New FAAH inhibitors based on 3-carboxamido-5-aryl-isoxazole scaffold that protect against experimental colitis.

Abstract

Growing evidence suggests a role for the endocannabinoid (EC) system, in intestinal inflammation and compounds inhibiting anandamide degradation offer a promising therapeutic option for the treatment of inflammatory bowel diseases. In this paper, we report the first series of carboxamides derivatives possessing FAAH inhibitory activities. Among them, compound 39 displayed significant inhibitory FAAH activity (IC(50)=0.088 μM) and reduced colitis induced by intrarectal administration of TNBS.

Full text

Page 1

New FAAH inhibitors based on 3-carboxamido-5-aryl-isoxazole scaffold
that protect against experimental colitis
Virginie Andrzejaka, Giulio G. Mucciolib,e, Mathilde Body-Malapelc, Jamal El Bakalia, Madjid Djouinac,
Nicolas Renaultd, Philippe Chavatted, Pierre Desreumauxc, Didier M. Lamberte, Régis Milleta,⇑
aUniversité Lille Nord de France, ICPAL, EA 4481, IFR114, 3 rue du Professeur Laguesse, BP-83, F-59006 Lille, France
bUniversité Catholique de Louvain, Louvain Drug Research Institute, Bioanalysis and Pharmacology of Bioactive Lipids Lab, 72 Avenue E. Mounier (CHAM7230),
B-1200 Bruxelles, Belgium
cUniversité Lille Nord de France, INSERM U995, Faculté de Médecine, Amphi J & K, IFR114, Boulevard du Professeur Leclercq, F-59045 Lille, France
dUniversité Lille Nord de France, Faculté des Sciences Pharmaceutiques et Biologiques, Laboratoire de Chimie Thérapeutique, EA 4481, IFR 114, 3 rue du Professeur Laguesse,
BP-83, F-59006 Lille, France
eUniversité catholique de Louvain, Louvain Drug Research Institute, Unité de Chimie Pharmaceutique et de Radiopharmacie, 73 Avenue E. Mounier UCL (CMFA7340),
B-1200 Bruxelles, Belgium
a r t i c l ei n f o
Article history:
Received 10 February 2011
Revised 26 April 2011
Accepted 30 April 2011
Available online 6 May 2011
Keywords:
FAAH
Cannabinoids
IBD
Isoxazole
FAAH modeling
a b s t r a c t
Growing evidence suggests a role for the endocannabinoid (EC) system, in intestinal inflammation and
compounds inhibiting anandamide degradation offer a promising therapeutic option for the treatment
of inflammatory bowel diseases. In this paper, we report the first series of carboxamides derivatives pos-
sessing FAAH inhibitory activities. Among them, compound 39 displayed significant inhibitory FAAH
activity (IC50= 0.088 lM) and reduced colitis induced by intrarectal administration of TNBS.
? 2011 Elsevier Ltd. All rights reserved.
1. Introduction
Endocannabinoids (ECs), including anandamide (AEA) and
2-arachidonoylglycerol (2-AG), are arachidonic acid derived bioac-
tive lipids that are biosynthesized on demand, and which, following
the activation of both cannabinoid receptors (CB1and CB2) trigger a
wide range of biological responses. These physiological effects are
transientdueto a rapidinactivation of ECsby specificenzymessuch
as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase
(MAGL).1–4
In the gastrointestinal tract, these endogenous ligands control,
notably via CB1and/or CB2receptor activation, many physiological
functionsincludingintestinalmotility,secretionandinflammation.5
Accordingly, stimulation of cannabinoid receptors directly or
indirectly constitutes a promising strategy to treat several gastroin-
testinal pathologies, especially diseases wherein an inflammatory
process is involved such as, for example, inflammatory bowel
diseases.
For that matter, increased levels of AEA as well as up-regula-
tion of cannabinoid receptors expression were reported during
intestinal inflammation,6–8and described as a protective mecha-
nism to counteract inflammation.9Over the past few years sev-
eral studies have provided evidence that exogenous agonists
acting at CB1 and/or CB2 receptors, as well as inhibitors of EC
re-uptake and degradation, provide protection against experimen-
tal colitis.10–12Indeed, it has been shown that the nonselective
cannabinoid receptor agonist HU210 as well as the two selective
CB2 receptor agonist JWH133 and AM1241 are able to signifi-
cantly reduce inflammation in hapten-induced colitis in mice.10
Consistent with these results, both genetic and pharmacological
blockade of either CB1or CB2receptor signaling led to a worsen-
ing of colitis in these experimental models.10Another approach
consisting in raising anandamide levels has been successfully ap-
plied to reduce intestinal inflammation by using inhibitors of EC
membrane transport (VDM11) or FAAH (URB597).11The involve-
ment of both cannabinoid receptors was confirmed by performing
experiments in CB1and CB2knock out mice.
Targeting FAAH is of particular interest since it increases AEA,
and related
N-acylethanolamines,levelswithouttriggering
0968-0896/$ - see front matter ? 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2011.04.057
⇑Corresponding author. Tel.: +33 320964374; fax: +33 320964906.
E-mail address: regis.millet@univ-lille2.fr (R. Millet).
Bioorganic & Medicinal Chemistry 19 (2011) 3777–3786
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc

Page 2

psychotropic
activation.13It is noteworthy that these side effects represent a
real curb for the use of CB1-interacting ligands in therapeutic.
Thus, inhibitors of FAAH account for a real option to elicit the
pharmacological effects of CB1receptor activation, while avoiding
CNS side effects.
In this context, we undertook the development of a new series
of FAAH inhibitors based on a 3-carboxamido-5-aryl-isoxazole
scaffold, which general structure is shown in Figure 1. We chose
this template because:
effectsassociated withcentralCB1
receptor
(i) Amide derivatives represent an extension and an alternative
to
a-ketoheterocycles(OL-135),14
(URB597) and ureas (PF622)16usually described as potent
FAAH inhibitors;
arylcarbamates15
(ii) Isoxazole rings have never been described as FAAH inhibi-
tors and the interactions with the enzyme are expected to
be different to the one observed with a-ketooxazoles, since
it has been shown that small changes in the nature of the
heterocycle result in huge differences in activity.16
The amide function introduced at the C-3 position of the isoxaz-
ole was hypothesized to interact with Ser241 of the Ser–Ser–Lys
catalytic triad of FAAH and the aryl group in C-5 position, to fill
in the wide hydrophobic pocket (acyl binding pocket) of the en-
zyme.17Finally, we introduced different aromatic groups, more
or less distant from the carboxamide function at position 3, to
complete the structure–activity relationships.
The FAAH inhibitory potential of the newly synthesized
compounds was evaluated and our lead was then assayed in the
NHO
N
N
O
N
O
N
N
H
O
O
ONH2
O
O
O
O
O
O
Br
H
N
R
O
Ar
O
N
Ar :
R :
226FP531 -LO795BRU
Figure 1. General structure of novel 3-amido-5-aryl-isoxazole derivatives compared to URB597, OL-135 and ureas (compound A).
3778
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786

