Both high and low maternal salt intake in pregnancy alter kidney development in the offspring.

Abstract

In humans, low glomerular numbers are related to hypertension, cardiovascular, and renal disease in adult life. The present study was designed 1) to explore whether above- or below-normal dietary salt intake during pregnancy influences nephron number and blood pressure in the offspring and 2) to identify potential mechanisms in kidney development modified by maternal sodium intake. Sprague-Dawley rats were fed low (0.07%)-, intermediate (0.51%)-, or high (3.0%)-sodium diets during pregnancy and lactation. The offspring were weaned at 4 wk and subsequently kept on a 0.51% sodium diet. The kidney structure was assessed at postnatal weeks 1 and 12 and the expression of proteins of interest at term and at week 1. Blood pressure was measured in male offspring by telemetry from postnatal month 2 to postnatal month 9. The numbers of glomeruli at weeks 1 and 12 were significantly lower and, in males, telemetrically measured mean arterial blood pressure after month 5 was higher in offspring of dams on a high- or low- compared with intermediate-sodium diet. A high-salt diet was paralleled by higher concentrations of marinobufagenin in the amniotic fluid and an increase in the expression of both sprouty-1 and glial cell-derived neutrophic factor in the offspring's kidney. The expression of FGF-10 was lower in offspring of dams on a low-sodium diet, and the expression of Pax-2 and FGF-2 was lower in offspring of dams on a high-sodium diet. Both excessively high and excessively low sodium intakes during pregnancy modify protein expression in offspring kidneys and reduce the final number of glomeruli, predisposing the risk of hypertension later in life.

Full text

Page 1

doi:10.1152/ajprenal.00626.2010
301:F344-F354, 2011. First published 18 May 2011;
Am J Physiol Renal Physiol
and Marie-Luise Gross-Weissmann
Annett Müller, Monika Weckbach, Jens Randel Nyengaard, Peter Schirmacher
Nadezda Koleganova, Grzegorz Piecha, Eberhard Ritz, Luis Eduardo Becker,
alter kidney development in the offspring
Both high and low maternal salt intake in pregnancy
You might find this additional info useful...
for this article can be found at:
http://ajprenal.physiology.org/content/suppl/2011/05/15/ajprenal.00626.2010.DC1.html
Supplemental material
65 articles, 28 of which can be accessed free at:
http://ajprenal.physiology.org/content/301/2/F344.full.html#ref-list-1
This article cites

including high resolution figures, can be found at:Updated information and services
http://ajprenal.physiology.org/content/301/2/F344.full.html
can be found at:
AJP - Renal Physiology
about Additional material and information
http://www.the-aps.org/publications/ajprenal
This infomation is current as of February 4, 2012.

American Physiological Society. ISSN: 0363-6127, ESSN: 1522-1466. Visit our website at http://www.the-aps.org/.
(monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2011 by the
respective cells and vasculature, as well as to the control of body fluid volume and composition. It is published 12 times a year
publishes original manuscripts on a broad range of subjects relating to the kidney, urinary tract, and their
AJP - Renal Physiology
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 2

Both high and low maternal salt intake in pregnancy alter kidney
development in the offspring
Nadezda Koleganova,1Grzegorz Piecha,1,2,3Eberhard Ritz,2Luis Eduardo Becker,2Annett Müller,1
Monika Weckbach,1Jens Randel Nyengaard,4Peter Schirmacher,1and Marie-Luise Gross-Weissmann1
1Institute of Pathology and2Department of Internal Medicine, Division of Nephrology, University of Heidelberg, Heidelberg,
Germany;3Department of Nephrology, Endocrinology, and Metabolic Diseases, Medical University of Silesia, Katowice,
Poland; and4Stereology and EM Laboratory, Centre for Stochastic Geometry and Advanced Bioimaging, University of
Aarhus, Aarhus, Denmark
Submitted 25 October 2010; accepted in final form 11 May 2011
KoleganovaN,PiechaG,RitzE,BeckerLE,MüllerA,WeckbachM,
Nyengaard JR, Schirmacher P, Gross-Weissmann ML. Both high and
low maternal salt intake in pregnancy alter kidney development in offspring.
