10 min and nucleotides were extracted twice
with 700 μl of 70 % ice-cold ethanol. The extract was lyophilized and saved in a freezer. The
extract equivalent to 100 mg cells was adjusted to 500 μl in 0.1 M ammonium acetate buffer
pH 7.0. (Nacalai Tesque, Kyoto, Kyoto)
High-performance liquid chromatography (HPLC) was performed on a 250×3.0 mm reverse
phase column (5C18-AR-II cosmosil/cosmogel packed column; Nacalai Tesque). Running condi-
tions were optimized using synthetic c-di-GMP. Runs were carried out in 0.1 M ammonium
acetate buffer pH 7.0 at 0.4 ml min–1 using a linear gradient. Fractions containing c-di-AMP of
800 μl were collected and lyophilized.
Mass spectrometric analysis of fractions containing c-di-AMP The collected fraction of 800 μl
or synthetic c-di-AMP was applied on a stainless-steel target by fast evaporation method (matrx:
α-cyano 4-hydroxycinnamic acid). After drying, MALDI-TOF mass spectrometric analysis was
performed on an UltraflexIII (Bruker Daltonics, Billerica, Massachusetts, U. S.) mass spectrometer
using a negative ion mode8).
Plasmid construction and introduction into E. coli Rosetta 2 competent cells Spy1036 gene
of S. pyogenes SF370 was amplified using primers exSpy1036F(5’-GCCGCATATGAATAATT
TATCTAGTATCGATATTAAATTTTTATTAAG-3’) and exSpy1036R(5’-GCCGCTCGAGTCATTTA
GATTTCCCTCCTAG-3’) for cloning. The purified fragment was ligated into Nde I and Xho
I sites at pCold TF vector (TaKaRa, Otsu, Shiga)9,10) multi-cloning site, and the product was
introduced into E. coli XL-1 blue strain with electroporation using a Bio-Rad gene pulser at
1.75 kV, 200 Ω, and 25 μF. After selection, the transformant was confirmed by PCR, and pCold
exSpy1036 was finally generated.
After 1 μg of pCold exSpy1036 was added to 20 μl of E. coli Rosetta 2 competent cells,
the mixture was incubated on ice for 5 min, after which it was heated for 30 sec in a water
bath, and heated mixture was incubated on ice for 2 min. Then, 250 μl of SOC medium was
added to the mixture, and incubated at 37°C for 1 hour. Adequate cells were inoculated into
the selective medium, and transformants were selected.
Expression and purification of spyDAC. E. coli Rosetta 2 carrying pCold exSpy1036 was
grown in the medium with ampicillin (100 μg/ml) and chloramphenicol (50 μg/ml), and the
expression was induced by cold shock (15°C) at OD660 0.4 for 30 min. Isopropyl 1-thio-β-D-
galactopyranoside was then added to the culture at a final concentration of 0.5 mM and incubated
at 15°C for 3 hours with shaking. After collection with centrifugation, the cells were resuspended