Page 3

experimental model of TNBS-induced colitis (TNBS: 2,4,6-trinitro-
benzene sulfonic acid), allowing the identification of a new FAAH
inhibitor endowed with anti-inflammatory properties in the gut.
2. Results and discussion
2.1. Synthesis of inhibitors
The target 3-carboxamido-5-aryl-isoxazoles 30–48 were ob-
tained in four steps from arylketones, as described in Scheme 1.
When the aromatic ketones were not commercially available a
preliminary additional step, consisting in a Suzuki coupling
reaction, was used (compounds 1 and 2). Then, arylketones
underwent a Claisen condensation to afford 1,3-diketoesters
3–11, obtained in their enol forms, in variable yields (37–99%).
Cyclisation into 3-carboxylate-5-aryl-isoxazole (compounds 12–
20) was carried out by addition of hydroxylamine hydrochloride
on 1,3-diketoesters as previously described.18The target com-
pounds 30–48 were finally obtained in moderate yields (47–
80%), by saponification of the ethyl ester function of compounds
12–21 with sodium hydroxide followed by amidification under
peptide coupling conditions (HOBt/HBTU).
2.2. In vitro pharmacology
The novel3-carboxamido-5-aryl-isoxazoleshavebeen
evaluated for their ability to inhibit the hydrolysis of [3H]-AEA by
a recombinant human FAAH preparation.19–21Inhibitory data are
summarized in Table 1.
From a structure–activity relationship perspective, compounds
can be divided into two series, depending on their aromatic termi-
nal group borne by the carboxamide at C-3 position: compounds
30–36 and 45–46 possess a phenyl terminal group (series A)
whereas compounds 37–44 and 47–48 are characterized by a
1,3-benzodioxolyl moiety.
We started our investigations by evaluating the importance of
the substituent borne by the amide at C-3. This first part of the
study was carried out with a 4-biphenyl at C-5 position since this
group generally led to compounds with high affinity for FAAH.17
Thus, compounds 32, 39 and 45–48 were synthesized allowing
the emergence of some interesting SAR. Indeed, in the series A,
the increase of the chain length led to a 200-fold improvement of
the activity with IC50values decreasing from 105 lM for 45 (benzyl
group), to 0.501 lM for 32 (phenylpropyl group). As for the series
B, no significant difference was observed between the activities of
compound 47 (1,3-benzodioxolyl) and 48 ((1,3-benzodioxol-
yl)methyl). More surprisingly, a sharp increase (>1000-fold) of
activity was noticed when the (1,3-benzodioxolyl)methyl of com-
pound 48 (IC50= 92.1 lM) was replaced with the (1,3-benzodioxol-
yl)ethyl moiety (compound 39, IC50= 0.088 lM). It is noteworthy
that when direct comparison was possible, compounds from series
Br
CH3
O
CH3
O
a
1-2
ArCH3
O
b
Ar
O
COOEt
OH
c
O
N
Ar
COOEt
3-11
12-20
1-2 and commercially
available arylketones
d
O
N
Ar
COOH
21-29
e
O
N
Ar
CONHR
30-48
Scheme 1. Reagents and conditions: (a) phenylboronic acid, K2CO3, DME/H2O (1:1),
rt, 48 h; (b) diethyl oxalate, sodium ethanolate, EtOH, reflux, 2 h; (c) hydroxylamine
hydrochloride, EtOH, reflux, 2 h; (d) sodium hydroxide, EtOH (95%), rt, 24 h; (e)
R–NH2, HBTU, HOBt, DIPEA, CH2Cl2, rt, 24 h.
Table 1
Structures and inhibitory activities of compounds 30–48a
O
N
Ar
N
H
O
R
CompoundsAr R IC50(lM) or FAAH (% inhibition)
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
Phenyl
4-Bromophenyl
4-Biphenyl
2-Phenantryl
2-Naphthyl
P-Tolyl
4-Trifluoromethylphenyl
Phenyl
4-Bromophenyl
4-Biphenyl
2-Naphthyl
p-Tolyl
4-Trifluoromethylphenyl
2-Biphenyl
3-Biphenyl
4-Biphenyl
4-Biphenyl
4-Biphenyl
4-Biphenyl
Phenylpropyl
Phenylpropyl
Phenylpropyl
Phenylpropyl
Phenylpropyl
Phenylpropyl
Phenylpropyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
2-(Benzo[d][1,3]dioxol-5-yl)ethyl
Benzyl
Phenethyl
Benzo[d][1,3]dioxol-5-yl
2-(Benzo[d][1,3]dioxol-5-yl)methyl
30.78%
251 ± 41 lM
0.50 ± 0.1 lM
12.6 ± 1.5 lM
38.7%
125 ± 31 lM
25.1 ± 6.0 lM
25.1 ± 3.7 lM
39.8 ± 5.1 lM
0.088 ± 0.004 lM
10.0 ± 0.4 lM
79.4 ± 14 lM
20.0 ± 2.2 lM
2.6%
43.8 ± 4.8 lM
105.0 ± 15 lM
70.0 ± 10 lM
57.5 ± 8.5 lM
92.1 ± 18 lM
aData represent the mean ± SEM of three experiments performed in duplicate.
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786
3779

Page 4

B (37–42) exhibit higher affinities for FAAH than their counterparts
in the series A (30–36). This significant difference of activity is
probably due to the ability of the 1,3-benzodioxolyl group to estab-
lish hydrogen bonds with the protein.
These data demonstrate that the activity is very sensitive to the
nature of the terminal aromatic group borne by the carboxamide at
position 3, as well as the length of the carbon chain linking this
terminal group to the heterocyclic core. Consequently, for the sec-
ond part of the study, we decided to retain the phenylpropyl and
(1,3-benzodioxolyl)ethyl group as 3-carboxamido substituent, for
the series A and B, respectively.
Next, we sought to evaluate the impact of the aromatic substitu-
ent at C-5 position of the isoxazole ring by replacing the 4-biphenyl
moiety by other aromatic groups (compounds 30–31, 33–38, and
40–42). Unfortunately, regardless to the C-3 substituent, this strat-
egy resulted in compounds with only moderate or no affinity for
FAAH. Indeed, introducing bromine, methyl or trifluoromethyl in
place of one phenyl of the 4-biphenyl group (e.g., compare com-
pounds 38, 41 and 42 vs 39) resulted in a drastic reduction in FAAH
inhibition. Analogously, the rigidification of the 4-biphenyl into 2-
phenantryl as well as its replacement with a phenyl or a 2-naphtyl
group did not improve FAAH activity. Finally, we replaced the 4-
biphenylmoietybyits positionisomers inorder to study the impor-
tance of the biphenyl substitution. By comparison with compound
39 (IC50= 0.088 lM), this modification resulted in a strong reduc-
tion of the affinity as for the 3-biphenyl group (43, IC50= 43.8 lM),
whilethe2-biphenyl(44)completelyabolishedFAAHaffinity.These
data demonstrate that at C-5 position of the isoxazole ring, the 4-
biphenylsubstitutionisoptimalforFAAHactivity.Ofnote,noMAGL
inhibitory activity was detected for our lead compound (39) when
assayed at concentrations up to 30 lM (i.e., at a concentration more
than 300 times higher than its FAAH IC50).
In conclusion, compound 39, characterized by a 4-biphenyl
group at C-5 position and a (1,3-benzodioxolyl)ethyl carboxamido
substituent at position 3 of the isoxazole ring, was found to be the
most potent FAAH inhibitor of our series with an IC50value of
0.088 lM. Thus, we next conducted in silico modeling studies to
enhance our understanding of the mechanism of action of 39.
2.3. In silico study
Docking procedures in the FAAH enzyme have been performed
in order to identify key interactions of compound 39 with the en-
zyme in comparison with the binding mode of OL-135, a reference
inhibitor. Thus the holo-enzyme FAAH co-crystallized with OL-135
covalent inhibitor has been used as the target (1WJ1 PDB entry).25
Prior GOLD docking procedures26have permitted to recover the
tentop-10solutionsofOL-135,withtheGoldScorescoringfunction,
within a 2 Å RMSd (data not shown here) in comparison with its co-
crystallized conformation. As this is a covalently bound molecule,
this process assumed a modified ligand by docking its intermedi-
ate-type diol conformation and replacing the Ser241 by an Alanine
residue in order to mimic the electrophile addition of the serine
hydroxyle group by the ligand carbonyle.27As the binding mecha-
nism of 39 is not known, the docking of the compound was tested
in both wild-type and alanine-mutated targets from its initial car-
boxamidoor amino–methanediol forms, respectively. In both cases,
the best GoldScore solutions of the most representative binding
mode are so similar that only the carboxamide form of 39 is repre-
sented as docked in the wild-type FAAH receptor (Fig. 2).
In comparison with OL-135, the polar isoxazole-carboxamide
moiety of compound 39 fits in the oxyanion hole establishing
hydrogen bonds Lys142—carbonyl and Ile138—isoxazole. Never-
theless, it makes the benzodioxol chain binding further in a region
of the entrance cavity not occupied by OL-135. Note that the dock-
ing results reflect some of the structure–affinity relationships
found in the inhibition assays. Indeed, the optimal length for the
linker of the 2-(benzo[d][1,3]dioxol-5-yl) substituent is of 2 meth-
ylenes, compared to one methylene (compound 48) of none (com-
pound
47).In addition,the
benzodioxol allow an additional hydrogen bond with Gln273—
compared to the phenyl of compound 32 - which could explain
the significant gain of binding. Also, as for the OL-135, the more
hydrophobic group—4-biphenyl—is reasonably fitting in the ABP
(acyl binding pocket). However, in contrast with the acylphenyl
chain of OL-135 which is flexible enough to fit toward the
membrane access channel, the intrinsic rigid conformation of
hydrogenbond acceptorsof
Figure 2. In silico binding mode of compound 39. The best docking solution of the compound 39 (left) is compared to the co-crystallized OL-135 reference compound (right).
They are represented as sticks in yellow and magenta, respectively, as well as the covalently bound Ser241 in white. The intermolecular hydrogen bonds are displayed in
yellow dashed lines whereas intermolecular van der Waals interactions are implicitly associated to the shape of the solvent-accessible binding site, colored from blue for
polar areas to brown for lipophilic areas. Graphical inspection of models was performed on the SYBYL 6.9.2 software.28
3780
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786