AmJPhysiolRenalPhysiol301:F344–F354,2011.FirstpublishedMay18,
2011; doi:10.1152/ajprenal.00626.2010.—In humans, low glomerular
numbers are related to hypertension, cardiovascular, and renal disease
in adult life. The present study was designed 1) to explore whether
above- or below-normal dietary salt intake during pregnancy influ-
ences nephron number and blood pressure in the offspring and 2) to
identify potential mechanisms in kidney development modified by
maternal sodium intake. Sprague-Dawley rats were fed low (0.07%)-,
intermediate (0.51%)-, or high (3.0%)-sodium diets during pregnancy
and lactation. The offspring were weaned at 4 wk and subsequently
kept on a 0.51% sodium diet. The kidney structure was assessed at
postnatal weeks 1 and 12 and the expression of proteins of interest at
term and at week 1. Blood pressure was measured in male offspring by
telemetry from postnatal month 2 to postnatal month 9. The numbers
of glomeruli at weeks 1 and 12 were significantly lower and, in males,
telemetrically measured mean arterial blood pressure after month 5
was higher in offspring of dams on a high- or low- compared with
intermediate-sodium diet. A high-salt diet was paralleled by higher
concentrations of marinobufagenin in the amniotic fluid and an
increase in the expression of both sprouty-1 and glial cell-derived
neutrophic factor in the offspring’s kidney. The expression of FGF-10
was lower in offspring of dams on a low-sodium diet, and the
expression of Pax-2 and FGF-2 was lower in offspring of dams on a
high-sodium diet. Both excessively high and excessively low sodium
intakes during pregnancy modify protein expression in offspring
kidneys and reduce the final number of glomeruli, predisposing the
risk of hypertension later in life.
intrauterine environment; dietary salt; kidney development; nephron
underdosing; blood pressure; Barker hypothesis
THERE IS GROWING CONSENSUS (4, 44), that customary levels of
salt intake in Western societies make a major contribution to
elevated blood pressure (20, 28). Several mechanisms have
been proposed to explain the effect of salt on blood pressure
(21, 25, 27, 40). Excessive salt intake causes secretion of
endogenous cardiotonic steroids, e.g., marinobufagenin (MBG),
which inhibits plasmalemmal Na?-K?-ATPase (6). The result-
ing effects include natriuresis, elevation of blood pressure,
vasoconstriction, and heart and kidney fibrosis (6). High MBG
serum concentrations in preeclamptic mothers are correlated
with low birth weight (42). Furthermore, maternal pre-
eclampsia is associated with higher blood pressure in the
offspring (23).
Recently, observations in animal experiments (10, 64) and in
humans (31, 32, 34) indicate that a low nephron number is
associated with higher blood pressure. In addition, prenatal
programming has been shown to be related to factors such as
obesity, insulin resistance, and other cardiovascular risk factors
(8). Maternal diet is a modifiable factor influencing the off-
spring’s health in adult life. In experimental studies, several
maternal factors, such as protein, calorie, and calcium defi-
ciency are associated with a higher risk of the offspring
developing hypertension; in humans, this association is less
clear (12). In rats, exposure of dams to a low-protein diet at any
period of pregnancy results in hypertension (37) and lower
nephron number (63) in their offspring. Maternal high salt
intake also influences organ development in the fetus, for
instance, the heart (18).
Kidney development is orchestrated by a sequence of inter-
playing factors. Their disruption causes abnormal renal devel-
opment. Fibroblast growth factor (FGF)-2 is produced in the
ureteric bud; it prevents apoptosis of the metanephrogenic
mesenchyme and induces formation of nephrons (17). Further-
more, expression of paired box transcription factor (Pax)-2 is
required for the early phase of mesenchyme-to-epithelium
transition and is subsequently downregulated as the tissue
becomes more differentiated (55). Pax-2 knockout mice do not
develop kidneys (61). Wilms’ tumor inhibitory protein 1
(WT-1) gene is expressed starting with the early stages of
nephrogenesis. In contrast to Pax-2, it is expressed in glomeruli
of fetal kidneys at a later stage than PAX genes (19). The
expression of WT-1 increases as glomeruli mature and sup-
presses Pax-2 expression (56). Glial cell line-derived neu-
rotrophic factor (GDNF) signaling is vital for kidney develop-
ment, and GDNF knockout mice demonstrate kidney agenesis
(57). The loss of one allele for GDNF causes a reduction in
nephron number and adult hypertension (15). GDNF’s effects
in kidney development are opposed by an inhibitor, sprouty-1
(9). In the absence of GDNF signaling, FGF-10 starts playing
a major role in ureteric bud branching (46). Blockade of the
renin-angiotensin system (RAS) during kidney development
results in irreversible abnormalities in renal histology, includ-
ing low nephron number (24, 65). Vascular endothelial growth
factor (VEGF) is produced by differentiating podocytes and
triggers formation of capillaries in the glomeruli (35).