Page 4

52
Taichi Kamegaya et al.
in 15 ml lysis buffer with an Ni-NTA fast start kit (QIAGEN). The suspension was incubated on
ice for 30 min, centrifuged at 14,000 ×g, and the supernatant was collected. 0.01 g of imidazole
was added, it and the solution was loaded onto Ni-NTA column. Which was then washed twice
with wash buffer. The His6 protein was eluted with 1 ml of the buffer containing 250 mM
imidazole. The expression and purification of the protein were carried out as recommended by
suppliers. The eluted protein fraction was dialyzed overnight in Slide-A-Lyzer 10,000 molecular
weight cut-off dialysis cassettes (Thermo Fisher Scientific, Waltham, Massachusetts, U. S.) against
a reaction buffer (100 mM NaCl, 40 mM Tris-HCl, pH 7.8, 10 mM MgCl2). The extracted His6
protein was examined for purify with SDS-PAGE, and the concentration was measured using a
bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific).
Synthesis of c-di-AMP with enzyme assay In vitro enzymatic synthesis of c-di-AMP was carried
out with the method of Witte G et al.1) in dependence upon the enzymatic assay11,12,13,14,15). A
reaction mixture containing the purified 5 μM His6 protein in 100 mM NaCl, 40 mM Tris-HCl,
pH 7.8, 10 mM MgCl2 and 100 μM ATP was prepared, and the resulting mixture was then
incubated at 37°C for 1 hour. After the incubation, the mixture was immediately precipitated by
heating for 2 min at 100°C followed by centrifugation for 1 min at 14,000 rpm. One hundred
μl of the suspension was analyzed with HPLC as described above. An equivalent to the reaction
mixture of 600 μl was applied to MALDI-TOF mass spectrometric analysis.
RESULTS
To determine whether c-di-AMP is produced in S. pyogenes SF370 cell, nucleotides were
extracted with ethanol8) and the cell extract was analyzed with reversed-phase HPLC coupled
with MALDI-TOF analysis using the conditions optimized for separation and detection of c-di-
AMP (Fig. 1B). The retention time (tr) of synthetic c-di-AMP (Biolog, Flughafendamm, Bremen,
Germany) represents 20.6 min under these conditions. The same retention time was observed in
the extract from S. pyogenes SF370 (Fig. 1A).
The relevant fraction was collected and subjected to MALDI-TOF analysis to verify the
presence of c-di-AMP. The mass/charge (m/z) ratio of c-di-AMP (m/z = 657.001) was detected
in fractions from the extract of S. pyogenes SF370. In addition, the MS/MS spectra of the [M-
H]– ion at m/z 657 yielded identical fragmentation products (Fig. 2 C and D) for both of the
isolated and synthetic c-di-AMP compounds (Fig. 2 A and B).
Consequently, these experiments suggested that S. pyogenes SF370 synthesizes c-di-AMP in
vivo. Genomic analysis revealed that a gene encoding a protein comparable to DisA in B. subtilis
was not present in S. pyogenes SF370. However, a protein, which was encoded by spy1036,
containing a sequence with high scores of identity and similarity to the DAC domain was found
with a BLAST search (Fig. 3). We therefore speculated that the spy1036 protein belonged to the
protein family containing a DAC domain and designated it as spyDAC. Römling2) has reported
that spyDAC is composed of a trans-membrane domain (TM-DAC domain) and a DAC domain
without a DNA-binding domain (HhH domain). Thus, spyDAC has a considerably different
domain structure compared with that of DisA. Moreover, it seems likely that spyDAC possesses
the DAC activity since the protein contains the Asp- Gly- Ara (DGA) and Arg- His-Arg (RHR)
motifs responsible for the cyclase reaction (Fig. 3).
We therefore tested whether spyDAC synthesizes c-di-AMP from ATP in vitro. In vitro
enzymatic activitiy of spyDAC was investigated as follows; spy1036 gene was cloned into pCold
exSpy1036 and spyDAC was overexpressed in E. coli Rosetta 2. spyDAC was purified and assayed
for various nucleotides. The assay buffer and reaction conditions were essentially as described

Page 5

53
C-DI-AMP PRODUCTION IN STREPTOCOCCUS PYOGENES SF370
Fig. 1 Detection of c-di-AMP in nucleotide extracts from S. pyogenes SF370 by HPLC analysis. An overlay
of the A254 curves from reverse-phase HPLC analysis of extracts from S. pyogenes SF370 grown on
BHI-YE agar plates at 37°C overnight was shown (A). The peak at 20.6 min represents c-di-AMP, as
determined from its correspondence to the retention time of chemically synthetic c-di-AMP (B). For the
assessment of DAC activity, synthetic c-di-AMP was added to nucleotide extract and represented traces
from the HPLC analysis of the S. pyogenes extract containing synthetic c-di-AMP (C).
Fig. 2 Detection of c-di-AMP in vivo. MALDI-TOF analysis of relevant HPLC fractions was performed in
the negative-ion detection mode. c-di-AMP was detected at a mass-to-charge ratio (m/z) of 657 [M-H].
Fractions were derived from synthetic c-di-AMP (positive control) (A) and S. pyogenes SF370 (B). Three
major ions were visible in the fragmentation pattern, whereby m/z 133 and 521 corresponded to products
from single bond fragmentation. Black lines indicate ion fragmentation by single- and double-bond
cleavage as detected by MS/MS displayed in C and D.