Page 5

4-biphenyl constraints the docking of the terminal phenyl in a sub-
pocket thus establishing an orthogonal p–p aromatic interaction
with Phe194. The bent shape between the oxyanion hole and
ABP regions does not allow the suitable fit of 2-biphenyl (com-
pound 43) and 3-biphenyl (compound 44) which translates in
inactive compounds in the inhibition tests.
Figure 3. The FAAH inhibitor 39 protects against TNBS-induced colitis. (A) Changes in body weight at the day of sacrifice as compared with the day of colitis induction. (B)
Macroscopic score of the colonic tissue according to Wallace criteria. (C) MGG-stained colonic tissue of mice challenged with TNBS and treated with vehicle or 39. Histology of
vehicle treated mice showed massive infiltration of mononuclear cells as well as destruction of crypt architecture (top); histology of 39-treated mice showed almost normal
colonic tissue with minimal infiltration of mononuclear cells (bottom). Original magnification, ?20. (D) Histological score of the colonic tissue of the mice according to Ameho
criteria. (E) and (F) Effect of 39 on TNF and Il-1b mRNA expression levels.
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786
3781

Page 6

2.4. In vivo pharmacology
Todemonstratethe potentialofcompound39asan invivoFAAH
inhibitor we investigated the effect of our lead compound in the
mouse model of TNBS-induced colitis. Thus, compound 39 was
administered intraperitoneally once daily at the dosage of 10 mg/
kg,startingthreedaysbeforecolitisinduction.5-Aminosalicylicacid
(5-ASA, Pentasa) granules (the standard first-line therapy for pa-
tients with mild-to-moderate ulcerative colitis), mixed in food at
the dosage of 150 mg/kg, and provided ad libitum during all the
course of the experiment, was used as anti-inflammatory positive
control.22Mice were euthanized three days after TNBS administra-
tion and parameters reflecting the degree of inflammation were
assessed.
Before euthanasia, the body weight loss was evaluated. As can
be seen from Figure 3A, daily treatment with compound 39 signif-
icantly reduced body weight loss generally observed during the
development of TNBS colitis. The colon of each mouse was then
examined and damages were assessed by a semi-quantitative
scoring system.23As shown in Figure 3B, 39 induced a decrease
in colitis macroscopic scores of the same magnitude as the positive
control 5-ASA (47%, 2,2 ± 0,4 vs 4,2 ± 0,5, p 6 001). Moreover,
whereas untreated mice exhibited destruction of crypt architec-
ture and infiltration of mononuclear cells in the colonic lamina
propria, mice treated with compound 39 exhibited only minor epi-
thelial damage or cellular infiltration (Fig. 3C).
This protective effect was confirmed by the histological colitis
scores (Fig. 3D).24Indeed, 39 led to 68% decrease of the colitis his-
tological score as compared to the vehicle (1,4 ± 0,5 vs 4,4 ± 0,9,
p 6 001). Finally, the quantification of colonic TNF and IL1-b mRNA
expression, two cytokines widely involved in the inflammatory re-
sponse leading to epithelial injury, showed that systemic adminis-
trationof
39
induceda potent
comparable to the one observed after treatment with 5-ASA
(Fig. 3E and 3F).
Taken together, these data clearly indicate that our new FAAH
inhibitor is endowed with potent anti-inflammatory properties in
the gut. Our work is consistent with two previous reports that
showed that genetic ablation (FAAH?/? mice) or pharmacological
inhibition of FAAH (using URB597) could provide protection
against experimental colitis.10,11Here, we show that this anti-
inflammatory effect can be obtained with another class of FAAH
inhibitor (different from the carbamate derivative URB597), which
validate FAAH as a promising therapeutic target for the treatment
of colitis.
anti-inflammatory effect,
3. Conclusion
In this paper, we described the first series of carboxamide
derivatives that present FAAH activities. Based on 3-carboxa-
mido-5-aryl-isoxazole scaffolds, the compound presented SAR dif-
ferent from a-ketoheterocycle series. Indeed, different aromatic
substituents were introduced in C-5 position of the isoxazole
and the best activities were found with a 4-biphenyl group. The
importance of the substituent borne by the nitrogen atom of
the amide function was investigated and the best inhibitory
capacities were obtained when the substituent was the (1,3-ben-
zodioxolyl)ethyl group. Docking studies revealed no interaction
with Ser241, suggesting a different binding mode compared to
URB597 or OL-135.
In this series, compound 39 inhibits FAAH with an IC50value of
0.088 lM, without affecting MAGL activity, and efficiently reduces
the inflammation and colon damage in a model of TNBS-induced
colitis in mice, showing evidence that FAAH inhibitors are promis-
ing target for the Inflammatory Bowel Diseases (IBD) treatment.
4. Experimental
4.1. Chemistry
All commercial reagents and solvents were used without further
purification. Analytical thin-layer chromatography was performed
on precoated Kieselgel 60F254 plates (Merck); the spots were lo-
cated by UV (254 and 366 nM) and/or with iodine. Silica gel 60
230–400 meshpurchasedfromMerckwasusedforcolumnchroma-
tography. Preparative thick-layer chromatography (TLC) was per-
formed using silica gel from Merck, the compounds were extracted
fromthesilicausingcyclohexane/AcOEt(7:3,v/v).Allmeltingpoints
were determined with a Büchi 535 capillary apparatus and remain
uncorrected.1H NMR spectra were obtained using a Brücker 300
MHz spectrometer, chemical shift (d) were expressed in ppm rela-
tive to tetramethylsilane used as an internal standard, J values are
inhertz.AllcompoundswereanalyzedbyHPLC–MSonaHPLCcom-
bined with a Surveyor MSQ (Thermo Electron) equipped with an
APCI-source.Alltestedcompoundsshowedapurityof>96%inAPCI+
mode. Elementalanalysesfor target compoundswere performedby
the ‘Service Central d’Analyses’ at the CNRS, Vernaison (France) and
the data were within ±0.4% of the theoretical values.
4.1.1. General procedure for the preparation of 1-(biphenyl-2-
yl)ethanone (1) and 1-(biphenyl-3-yl)ethanone (2)
20- or 30-Bromoacetophenone (10.05 mmol, 1 equiv) and phen-
ylboronic acid (12.04 mmol, 1.2 equiv) were dissolved in a mixture
of DME (30 mL) and H2O (30 mL). Then, K2CO3 (15.08 mmol,
1.5 equiv) and tetrakistriphenylphosphinepalladium (0.05 mol,
0.005 equiv) were added and the mixture was refluxed for 48 h.
After cooling to room temperature, the suspension was filtered
off and the filtrate was extracted with CH2Cl2. The resulting organic
layer was dried over MgSO4and concentrated under reduced pres-
sure. The resulting residue was purified by silica gel column chro-
matography (cyclohexane/AcOEt, 6:4) to afford the corresponding
derivatives 1 and 2.
4.1.1.1. 1-(Biphen-2-yl)ethanone (1).
NMR (DMSO-d6) d 7.60–7.28 (m, 9H), 2.09 (s, 3H). LC/MS (APCI+)
m/z 197.3 (MH+).
Brown oil (31%);
1H
4.1.1.2. 1-(Biphen-3-yl)ethanone (2).
NMR (DMSO-d6) d 8.15 (s, 1H), 7.92–7.36 (m, 8H), 2.61 (s, 3H).
LC/MS (APCI+) m/z 197.3 (MH+).
Yellow oil (17%);
1H
4.1.2. General procedure for the preparation of ethyl 2-hydroxy-
4-oxo-4-aryl-but-2-enoate (3–11)
To a stirred solution of sodium ethanolate freshly prepared from
Na (66.04 mmol, 2 equiv) in 50 mL of absolute EtOH, were added
dropwise, at 50 ?C, the aryl ketone (33.02 mmol, 1 equiv) and the
diethyl oxalate (66.04 mmol, 2 equiv) diluted in 30 mL of absolute
ethyl alcohol. The mixture was refluxed for 2 h. The solvent was
evaporated and the obtained residue was taken up in an aqueous
solution of hydrochloric acid (1N) and stirred for 1 h. Then, it
was extracted with AcOEt and washed with distilled water. The or-
ganic layer was dried over MgSO4and the solvent removed. Finally,
the residue was triturated in cyclohexane to give compounds 3–11.
4.1.2.1.
(3).
8.02 (d, 2H, J = 7.7 Hz), 7.67 (t, 1H, J = 7.9 Hz), 7.54 (t, 2H,
J = 7.8 Hz), 7.08 (s, 1H), 3.98 (q, 2H, J = 6.4 Hz), 1.12 (t, 3H,
J = 6.4 Hz). LC/MS (APCI+) m/z 221.2 (MH+).
Ethyl2-hydroxy-4-oxo-4-phenyl-2-butenoate
Orange oil (75%);
1H NMR (DMSO-d6) d 10.68 (s, 1H),
3782
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786