Low-calorie and low-protein diets in dams cause low birth
weight, low nephron number, and hypertension in their off-
spring (29, 64). Increased maternal salt intake has been asso-
Address for reprint requests and other correspondence: N. Koleganova,
Institute of Pathology, Univ. of Heidelberg, Im Neuenheimer Feld 220/221,
D-69120, Heidelberg, Germany (e-mail: nad_ko@gmx.de).
Am J Physiol Renal Physiol 301: F344–F354, 2011.
First published May 18, 2011; doi:10.1152/ajprenal.00626.2010.
1931-857X/11 Copyright © 2011 the American Physiological Societyhttp://www.ajprenal.orgF344
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 3

ciated with kidney dysfunction in the offspring (7, 45). In-
creased blood pressure has been reported in offspring after
maternal high salt intake in one study (45), but only an elevated
poststress blood pressure response has been observed by others
(53). On the other hand, salt restriction in dams lead to lower
birth weight (39). This topic is definitely of interest because it
has been shown that maternal sodium intake determines blood
pressure in the next generation (14).
In modern times, salt intake in humans has become exces-
sive. There is, however, no knowledge of how far the salt
restriction should go. It was the purpose of the present inves-
tigation to examine the effects of sodium intake below or above
sodium intake generally used in rat experiments compared with
standard sodium intake in dams on nephron formation and
blood pressure in the offspring. We hypothesized that either
below-usual or above-usual sodium intake in dams would
reduce the number of glomeruli and increase blood pressure in
the offspring. It was a further object of the study to identify
potential pathways correlated with the changes in nephron
numbers.
MATERIALS AND METHODS
Animals
All animals were handled according to written approval from the
local authority for animal experiments (Regierungspraesidium
Karlsruhe). Pregnant Sprague-Dawley rats were obtained from
Charles River (Sulzfeld, Germany) at day 1 after conception. The
animals were randomized to receive a diet based on a standard rodent
diet (Ssniff, Soest, Germany) with modified sodium content: 0.07%
(low sodium; LS; n ? 34 dams); 0.51% (intermediate sodium; IS; n ?
34 dams); or 3.0% (high sodium; HS; n ? 35 dams) from the first day
of pregnancy until weaning. The litters were standardized to identical
size (n ? 10/litter) by randomly culling the pups at birth with a 1:1
male-to-female ratio retained. Subsequently, one randomly chosen
offspring per litter was used for each of the analyses. Offspring were
separated from their mothers at the age of 4 wk and subsequently
received the IS diet (0.51% Na). All animals were housed at a constant
room temperature (21 ? 1°C) and humidity (75 ? 5%) and were
exposed to a 12:12-h light-dark cycle. The animals had free access to
deionized water and food. Body weight, food, and water consumption
were monitored weekly.
ELISA
Urine was sampled for 24 h in metabolic cages at postnatal months
3, 6, and 9 (n ? 10 male and 10 female offspring/group) at baseline
and after 7 days of the HS (8%) diet. Urinary albumin excretion was
measured with a rat-specific ELISA kit (50).
MBG was measured in samples of amniotic fluid taken from individ-
ual fetuses (n ? 12/group) at gestation day 21 following extraction with
C18 columns as described previously (54). ELISA plates were coated
with a MBG-BSA conjugate at a dose of 5 ng/well. Anti-MBG mono-
clonal antibody (4G4, titer 1:1,000) derived from a mouse was employed
(100?l/well)followedbyabiotinylatedanti-mouseantibodyandstrepta-
vidin-horseradish peroxidase conjugate (Abcam, Cambridge, UK). C18
column extracts were sometimes diluted so that all absorbance values
could be read on the linear part of a MBG concentration curve, which
typically ranged from 10 pM to 1 nM.
Perfusion Fixation and Tissue Sampling
Tissue was collected from offspring at day 21 of gestation and at 1
and 12 wk of age. Under global anesthesia (100 mg/kg ketamine and
3.0 mg/kg xylazine), the abdominal aorta was catheterized, blood
samples were taken, and retrograde pressure-controlled perfusion
fixation was performed using 4% phosphate-buffered formaldehyde at
body temperature for morphological or ice-cold NaCl for molecular
investigations, respectively. Tissue samples were prepared as previ-
ously described (50).
Blood Analyses
Blood samples were collected from the abdominal aorta at the time
of death. The concentrations of sodium and potassium were deter-
mined in whole blood by an ionometer (Ionometer 2, Fresenius
Medical Care). Serum parameters were analyzed using standard lab-
oratory methods, and creatinine by Jaffé’s method.