Page 7

4.1.2.2. Ethyl 4-(4-bromophenyl)-2-hydroxy-4-oxo-2-butenoate
(4).
White solid (74%); mp 65–66 ?C;1H NMR (DMSO-d6) d
10.68 (s, 1H), 8.07–7.88 (m, 4H), 6.99 (s, 1H), 4.42 (q, 2H,
J = 7.2 Hz), 1.47 (t, 3H, J = 7.2 Hz). LC/MS (APCI+) m/z 299.1 (MH)
and 301.2 (MH2+).
4.1.2.3.
(5).
d 10.68 (s, 1H), 8.10 (d, 2H, J = 8.8 Hz), 7.76 (d, 2H, J = 8.8 Hz),
7.70–7.64 (m, 2H), 7.55 (m, 3H), 7.15 (s, 1H), 4.46 (q, 2H,
J = 7.2 Hz), 1.47 (t, 3H, J = 7.2 Hz). LC/MS (APCI+) m/z 297.3 (MH+).
Ethyl
Yellow solid (78%); mp 111–112 ?C;1H NMR (DMSO-d6)
4-biphen-4-yl-2-hydroxy-4-oxo-but-2-enoate
4.1.2.4.
(6).
d 10.68 (s, 1H), 8.77 (d, 1H, J = 8.8 Hz), 8.74–8.70 (m, 1H), 8.55 (s,
1H), 8.22 (dd, 1H, J = 8.8 Hz, J =1.8 Hz), 7.97–7.93 (m, 1H), 7.84
(m, 2H), 7.77–7.67 (m, 2H), 7.27 (s, 1H), 4.46 (q, 2H, J = 7.2 Hz),
1.47 (t, 3H, J = 7.2 Hz). LC/MS (APCI+) m/z 321.4 (MH+).
Ethyl
Yellow solid (85%); mp 116–117 ?C;1H NMR (DMSO-d6)
2-hydroxy-4-oxo-4-phenantr-2-yl-but-2-enoate
4.1.2.5.
(7).
10.68 (s, 1H), 8.57 (s, 1H), 8.07–7.88 (m, 4H), 7.68–7.55 (m, 2H),
7.25 (s, 1H), 4.42 (q, 2H, J = 7.2 Hz), 1.47 (t, 3H, J = 7.2 Hz). LC/MS
(APCI+) m/z 271.3 (MH+).
Ethyl
Yellow solid (74%); mp 79–80 ?C;1H NMR (DMSO-d6) d
2-hydroxy-4-napht-2-yl-4-oxo-but-2-enoate
4.1.2.6.
(8).
10.68 (s, 1H), 7.97 (d, 2H, J = 8.2 Hz), 7.38 (d, 2H, J = 8.2 Hz),7.09
(s, 1H), 4.30 (q, 2H, J = 7.1 Hz), 2.37 (s, 1H), 1.31 (t, 3H,
J = 7.0 Hz). LC/MS (APCI+) m/z 235.3 (MH+).
Ethyl 2-hydroxy-4-oxo-4-p-tolyl-but-2-enoate
Orange solid (57%); mp 47–48 ?C;1H NMR (DMSO-d6) d
4.1.2.7.
but-2-enoate (9).
(DMSO-d6) d 10.68 (s, 1H), 8.02 (d, 2H, J = 8.2 Hz), 7.64 (d, 2H,
J = 8.2 Hz), 6.98 (s, 1H), 4.30 (q, 2H, J = 7.3 Hz), 1.30 (t, 3H,
J = 7.3 Hz). LC/MS (APCI+) m/z 289.2 (MH+).
Ethyl2-hydroxy-4-oxo-4-(4-trifluoromethyl-phenyl)-
Yellow solid (99%); mp 50–51 ?C;1H NMR
4.1.2.8.
(10).
10.68 (s, 1H), 7.74–7.31 (m, 10H), 4.35 (q, 2H, J = 7.2 Hz), 1.14 (t,
3H, J = 7.1 Hz). LC/MS (APCI+) m/z 297.3 (MH+).
Ethyl
Brown solid (37%); mp 63–64 ?C;1H NMR (DMSO-d6) d
4-biphen-2-yl-2-hydroxy-4-oxo-but-2-enoate
4.1.2.9.
(11).
10.68 (s, 1H), 8.08–6.73 (m, 10H), 4.29 (q, 2H, J = 7.0 Hz), 1.27
(m, 3H). LC/MS (APCI+) m/z 297.3 (MH+).
Ethyl
Brown solid (83%); mp 75–76 ?C;1H NMR (DMSO-d6) d
4-biphen-3-yl-2-hydroxy-4-oxo-but-2-enoate
4.1.3. General procedure for the preparation of ethyl 5-aryl-isox
azole-3-carboxylate (12–20)
A solution of compound 3–11 (1 equiv) and hydroxylamine
hydrochloride (1 equiv) in absolute EtOH was stirred and re-
fluxed for 2 h. At the end of the reaction, the solvent was re-
moved and the residue was purified by flash chromatography
cyclohexane/AcOEt (8:2, v/v) followed by crystallization in abso-
lute EtOH.
4.1.3.1. Ethyl 5-phenyl-isoxazole-3-carboxylate (12).
solid (82%); mp 59–60 ?C;1H NMR (DMSO-d6) d 7.52–7.48 (m, 5H),
7.13 (s, 1H), 4.29 (q, 2H, J = 7.3 Hz), 1.30 (t, 3H, J = 7.2 Hz). LC/MS
(APCI+) m/z 218.2 (MH+).
White
4.1.3.2.
(13).
d 7.93 (d, 2H, J = 8.5 Hz), 7.78 (d, 2H, J = 8.5 Hz), 7.58 (s, 1H), 4.39
(q, 2H, J = 7.1 Hz), 1.34 (t, 3H, J = 7.1 Hz). LC/MS (APCI+) m/z 296.1
(MH) and 298.2 (MH2+).
Ethyl
White solid (85%); mp 133–134 ?C;1H NMR (DMSO-d6)
5-(4-bromo-phenyl)-isoxazole-3-carboxylate
4.1.3.3.
(14).
d 8.30 (d, 2H, J = 8.5 Hz), 7.75 (d, 2H, J = 8.5 Hz), 7.48–7.46 (m,
3H), 7.25 (d, 2H, J = 8.5 Hz), 7.15 (s, 1H), 4.35 (q, 2H, J = 7.2 Hz),
1.32 (t, 3H, J = 7.2 Hz). LC/MS (APCI+) m/z 294.4 (MH+).
Ethyl5-biphen-4-yl-isoxazole-3-carboxylate
White solid (87%); mp 117–118 ?C;1H NMR (DMSO-d6)
4.1.3.4.
(15).
d6) d 8.75 (d, 2H, J = 6.4 Hz), 8.65 (s, 1H), 8.24 (d, 1H, J = 9.0 Hz),
8.13 (m, 2H), 8.00 (d, 1H, J = 8.7 Hz), 7.65 (s, 1H), 7.59–7.56 (m,
2H), 4.42 (q, 2H, J = 7.3 Hz), 1.37 (t, 3H, J = 7.0 Hz). LC/MS (APCI+)
m/z 318.4 (MH+).
Ethyl
Yellow solid (90%); mp 196–197 ?C;
5-phenanthren-2-yl-isoxazole-3-carboxylate
1H NMR (DMSO-
4.1.3.5.
(16).
d 8.60 (s, 1H), 8.11–8.06 (m, 3H), 8.03–7.98 (m, 1H), 7.64–7.62
(m, 2H), 7.61 (s, 1H), 4.41 (q, 2H, J = 7.0 Hz), 1.37 (t, 3H,
J = 7.1 Hz). LC/MS (APCI+) m/z 268.3 (MH+).
Ethyl5-napht-2-yl-isoxazole-3-carboxylate
White solid (92%); mp 107–108 ?C;1H NMR (DMSO-d6)
4.1.3.6. Ethyl 5-p-tolyl-isoxazole-3-carboxylate (17).
solid (86%); mp 59–60 ?C;
J = 8.2 Hz), 7.42 (s, 1H), 7.37 (d, 2H, J = 8.0 Hz), 4.38 (q, 2H,
J = 7.1 Hz), 2.37 (s, 3H), 1.34 (t, 3H, J = 7.1 Hz). LC/MS (APCI+) m/z
232.3 (MH+).
White
1H NMR (DMSO-d6) d 7.84 (d, 2H,
4.1.3.7. Ethyl 5-(4-trifluoromethyl-phenyl)-isoxazole-3-carbox-
ylate (18).
White solid (73%); mp 136–137 ?C;
(DMSO-d6) d 8.42 (d, 2H, J = 8.2 Hz), 8.36 (d, 2H, J = 8.2 Hz), 7.85
(s, 1H), 4.39 (q, 2H, J = 7.2 Hz), 1.38 (t, 3H, J = 7.2 Hz). LC/MS (APCI+)
m/z 286.2 (MH+).
1H NMR
4.1.3.8.
(19).
7.89 (d, 1H, J = 7.0 Hz), 7.55–7.51 (m, 2H), 7.49–7.40 (m, 4H),
7.30–7.25 (m, 2H), 5.90 (s, 1H), 4.38 (q, 2H, J = 7.3 Hz), 1.39 (t,
3H, J = 7.3 Hz). LC/MS (APCI+) m/z 294.4 (MH+).
Ethyl 5-biphen-2-yl-isoxazole-3-carboxylate
White solid (74%); mp 72–73 ?C;
1H NMR (CDCl3) d
4.1.3.9.
(20).
8.26 (s, 1H), 7.96–7.42 (m, 8H), 7.78 (s, 1H), 4.42 (q, 2H,
J = 7.3 Hz), 1.36 (t, 3H, J = 7.2 Hz). LC/MS (APCI+) m/z 294.4 (MH+).
Ethyl5-biphen-3-yl-isoxazole-3-carboxylate
White solid (60%); mp 75–76 ?C;1H NMR (DMSO-d6) d
4.1.4. General procedure for the preparation of 5-aryl-isoxazole-
3-carboxylic acid (21–29)
To a stirred solution of ester 12–20 (1 equiv) in EtOH (95%), was
added sodium hydroxide in pellets (10 equiv). The mixture was
then stirred at room temperature for 24 h. EtOH was removed un-
der reduced pressure and the residue was acidified (1N HCl, pH 2)
and extracted with EtOAc. The organic extracts were washed with
water and brine, dried over MgSO4and concentrated under re-
duced pressure to afford essentially pure carboxylic acid 21–29.
4.1.4.1. 5-Phenyl-isoxazole-3-carboxylic acid (21).
solid (79%); mp 163–164 ?C;1H NMR (DMSO-d6) d 12.79 (s, 1H),
7.96–7.93 (m, 2H), 7.59–7.53 (m, 3H), 7.41 (s, 1H). LC/MS (APCI+)
m/z 190.2 (MH+).
White
4.1.4.2.
(22).
d 12.81 (s, 1H), 7.89 (d, 2H, J = 8.1 Hz), 7.76 (d, 2H, J = 8.0 Hz),
7.48 (s, 1H). LC/MS (APCI+) m/z 268.1 (MH) and 270.2 (MH2+).
5-(4-Bromo-phenyl)-isoxazole-3-carboxylic
White solid (83%); mp 226–227 ?C;1H NMR (DMSO-d6)
acid
4.1.4.3.
(23).
d6) d 12.80 (s, 1H), 8.30 (d, 2H, J = 8.1 Hz), 7.75 (d, 2H, J = 8.5 Hz),
5-Biphen-4-yl-isoxazole-3-carboxylic
Yellow solid (61%); mp 212–213 ?C;
acid
1H NMR (DMSO-
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786
3783