Systolic Blood Pressure Measurement
In the male offspring, blood pressure was measured by telemetry
from postnatal months 2–9 (n ? 6/group) as previously described
(49). Briefly, at the age of 8 wk, under isoflurane (Baxter) anesthesia
a telemetry sensor (model PA-C40; Data Science International) was
inserted into the abdominal aorta below the renal arteries, and the
transmitter was fixed intraperitoneally.
Morphological Investigations
Glomerular stereology. All investigations were performed by an
observer who was unaware of the study groups.
The number of glomeruli was estimated using the fractionator
method (48). Each kidney (from 7–9 males and 7–9 females/group at
each age) was dehydrated in graded ethanol, embedded in glycolmeth-
acrylate (Technovite 7100; Hereus Kulzer, Wehrheim, Germany), and
cut exhaustively in 20-?m-thick sections. Every 30th section and its
adjacent section (9–11 section pairs) were selected, mounted on one
slide, and stained with periodic acid-Schiff. Counting was performed
using an Olympus BX-50 microscope at a magnification of ?113 with
an automated Märzhäuser Multi Control 2000 specimen stage (Mär-
zhäuser, Wetzlar-Steindorf, Germany) and a digital camera (Pixelink
PL-A686C) connected to a computer with newCAST software (Vi-
siopharm, Hørsholm, Denmark) to superimpose the counting frame.
The glomeruli were counted if they were present inside the two-
dimensional unbiased counting frame in one section (the sampling
frame) but not in the adjacent section plane (the look-up section) and
vice versa. The average volume of glomeruli was estimated as a ratio
between the volume fraction of glomeruli estimated by point counting
and the numerical density of glomeruli estimated by dissector-sam-
pling as described above.
In 1-wk-old animals S-shaped bodies, immature, and mature glom-
eruli, defined according to Larsen (38), were counted separately.
Developing glomeruli were organized in layers of different matu-
rity (38). The number of layers was counted under ?400 magnifica-
tion in several view-fields, depending on kidney size.
Western Blotting
Kidney samples obtained on gestation day 21 (from 10 males and
10 females/group) and postnatal week 1 (from 10 males and 10
females/group) were homogenized. The protein concentration was
determined by the Bradford method (Bio-Rad). Protein (25 ?g) was
electrophoresed on SDS-polyacrylamide gels. Subsequently proteins
wereelectroblottedontopolyvinyldifluoridemembranes(Immobilon-P,Mil-
lipore). The membranes were blocked with 5% nonfat dry milk in
Tris-buffered saline with 0.5% Tween 20 (TBS-T) and incubated for
2 h at room temperature with the primary antibody against angioten-
sin-converting enzyme (ACE), FGF-2 (Chemicon), ANG II type 1
receptor (AT1R), renin, GDNF (Abcam), ANG II type 2 (AT2)
receptor, Pax-2, VEGF, WT-1, FGF-10, sprouty-1, and Na-K-ATPase
subunits ?1 and ?3 (Santa Cruz Biotechnology). Horseradish perox-
idase-conjugated secondary antibodies (Santa Cruz Biotechnology)
were used. Peroxidase labeling was detected using a chemilumines-
cence kit according to the manufacturer’s recommendations (GE
F345
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 4

Healthcare). To control for variations in protein loading or transfer,
membranes were washed and reincubated with anti-?-actin antibody
(Abcam). The specific bands were quantified using computer software
(ImageJ, National Institutes of Health).
Immunohistochemistry
Kidney samples obtained at postnatal week 1 (from 10 males and
10 females/group) were embedded in paraffin, and 2-?m sections
were used for immune staining using primary antibodies against
FGF-2 (Chemicon), angiotensin II type 1 receptor, GDNF (Abcam),
angiotensin II type 2 receptor, FGF-10, and sprouty-1 (Santa Cruz
Biotechnology). Biotin-labeled secondary antibodies, streptavidin-
conjugated alkaline phosphatase (BioGenex) and Fast Red substrate
(Dako) were used for visualization. Stained sections were analyzed by
an observer unaware of the study groups. Negative controls were
performed by omitting the primary antibody. Before the primary
antibody was applied, endogenous biotin was blocked by 0.05%
avidin in phosphate buffered saline followed by 0.005% biotin to
saturate the bound avidin. All antibodies were tested to cross-react
with rat samples.
Real-Time PCR
Total RNA was isolated from whole kidneys from offspring at
gestation day 21 (10 males and 10 females/group) and postnatal week
1 (10 males and 10 females/group) using the SV Total RNA Isolation
System (Promega) according to the manufacturer’s instructions, and
real-time PCR was performed as previously described (50) using
primers for WT-1 (gcagagcaaccacggcac), Pax-2 (gactttaagagatgtgtc-
cgaggg), renin (ctgcctgtgagattcacaacc), ACE (gtggctacgagcatgacatca),
AT1 receptor (tgatcaccaggtcaagtggatt), ?1-Na-K-ATPase (ggcag-
cagtggacctacgag), and ?3-Na-K-ATPase (cagagacagggagcaattgtg).
Every sample was quantified using a gene-specific standard curve, and
the average value of three different PCR runs normalized to GAPDH
expression was taken for statistical evaluation.
Statistical Analysis
Data are given as means ? SD. For Western blotting, the interme-
diate-sodium group served as a reference, and the mean value of
individual measurements was set as 100%. The value for each animal
was expressed as the manifold of the reference. One randomly chosen
offspring per litter was used for each of the analyses. Two-way (diet
and sex) ANOVA was used, followed by Duncan’s multiple-range test
for differences between groups. The results were considered signifi-
cant when P was ?0.05.
RESULTS
Dams
There was no difference between the groups with respect to
body weight at the beginning and at end of pregnancy or with
respect to weight gain during pregnancy (Table 1). Daily food
consumption was significantly higher in dams on the HS
compared with dams on IS and LS diets.
Offspring Data: Litter Size, Body Weight, and
Kidney Weight
There was no significant difference in mean litter size
between dams on the LS (12.5 ? 2.6 offspring), IS (13.5 ? 1.6
offspring), and HS diet (12.7 ? 1.6 offspring). Similarly, no
difference between the groups was seen with respect to pla-
centa weight (LS: 0.435 ? 0.056 g; IS: 0.432 ? 0.073 g; HS:
0.455 ? 0.059 g).
The body weight of offspring was not different between the
groups examined at fetal day 21 and later, until postnatal week
12 (Table 2).
Kidney weight-to-body weight ratio were not different be-
tween the groups of offspring (Table 2). There was no differ-
ence in kidney weight-to-body weight ratio between male and
female offspring.
At 12 wk of age, serum concentrations of sodium and
potassium were not significantly different between the groups
(Table 3). Serum concentrations of creatinine were signifi-
cantly lower and creatinine clearances were higher in both
male and female offspring of dams on a HS compared with a
LS or IS diet (Table 3).
Systolic Blood Pressure and Albuminuria
Until postnatal month 4, there was no difference in mean
arterial blood pressure between the groups of male offspring.
Beginning at postnatal month 5 until the end of observation at
month 9, mean arterial pressure was significantly higher in
male offspring of dams on a LS or HS diet, respectively
compared with offspring of dams on IS intake (Fig. 1).
At 3 mo of age, 24-h baseline urinary albumin excretion was
significantly (P ? 0.05, ANOVA) higher in the male offspring
of dams on LS and HS compared with offspring of dams on IS,
and the difference increased from month 6 (Fig. 1B). There was
no difference in baseline albuminuria in female offspring (Fig.
1C). After 7 days of a HS diet, urinary albumin excretion
increased more in male offspring of dams on LS and HS
compared with offspring of dams on IS (Fig. 1D). In
females, albuminuria increased on a HS diet in offspring of
dams on LS from month 6 and in offspring of dams on HS
on month 9 (Fig. 1E).
Number of Glomeruli
At 1 wk of age, the total number of glomeruli was signifi-
cantly (P ? 0.001, ANOVA) lower in offspring of dams on LS
(23,900 ? 4,000) and even more in offspring of dams on HS
(11,200 ? 1,800) compared with IS (30,800 ? 4,000). No
difference was found between males and females (Fig. 2).
At 1 wk of age, the relative proportion (% of all glomeruli)
of S-shaped bodies was significantly lower in offspring of
Table 1. Body weight and food intake of dams
Group
Body Weight, g
Food Intake During
Pregnancy, g/dayAt start of pregnancyAt end of pregnancy Gain in pregnancy
Low sodium
Intermediate sodium
High sodium
ANOVA
205 ? 29
201 ? 29
203 ? 32
NS
305 ? 29
298 ? 29
294 ? 32
NS
100 ? 27
97 ? 22
91 ? 26
NS
21.3 ? 4.9
20.7 ? 2.4
26.6 ? 3.6*†
P ? 0.05
Values are means ? SD. NS, not significant. *P ? 0.05 vs. low sodium. †P ? 0.05 vs. intermediate sodium.