Page 8

7.48–7.46 (m, 3H), 7.38 (s, 1H), 7.25 (d, 2H, J = 8.2 Hz). LC/MS
(APCI+) m/z 266.3 (MH+).
4.1.4.4.
(24).
d6) d 12.81 (s, 1H), 8.75 (d, 1H, J = 8.2 Hz), 8.66 (s, 1H), 8.23 (d,
2H, J = 8.3 Hz), 8.12 (m, 2H), 8.02 (m, 1H), 7.60–7.57 (m, 2H),
7.54 (s, 1H). LC/MS (APCI+) m/z 290.3 (MH+).
5-Phenanthr-2-yl-isoxazole-3-carboxylic
Yellow solid (84%); mp 220–221 ?C;
acid
1H NMR (DMSO-
4.1.4.5.
(25).
d 12.79 (s, 1H), 8.57 (s, 1H), 8.09–7.97 (m, 4H), 7.63–7.58 (m,
2H), 7.53 (s, 1H). LC/MS (APCI+) m/z 240.2 (MH+).
5-Napht-2-yl-isoxazole-3-carboxylic
White solid (84%); mp 208–209 ?C;1H NMR (DMSO-d6)
acid
4.1.4.6. 5-p-Tolyl-isoxazole-3-carboxylic acid (26).
lid (91%); mp 165–166 ?C;1H NMR (DMSO-d6) d 12.81 (s, 1H), 7.82
(d, 2H, J = 8.2 Hz), 7.35 (d, 2H, J = 8.2 Hz), 7.31 (s, 1H), 2.36 (s, 1H).
LC/MS (APCI+) m/z 204.2 (MH+).
Beige so-
4.1.4.7.
acid (27).
(DMSO-d6) d 12.80 (s, 1H), 8.17 (d, 2H, J = 7.9 Hz), 7.93 (d, 2H,
J = 7.9 Hz), 7.62 (s, 1H). LC/MS (APCI+) m/z 258.2 (MH+).
5-(4-Trifluoromethyl-phenyl)-isoxazole-3-carboxylic
White solid (87%); mp 201–202 ?C;
1H NMR
4.1.4.8.
(28).
d 12.79 (s, 1H), 7.82 (d, 2H, J = 6.1 Hz), 7.60–7.40 (m, 5H), 7.24
(m, 2H), 6.27 (s, 1H). LC/MS (APCI+) m/z 266.3 (MH+).
5-Biphen-2-yl-isoxazole-3-carboxylic
White solid (88%); mp 110–111 ?C;1H NMR (DMSO-d6)
acid
4.1.4.9.
(29).
d 12.79 (s, 1H), 8.23 (s, 1H), 7.93 (d, 1H, J = 7.9 Hz), 7.84–7.41 (m,
7H), 7.61 (s, 1H). LC/MS (APCI+) m/z 266.3 (MH+).
5-Biphen-3-yl-isoxazole-3-carboxylic
White solid (75%); mp 180–181 ?C;1H NMR (DMSO-d6)
acid
4.1.5. General procedure for the preparation of 5-aryl-isoxazole-
3-carboxamide (30–48)
To a solution of carboxylic acid 21–29 (1 equiv) in anhydrous
CH2Cl2
weresuccessivelyadded
(0.5 equiv) and DIPEA (2 equiv). The mixture was stirred for
45 min at room temperature. Then, the appropriate amine
(1.1 equiv) was introduced and the stirring was continued for
24 h. At the end of the reaction, the mixture was filtered off
and the filtrate was successively washed with saturated aqueous
NaHCO3 solution, 1N aqueous HCl and distilled water. The or-
ganic layer was dried over MgSO4and was concentrated in va-
cuo. The resulting residue was purified by TLC (cyclohexane/
AcOEt, 7:3) and crystallized in absolute EtOH to give carboxam-
ide 30–48.
HBTU(1.5 equiv),HOBt
4.1.5.1.
(30).
d 8.85 (t, 1H, J = 5.5 Hz), 7.93 (d, 2H, J = 8.2 Hz), 7.91–7.53 (m,
3H), 7.31 (s, 1H), 7.28–7.14 (m, 5H), 3.29 (t, 2H, J = 5.8 Hz), 2.62
(t, 2H, J = 7.6 Hz), 1.83 (m, 2H). LC/MS (APCI+) m/z 307.2 (MH+);
Anal. Calcd for C19H18N2O2: C, 74.49; H, 5.92; N, 9.14. Found: C,
74.22; H, 5.87; N, 9.35.
5-Phenyl-N-(3-phenylpropyl)isoxazole-3-carboxamide
White solid (67%); mp 127–128 ?C;1H NMR (DMSO-d6)
4.1.5.2. 5-(4-Bromophenyl)-N-(3-phenylpropyl)isoxazole-3-car-
boxamide (31).
White solid (63%); mp 171–172 ?C;1H NMR
(DMSO-d6) d 10.93 (t, 1H, J = 5.7 Hz), 9.94 (d, 2H, J = 8.7 Hz), 9.82 (d,
2H,
J = 8.7 Hz), 9.47 (s, 1H), 9.36–9.20 (m, 5H), 5.34 (t, 2H,
J = 5.7 Hz), 4.58 (t, 2H, J = 7.6 Hz), 3.89 (m, 2H). LC/MS (APCI+) m/
z 385.1 (MH) and 387.3 (MH2+); Anal. Calcd for C19H17BrN2O2: C,
59.24; H, 4.45; N, 7.27. Found: C, 59.36; H, 4.33; N, 7.18.
4.1.5.3. 5-(Biphen-4-yl)-N-(3-phenylpropyl)isoxazole-3-carbox-
amide (32).
White solid (52%); mp 142–143 ?C;
(DMSO-d6) d 8.56 (ls, 1H), 8.30 (d, 2H, J = 8.7 Hz), 7.75 (d, 2H,
J = 8.5 Hz), 7.48–7.46 (m, 3H), 7.36 (s, 1H), 7.25 (d, 2H, J = 8.7 Hz),