F346
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 5

dams on HS (4.3 ? 3.1%; 480 ? 350/kidney) compared with
offspring of dams on IS (9.8 ? 6.3%; 3,020 ? 1,940/kidney)
or LS (9.4 ? 3.8%; 2,250 ? 910/kidney) (Fig. 2).
The relative proportion of immature glomeruli was not
significantly different between the groups (Fig. 2).
The relative proportion of mature glomeruli was significantly
higher in offspring of dams on HS (11.9 ? 7.1%; 1,330 ? 800/
kidney) compared with offspring of dams on LS (6.0 ? 4.3%;
1,430 ? 1,030/kidney). The proportion of mature glomeruli in off-
spring of dams on IS (8.3 ? 5.4%; 2,560 ? 1,670/kidney) was not
different from offspring of dams on HS and on LS (fig. 2).
The number of layers of developing glomeruli was sig-
nificantly (P ? 0.001) higher in offspring of dams on HS
(7.1 ? 0.6) compared with offspring of dams on LS (5.9 ?
0.9) and IS (5.8 ? 1.1). There was no significant difference
in the number of glomeruli and their maturation between
male and female offspring.
The average glomerular volume was significantly (P ?
0.001) higher in offspring of dams on HS (1.47 ? 0.37 ? 106
?m3) compared with offspring of dams on LS (0.59 ? 0.18 ?
106?m3) and IS (0.49 ? 0.09 ? 106/?m3) with no difference
between males and females.
At 12 wk of age, the total number of glomeruli per kidney was
significantly lower in offspring of dams on LS (19,200 ? 3,200)
and lowest in offspring of dams on HS (12,300 ? 2,500) com-
pared with offspring of dams on IS (31,600 ? 4,300) (Fig. 2). No
difference in the number of glomeruli between male and female
offspring was observed.
The average glomerular volume was significantly higher in
offspring of dams on HS (6.91 ? 2.72 ? 106?m3) compared
with offspring of dams on IS (2.25 ? 0.89 ? 106?m3) and on
LS (3.51 ? 1.26 ? 106?m3) (Fig. 2).
Growth and Transcription Factors
At 1 wk of age, expression of Pax-2 was significantly lower
in offspring of dams on HS compared with offspring of dams
on LS and IS (Fig. 3).
The protein expression of WT-1 was significantly higher
both at term and at 1 wk of age in offspring of dams on HS
compared with offspring of dams on LS and IS (Fig. 3). The
mRNA expression of WT-1 was also significantly (P ? 0.05)
higher in offspring of dams on HS (term: 2.70 ? 0.65, week 1:
1.00 ? 0.38) compared with offspring of dams on LS (2.15 ?
0.57 and 0.71 ? 0.31, respectively) and IS (2.29 ? 0.52 and
0.65 ? 0.47, respectively).
At term, the expression of VEGF was significantly lower
and the expression of basic fibroblast growth factor (FGF-2)
Table 2. Body and organ weight in offspring
Group
21-Day Fetuses 1 wk 12 wk
Body
weight, g
Kidney weight,
mg
Kidney weight/
body weight ratio,
mg/g
Body
weight, g
Kidney
weight,
mg
Kidney weight/
body weight
ratio, mg/g
Body
weight, g
Kidney
weight, g
Kidney weight/
body weight ratio,
g/kg
Female
Low sodium
Intermediate
sodium
High sodium
Male
Low sodium
Intermediate
sodium
High sodium
2.33 ? 0.146.55 ? 0.894.11 ? 0.51 17.0 ? 3.0 131 ? 14 7.52 ? 0.61270 ? 241.34 ? 0.13 5.03 ? 0.47
2.37 ? 0.21
2.47 ? 0.18
5.46 ? 1.23*
7.32 ? 0.77*†
3.46 ? 0.65
4.01 ? 0.46
16.9 ? 2.0
16.6 ? 1.6
129 ? 18
117 ? 17
7.47 ? 1.26
6.76 ? 1.01
275 ? 23
275 ? 18
1.31 ? 0.16
1.43 ? 0.16*†
4.81 ? 0.56
5.25 ? 0.59
2.41 ? 0.19 6.25 ? 0.903.99 ? 0.52 17.6 ? 2.5 126 ? 157.27 ? 0.72454 ? 452.32 ? 0.22 5.14 ? 0.43
2.45 ? 0.23
2.55 ? 0.19
5.99 ? 0.15*
7.38 ? 0.90*†
3.60 ? 0.34
3.95 ? 0.66
17.0 ? 1.8
16.9 ? 1.6
131 ? 18
136 ? 24
7.52 ? 1.19
7.42 ? 1.22
445 ? 29
464 ? 36
2.37 ? 0.26
2.52 ? 0.20*†
5.18 ? 0.47
5.45 ? 0.47
2-Way ANOVA
Sex
Salt intake of
dams
NSNSNS NSNSNS
P ? 0.001
P ? 0.001NS
NS
P ? 0.001NS NSNSNS NS
P ? 0.005 NS
Values are means ? SD. *P ? 0.05 vs. low sodium †P ? 0.05 vs. intermediate sodium.
Table 3. Blood analyses in offspring at week 12
GroupNa?, mmol/l
K?, mmol/l
Creatinine, ?mol/l Creatinine clearance, ml/min
Female
Low sodium
Intermediate sodium
High sodium
Male
Low sodium
Intermediate sodium
High sodium
141 ? 3
141 ? 2
140 ? 2
3.9 ? 0.2
3.9 ? 0.2
4.0 ? 0.3
34.1 ? 8.4
34.4 ? 9.4
29.4 ? 6.4*†
1.53 ? 0.98
1.35 ? 0.55
2.37 ? 1.00*†
141 ? 3
140 ? 2
140 ? 2
3.9 ? 0.2
3.9 ? 0.2
3.8 ? 0.4
29.1 ? 5.3
30.6 ? 4.1
24.1 ? 3.7*†
2.45 ? 1.07
2.57 ? 0.59
3.61 ? 1.39*†
2-Way ANOVA
Sex
Salt intake of dams
NS
NS
NS
NS
P ? 0.001
P ? 0.01
P ? 0.001
P ? 0.001
Values are means ? SD. *P ? 0.05 vs. low sodium. †P ? 0.05 vs. intermediate sodium.
F347
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 6

higher in offspring of dams on HS compared with offspring of
dams on IS (Fig. 3). At 1 wk of age, the expression of VEGF
and FGF-2 was lower in kidneys of dams on HS compared with
offspring of dams on LS and IS. Strong staining for FGF-2 was
detected in proximal and distal tubuli, and weak staining was
observed in glomeruli without differences in localization be-
tween groups.
The expression of glial cell line-derived neurotrophic factor
(GDNF) was not different between the groups at term, but at
week 1 it was higher in offspring of dams on HS and LS
compared with offspring of dams on IS (Fig. 3). Staining for
GDNF was detected in glomerular, proximal, and distal tubular
compartments without differences in localization between
groups.
At term, the expression of sprouty-1 was similar in all
groups and was significantly higher at week 1 in both offspring
of dams on HS and LS compared with IS (Fig. 3). Staining for
sprouty-1 was strong in proximal tubuli, weak in distal tubuli,
and absent in glomeruli. There was no difference in localiza-
tion of staining between groups. At 1 wk of age, the sprouty-
1/GDNF ratio was significantly (P ? 0.001) higher in offspring
of dams on HS (3.8 ? 1.0) and LS (2.3 ? 0.4) compared with
IS (0.5 ? 0.2).
The expression of FGF-10 was lowest in offspring of dams
on LS both at term and at 1 wk (Fig. 3). Staining for FGF-10
was strong in proximal tubuli, weak in distal tubuli, and absent
in glomeruli. There was no difference in localization of stain-
ing between groups.
Components of the RAS
The protein expression of renin at term in offspring of dams
on HS was significantly lower compared with offspring of
dams on LS and IS (Fig. 4). Similar results were observed for
mRNA: HS: 0.85 ? 0.28, P ? 0.005 vs. LS: 1.04 ? 0.14, IS:
1.20 ? 0.27. At 1 wk of age, the expression of renin and ACE
Fig. 1. A: mean arterial blood pressure (MAP)
measured by intra-aortal telemetry in male
offspring. Starting at postnatal month 5, MAP
(1-mo average) was significantly (*P ? 0.05)
higher in offspring of dams on low salt (LS) or
high salt (HS) intake compared with interme-
diate salt (IS) intake. B–E: 24-h urinary albu-
min excretion on a standard diet (B, male
offspring; C, female offspring) and after 1 wk
of HS (8%) diet (D, male offspring; E, female
offspring; BL, baseline, 1W, HS diet). Base-
line albuminuria was significantly (*P ? 0.05
vs. IS) higher in offspring of dams on LS or
HS compared with IS from month 3. HS diet
further increased albuminuria (†P ? 0.05 vs.
baseline) in male offspring of dams on LS or
HS at month 3 and all male offspring from
month 6. In females, albuminuria increased on
a HS salt diet in offspring of dams on LS from
month 6 and in offspring of dams on HS from
month 9.