7.20–7.17 (m, 5H), 3.18 (q, 2H, J = 5.5 Hz), 2.94 (t, 2H, J = 7.2 Hz),
2.10 (m, 2H). LC/MS (APCI+) m/z 383.3 (MH+); Anal. Calcd for
C25H22N2O2: C, 78.51; H, 5.80; N, 7.32. Found: C, 78.44; H, 5.66;
N, 7.45.
1H NMR
4.1.5.4. 5-(Phenanthr-2-yl)-N-(3-phenylpropyl)isoxazole-5-car-
boxamide (33).
Yellow solid (72%); mp 186–187 ?C;
NMR(DMSO-d6)
d
8.91 (t,
J = 7.9 Hz), 8.65 (s, 1H), 8.24 (d, 1H, J = 9.0 Hz), 8.14–8.11 (m,
2H), 7.99 (d, 1H, J = 8.7 Hz), 7.59–7.56 (m, 2H), 7.51 (s, 1H),
7.31–7.15 (m, 5H), 3.31(q,
J = 7.7 Hz), 1.86 (m, 2H). LC/MS (APCI+) m/z 407.2 (MH+); Anal.
Calcd for C27H22N2O2: C, 79.78; H, 5.46; N, 6.89. Found: C,
79.99; H, 5.47; N, 6.85.
1H
2H, 1H,
J = 5.7 Hz),8.74 (d,
2H,
J = 5.5 Hz),2.64 (t,2H,
4.1.5.5.
amide (34).
(DMSO-d6) d 8.89 (t, 1H, J = 5.5 Hz), 8.56 (s, 1H), 8.08 (d, 2H,
J = 7.9 Hz), 8.02–7.98 (m, 2H), 7.63–7.61 (m, 2H), 7.46 (s, 1H),
7.29–7.18 (m, 5H), 3.31 (q, 2H, J = 5.5 Hz), 2.63 (t, 2H, J = 7.6 Hz),
1.85 (m, 2H). LC/MS (APCI+) m/z 357.3 (MH+); Anal. Calcd for
C23H20N2O2: C, 77.51; H, 5.66; N, 7.86. Found: C, 77.44; H, 5.60;
N, 7.99.
5-(Napht-2-yl)-N-(3-phenypropyl)isoxazole-3-carbox-
White solid (47%); mp 160–161 ?C;
1H NMR
4.1.5.6.
(35).
d 8.83 (t, 1H, J = 5.7 Hz), 7.81 (d, 2H, J = 8.2 Hz), 7.35 (d, 2H,
J = 8.2 Hz), 7.31–7.17 (m, 6H), 3.27 (q, 2H, J = 6.9 Hz), 2.62 (t, 2H,
J = 7.7 Hz), 2.37 (s, 3H), 1.83 (m, 2H). LC/MS (APCI+) m/z 312.2
(MH+); Anal. Calcd for C20H20N2O2: C, 74.98; H, 6.29; N, 8.74.
Found: C, 75.11; H, 5.95 N, 8.69.
5-p-Tolyl-N-(3-phenylpropyl)isoxazole-3-carboxamide
White solid (80%); mp 150–151 ?C;1H NMR (DMSO-d6)
4.1.5.7. 5-(4-(Trifluoromethyl)phenyl)-N-(3-phenylpropyl) isox-
azole-3-carboxamide (36).
157 ?C;1H NMR (DMSO-d6) d 8.93 (t, 1H, J = 5.7 Hz), 8.15 (d, 2H,
J = 8.2 Hz), 7.93 (d, 2H, J = 8.3 Hz), 7.56 (s, 1H), 7.31–7.15 (m, 5H),
3.28 (q, 2H, J = 6.9 Hz), 2.62 (t, 2H, J = 7.6 Hz), 1.83 (m, 2H). LC/
MS (APCI+) m/z 375.4 (MH+); Anal. Calcd for C20H17F3N2O2: C,
64.17; H, 4.58; N, 7.48. Found: C, 64.22; H, 4.71; N, 7.22.
White solid (55%); mp 156–
4.1.5.8. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-phenyl-isoxaz-
ole-3-carboxamide (37).
White
192 ?C;1H NMR (DMSO-d6) d 8.56 (t, 1H, J = 5.5 Hz), 7.91 (d, 2H,
J = 8.2 Hz), 7.85–7.74 (m, 3H), 7.56 (s, 1H), 6.93 (d, 1H, J = 8.5 Hz),
6.77 (s, 1H), 6.67 (d, 1H, J = 8.5 Hz), 6.06 (s, 2H), 3.45 (q, 2H,
J = 6.9 Hz), 2.81 (t, 2H, J = 7.1 Hz). LC/MS (APCI+) m/z 337.2
(MH+); Anal. Calcd for C19H16N2O4: C, 67.85; H, 4.79; N, 8.33.
Found: C, 67.77; H, 5.00 N, 8.39.
solid (65%);mp 191–
4.1.5.9. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(4-bromophe-
nyl)-isoxazole-3-carboxamide (38).
205–206 ?C;1H NMR (DMSO-d6) d 8.83 (t, 1H, J = 5.5 Hz), 7.87 (d,
2H, J = 8.7 Hz), 7.75 (d, 2H, J = 8.5 Hz), 7.39 (s, 1H), 6.82–6.81 (m,
2H), 6.68 (d, 1H, J = 7.9 Hz), 5.96 (s, 2H), 3.45 (q, 2H, J = 6.8 Hz),
2.81 (t, 2H, J = 7.3 Hz). LC/MS (APCI+) m/z 415.2 (MH) and 417.3
(MH2+); Anal. Calcd for C19H15BrN2O4: C, 54.96; H, 3.64; N, 6.75.
Found: C, 55.01; H, 3.68 N, 6.82.
White solid (68%); mp
4.1.5.10. N-(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(biphen-4-yl)-
isoxazole-3-carboxamide (39).
200 ?C; H NMR (DMSO-d6) d 8.84 (t, 1H, J = 5.5 Hz), 8.02 (d, 2H,
J = 8.5 Hz), 7.85 (d, 2H, J = 8.5 Hz), 7.75 (d, 2H, J = 7.3 Hz), 7.51 (t,
White solid (72%); mp 199–
3784
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786

Page 9

2H, J = 7.4 Hz), 7.41 (t, 1H, J = 7.7 Hz), 7.38 (s,1H), 6.83–6.81(m,2H),
6.69(d,1H,J = 7.9 Hz),5.96(s,2H),3.46(q,2H,J = 6.4 Hz),2.77(t,2H,
J = 7.3 Hz). LC/MS (APCI+) m/z 413.1 (MH+); Anal. Calcd for
C25H20N2O4:C,72.80;H,4.89;N,6.79.Found:C,72.97;H,4.77N,6.52.
4.1.5.11. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(napht-2-yl)-
isoxazole-3-carboxamide (40).
205 ?C;1H NMR (DMSO-d6) d 8.88 (t, 1H, J = 5.7 Hz), 8.56 (s, 1H),
8.08 (d, 2H, J = 7.6 Hz), 8.02–7.98 (m, 2H), 7.63–7.60 (m, 2H),
7.45 (s, 1H), 6.85–6.83 (m, 2H), 6.69 (d, 1H, J = 7.7 Hz), 5.96 (s,
2H), 3.47 (q, 2H, J = 6.7 Hz), 2.79 (t, 2H, J = 7.3 Hz). LC/MS (APCI+)
m/z 387.2 (MH+); Anal. Calcd for C23H18N2O4: C, 71.49; H, 4.70;
N, 7.25. Found: C, 71.22; H, 4.81 N, 7.53.
White solid (31%); mp 204–
4.1.5.12. N-(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-p-tolyl-isoxaz-
ole-3-carboxamide (41).
White solid (45%); mp 187–188 ?C;
1H NMR (DMSO-d6) d 8.79 (t, 1H, J = 5.4 Hz), 7.80 (d, 2H, J = 8.2 Hz),
7.35 (d, 2H, J = 8.2 Hz), 7.25 (s, 1H), 6.83–6.81 (m, 2H), 6.67 (d, 1H,
J = 7.9 Hz), 5.96 (s, 2H), 3.44 (q, 2H, J = 6.5 Hz), 2.76 (t, 2H,
J = 7.3 Hz), 2.37 (s, 3H). LC/MS (APCI+) m/z 351.4 (MH+); Anal. Calcd
for C20H18N2O4: C, 68.56; H, 5.18; N, 8.00. Found: C, 68.72; H, 5.02
N, 7.88.
4.1.5.13. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(4-(trifluoro-
methyl)phenyl)-isoxazole-3-carboxamide (42).
(38%); mp 187–188 ?C;
J = 5.8 Hz), 8.15 (d, 2H, J = 8.2 Hz), 7.92 (d, 2H, J = 8.2 Hz), 7.54 (s,
1H), 6.81 (m, 2H), 6.68 (d, 1H, J = 8.2 Hz), 5.96 (s, 2H), 3.45 (q,
2H, J = 6.7 Hz), 2.77 (t, 2H, J = 7.3 Hz). LC/MS (APCI+) m/z 405.3
(MH+); Anal. Calcd for C20H15F3N2O4: C, 59.41; H, 3.74; N, 6.93.
Found: C, 59.28; H, 3.88 N, 7.03.
White solid
1H NMR (DMSO-d6) d 8.89 (t, 1H,
4.1.5.14. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(biphen-2-yl)-
isoxazole-3-carboxamide (43).
138 ?C;1H NMR (DMSO-d6) d 8.44 (t, 1H, J = 7.2 Hz), 7.79 (m, 2H),
7.54–7.28 (m, 8H), 6.93–6.77 (m, 3H), 6.07 (s, 2H), 3.49 (q, 2H,
J = 6.4 Hz), 2.81 (t, 2H, J = 7.2 Hz). LC/MS (APCI+) m/z 413.1
(MH+); Anal. Calcd for C25H20N2O4: C, 72.80; H, 4.89; N, 6.79.
Found: C, 72.66; H, 4.95 N, 6.55.
White solid (18%); mp 137–
4.1.5.15. N -(2-(Benzo[d][1,3]dioxol-5-yl)ethyl)-5-(biphen-3-yl)-
isoxazole-3-carboxamide (44).
150 ?C;1H NMR (DMSO-d6) d 8.76 (t, 1H, J = 7.2 Hz), 8.21 (s, 1H),
7.93–7.39 (m, 9H), 6.82 (s, 1H), 6.72–6.69 (m, 2H), 5.96 (s, 2H),
3.46 (q, 2H, J = 6.4 Hz), 2.77 (t, 2H, J = 7.3 Hz). LC/MS (APCI+) m/z
413.1 (MH+); Anal. Calcd for C25H20N2O4: C, 72.80; H, 4.89; N,
6.79. Found: C, 72.92; H, 5.01 N, 6.48.
White solid (64%); mp 149–
4.1.5.16. 5-(Biphen-4-yl)-N-(3-benzyl)isoxazole-3-carboxamide
(45).
White solid (31%); mp 195–196 ?C;1H NMR (DMSO-d6)
d 9.40 (t, 1H, J = 6.1 Hz), 8.02 (d, 2H, J = 8.4 Hz), 7.85 (d, 2H,
J = 8.2 Hz), 7.75 (d, 2H, J = 7.2 Hz), 7.52–7.23 (m, 9H), 4.47 (d, 2H,
J = 6.4 Hz). LC/MS (APCI+) m/z 355.4 (MH+); Anal. Calcd for
C23H18N2O2: C, 77.95; H, 5.12; N, 7.90. Found: C, 77.78; H, 5.34
N, 7.72.
4.1.5.17.
amide (46).
(DMSO-d6) d 8.89 (t, 1H, J = 5.8 Hz), 8.00 (d, 2H, J = 8.2 Hz), 7.85
(d, 2H, J = 8.5 Hz), 7.75 (d, 2H, J = 7.3 Hz), 7.53–7.20 (m, 9H), 3.50
(q, 2H, J = 6.7 Hz), 2.86 (t, 2H, J = 7.57 Hz). LC/MS (APCI+) m/z
369.4 (MH+); Anal. Calcd for C24H20N2O2: C, 78.24; H, 5.47; N,
7.60. Found: C, 78.51; H, 5.72 N, 7.59.
5-(Biphen-4-yl)-N-(3-phenethyl)isoxazole-3-carbox-
White solid (26%); mp 210–211 ?C;
1H NMR
4.1.5.18. N-(Benzo[d][1,3]dioxol-5-yl)-5-(biphen-4-yl)isoxazole-
3-carboxamide (47).
White solid (24%); mp 215–216 ?C;1H
NMR (DMSO-d6) d 10.70 (s, 1H), 8.05 (d, 2H, J = 8.4 Hz), 7.85 (d,
2H, J = 8.2 Hz), 7.76 (d, 2H, J = 7.0 Hz), 7.53–7.48 (m, 4H), 6.92–
6.81 (m, 3H), 6.02 (s, 2H). LC/MS (APCI+) m/z 385.4 (MH+); Anal.
Calcd for C23H16N2O4: C, 71.87; H, 4.20; N, 7.29. Found: C, 71.59;
H, 4.44 N, 7.17.
4.1.5.19. N -(2-(Benzo[d][1,3]dioxol-5-yl)methyl)-5-(biphen-4-
yl)-isoxazole-3-carboxamide (48).
197–198 ?C;1H NMR (DMSO-d6) d 9.34 (t, 1H, J = 6.1 Hz), 8.02 (d,
2H, J = 8.4 Hz), 7.85 (d, 2H, J = 8.2 Hz), 7.75 (d, 2H, J = 7.3 Hz),
7.52–7.39 (m, 4H), 6.91–6.80 (m, 3H), 5.98 (s, 2H), 4.35 (d, 2H,
J = 6.1 Hz). LC/MS (APCI+) m/z 399.4 (MH+); Anal. Calcd for
C24H18N2O4: C, 72.35; H, 4.55; N, 7.03. Found: C, 72.21; H, 4.58
N, 7.11.
White solid (17%); mp
4.2. In vitro assays towards human FAAH and MAGL
Tubes containing human recombinant FAAH (expressed in E.
Coli) in buffer (100 mM Tris–HCl, 1 mM EDTA, 0.1% (w/v) BSA, pH
7.4, 165 lL), test compounds in DMSO, or DMSO alone for controls
(10 lL), and [3H]-AEA (50 000 dpm, 2 lM final concentration,
25 lL) were incubated at 37 ?C for 10 min. Reactions were stopped
by rapidly adding 400 lL of ice-cold chloroform/methanol (1:1 v/v)
followed by vigorous mixing. Phases were separated by centrifuga-
tion at 850?g, and aliquots (200 lL) of the upper methanol/buffer
phase were counted for radioactivity by liquid scintillation. In all
experiments, tubes containing buffer only were used as control
for chemical hydrolysis (blank) and this value was systematically
subtracted. Using these conditions, the well known FAAH inhibitor
URB597 inhibits hFAAH with an IC50value of 40 nM. MAGL inhibi-
tion was assayed using a similar protocol but with purified hMAGL
and[3H]-2-OG(10 lM)instead
respectively.20
ofFAAHand[3H]-AEA,
4.3. In vivo Assays
C57Bl6 mice (n = 10 per group) had free access to standard
mouse chow and tap water. For colitis induction, mice were
anesthetized by subcutaneous administration of xylazine–keta-
mine (50 mg/kg) in saline for 90–120 min and received an intra-
rectal administration of TNBS (40 lL, 150 mg/kg) dissolved in a
1:1 mixture of 0.9% NaCl with 100% ethanol. Control mice
(n = 6) received a 1:1 mixture of 0.9% NaCl with 100% ethanol
using the same technique. 5-ASA granules mixed in food at the
dosage of 150 mg/kg and provided ad libitum during all the
course of the experiment was used as anti-inflammatory positive
control. The FAAH inhibitor 39 was dissolved in vehicle (DMSO
2%, Tween 80 1% in saline) and administered intraperitoneally
once daily, starting three days before colitis induction at the dos-
age of 10 mg/kg. Animals were euthanized three days after TNBS
administration. Body-weight changes, macroscopic and histolog-
ical indications of colitis were evaluated blindly by two investi-
gators. The colon of each mouse was examined to evaluate the
macroscopic lesions according to the Wallace criteria.23The Wal-
lace score rates macroscopic lesions on a scale from 0 to 10
based on features reflecting inflammation, such as hyperemia,
thickening of the bowel, and extent of ulceration. A colon spec-
imen located precisely 2 cm above the anal canal was used for
histological evaluation following May–Grunwald Giemsa staining
and according to the Ameho criteria.24This grading on a scale
from 0 to 6 takes into account the degree of inflammation infil-
trate, the presence of erosion, ulceration, or necrosis, and the
depth and surface extension of lesions. The other parts of the co-
lon were frozen and used to quantify cytokines mRNA levels.
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786
3785

Page 10

4.4. Quantification of colonic cytokines levels by real-time PCR
Total RNA from colon was extracted using Nucleospin RNAII
(Macherey Nagel, Hoerdt, France) and then reverse transcribed
using the high-Capacity cDNA Reverse Transcription Kit (Applied
Biosystems, Foster City, USA). Real time PCR was performed using
SYBR Green (Applied Biosystems, Foster City, USA). Specific prim-
ers for TNF (TNFa_F_Sou_MBM; CCACCACGCTCTTCTGTCTA and
TNFa_R_Sou_MBM; GAGGCCATTTGGGAACTTCT), IL-1b (IL1b_F_-
sou_MBM; AGCTCTCCACCTCAATGGAC
AGGCCACAGGTATTTTGTCG) and b-Actin acting as internal control
were designed using the Primer Express Program (Applied Biosys-
tems, Foster City, USA). For graphical representation of quantitative
PCR data, raw cycle threshold values (Ct values) obtained for target
samples were deducted from the Ct value obtained for internal
control transcript levels, using the DDCt method as follows:
DDCt = (Ct,target-Ct,control)treatment-(Ct,target-Ct,control)non-
treatment, and the final data were derived from 2-DDCt.
and IL1b_R_Sou_MBM;
Acknowledgments
The authors thank Ms. Perrine Six for the NMR and LC–MS anal-
ysis, as well as Dr. Geoffray Labar for the preparation of the human
recombinant enzymes. This work was financially supported by the
‘Conseil Régional Nord Pas de Calais’.
References and notes
1. Vandevoorde, S.; Lambert, D. M. Chem. Biodivers. 2007, 4, 1858.
2. Ahn, K.; McKinney, M. K.; Cravatt, B. F. Chem. Rev. 2008, 108, 1687.
3. Dinh, T. P.; Freund, T. F.; Piomelli, D. A. Chem. Phys. Lipids 2002, 121, 149.
4. Muccioli, G. G. Drug Discovery Today 2010, 15, 474.
5. Izzo, A. A.; Sharkey, K. A. Pharmacol. Ther. 2010, 126, 21.
6. D’Argenio, G.; Valenti, M.; Scaglione, G.; Cosenza, V.; Sorrentini, I.; Di Marzo, V.
FASEB J. 2006, 20, 568.
7. Wright, K.; Rooney, N.; Feeney, M.; Tate, J.; Robertson, D.; Welham, M.; Ward, S.
Gastroenterology 2005, 129, 437.
8. Marquéz, L.; Suárez, J.; Iglesias, M.; Bermudez-Silva, F. J.; Rodríguez de Fonseca,
F.; Andreu, M. PLoS ONE 2009, 4, e6893.
9. Di Marzo, V.; Izzo, A. Gut 2006, 55, 1373.
10. Storr, M. A.; Keenan, C. M.; Zhang, H.; Patel, K. D.; Makriyannis, A.; Sharkey, K.
A. Inflamm. Bowel. Dis. 2009, 15, 1678.
11. Storr, M. A.; Keenan, C. M.; Emmerdinger, D.; Zhang, H.; Yüce, B.; Sibaev, A.;
Massa, F.; Buckley, N. E.; Lutz, B.; Göke, B.; Brand, S.; Patel, K. D.; Sharkey, K. A.
J. Mol. Med. 2008, 86, 925.
12. Massa, F.; Marsicano, G.; Hermann, H.; Cannich, A.; Monory, K.; Cravatt, B. F.;
Ferri, G. L.; Sibaev, A.; Storr, M.; Lutz, B. J. Clin. Invest. 2004, 113, 1202.
13. Cravatt, B. F.; Lichtman, A. H. Curr. Opin. Chem. Biol. 2003, 7, 469.
14. Garfunkle, J.; Ezzili, C.; Rayl, T. J.; Hochstatter, D. G.; Hwang, I.; Boger, D. L. J.
Med. Chem. 2008, 51, 4392.
15. Mor, M.; Lodola, A.; Rivara, S.; Vacondio, F.; Duranti, A.; Tontini, A.; Sanchini, S.;
Piersanti, G.; Clapper, J. R.; King, A. R.; Tarzia, G.; Piomelli, D. J. Med. Chem.
2008, 51, 3487.
16. Ahn, K.; Johnson, D. S.; Fitzgerald, L. R.; Liimatta, M.; Arendse, A.; Stevenson, T.;
Lund, E. T.; Nugent, R. A.; Nomanbhoy, T. K.; Alexander, J. P.; Cravatt, B. F.
Biochemistry 2007, 46, 13019.
17. Seierstad, M.; Breitenbucher, J. G. J. Med. Chem. 2008, 51, 7327.
18. Andrzejak, V.; Millet, R.; El Bakali, J.; Guelzim, A.; Gluszok, S.; Chavatte, P.;
Bonte, J. P.; Vaccher, C.; Lipka, E. Lett. Org. Chem. 2010, 7, 32.
19. Labar, G.; Vliet, F. V.; Wouters, J.; Lambert, D. M. Amino Acids 2008, 34, 127.
20. Muccioli, G. G.; Labar, G.; Lambert, D. M. Chem. Biol. Chem. 2008, 9, 2704.
21. Muccioli, G. G.; Fazio, N.; Scriba, G. K.; Poppitz, W.; Cannata, F.; Poupaert, J. H.;
Wouters, J.; Lambert, D. M. J. Med. Chem. 2006, 49, 417.
22. Ritland, S. R.; Leighton, J. A.; Hirsch, R. E.; Morrow, J. D.; Weaver, A. L.; Gendler,
S. Clin. Cancer Res. 1999, 5, 855.
23. Wallace, J. L.; MacNaughton, W. K.; Morris, G. P.; Beck, P. L. Gastroenterology
1989, 96, 29.
24. Ameho, C. K.; Adjei, A. A.; Harrison, E. K.; Takeshita, K.; Morioka, T.; Arakaki, Y.;
Ito, E.; Suzuki, I.; Kulkarni, A. D.; Kawajiri, A.; Yamamoto, S. Gut 1997, 41, 487.
25. Mileni, M.; Garfunkle, J.; DeMartino, J. K.; Cravatt, B. F.; Boger, D. L.; Stevens, R.
C. J. Am. Chem. Soc. 2009, 5, 10497.
26. Jones, G.; Willett, P.; Glen, R. C.; Leach, A. R.; Taylor, R. J. Mol. Biol. 1997, 267,
727.
27. Katritch, V.; Byrd, C. M.; Tseitin, V.; Dai, D.; Raush, E.; Totrov, M.; Abagyan, R.;
Jordan, R.; Hruby, D. E. J. Comput.-Aided Mol. Des. 2007, 21, 549.
28. Tripos Associates, Inc., 1699 South Hanley Road, St. Louis, MO 63144.
3786
V. Andrzejak et al./Bioorg. Med. Chem. 19 (2011) 3777–3786