F348
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 7

was significantly higher in the offspring of dams on HS
compared with offspring of dams on LS and IS.
At term, the protein expression of AT1R was significantly
lower in offspring of dams on HS compared with offspring of
dams on IS and LS (Fig. 4). This was confirmed at mRNA
level: HS: 1.61 ? 0.34, P ? 0.005 vs. IS: 2.16 ? 0.48, LS:
1.92 ? 0.45. At 1 wk of age, the expression of AT1R was
highest in offspring of dams on HS, intermediate in offspring
of dams on LS, and lowest in offspring of dams on IS. Staining
for AT1R was detected in proximal and distal glomeruli but not
in glomeruli in similar localization in all groups.
Both at term and at 1 wk of age, the expression of AT2R on
the protein level was significantly lower in offspring of dams
on HS and LS compared with offspring of dams on IS (Fig. 4).
Staining for AT2R was detected in glomerular, proximal, and
distal tubular compartments in similar localization in all
groups.
Sodium-Potassium Pump
The expression of ?1-Na?-K?-ATPase (at both protein and
RNA levels) at term was significantly lower in offspring of
dams on HS or LS compared with IS and, conversely, signif-
icantly higher in offspring of dams on HS or LS compared with
IS at week 1 (Fig. 5). The expression of ?3-Na?-K?-ATPase
was significantly lower in offspring of dams on HS or LS
compared with IS both at term and at week 1 (Fig. 5).
MBG in Amniotic Fluid
The concentration of MBG in the amniotic fluid was
significantly higher in HS and LS compared with the IS
group (Fig. 6).
DISCUSSION
The main finding of the present study is the identification of
potential molecular mechanisms influencing nephron develop-
ment in response to different salt intakes in dams as well as the
documentation of diminished final nephron number in off-
spring of dams fed either a LS or HS diet during pregnancy and
weaning. The lower prevalence of S-shaped bodies and the
relative increase in mature glomeruli in the offspring of dams
on HS may argue for accelerated maturation of glomeruli.
Our study does not answer the question of whether the
reduced nephron number following modification of dietary salt
was due to events in utero or during lactation. In contrast to
humans, in rats nephrogenesis continues until 8 days postna-
tally. This was the reason we used the modified diet also during
lactation. The issue has been raised whether HS causes regres-
sion of glomeruli; this possibility cannot be completely ex-
cluded, but no glomerular remnants were observed. The dif-
ferences in food intake (and subsequently protein and calorie)
by dams are unlikely to account for the lower nephron number
observed in LS and HS groups, because food intake between
LS and IS dams was not different and even higher in HS dams.
Blood pressure was higher in male offspring of dams on HS
or LS diets after 5 mo of life. Similarly, blood pressure
elevation has been shown in animals with a genetic deficit of
glomeruli (15, 36) or after maternal protein restriction (66).
Hypertension was also seen in humans with low nephron
numbers (31, 32, 34). It is worth noting that previous studies
have shown that, over time, blood pressure of animals with
reduced nephron numbers becomes progressively more salt
sensitive (47, 58). HS intake in pregnant rats caused a greater
blood pressure response to stress (53) in their adult offspring
and caused an elevation of resting blood pressure (62), which
our study confirms. In contrast to the observation by Porter et
al. (53), we observed elevation of baseline blood pressure in
the male offspring of dams on HS, but the animals in the study
by Porter were younger (2–6 mo) and the HS diet was
continued in lactation and therefore until the end of nephro-
genesis in this study.
Fig. 2. A: number of glomeruli per kidney in
female (Œ) and male (?) offspring at 1 wk of
age. B: relative proportion of glomeruli at
different stages of maturation at 1 wk of age.
C and D: number and average volume, re-
spectively, of glomeruli per kidney in female
(Œ) and male (?) 12-wk-old offspring. There
were fewer glomeruli in offspring of dams on
LS or HS compared with IS both at 1 and at
12 wk of age. In addition, in offspring of
dams on HS the glomeruli were bigger and
the proportion of S-shaped bodies was lower.
F349
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 8

In the present study, maternal sodium intake in one group
was 0.07%; this intake was chosen because more intense
sodium restriction of the maternal diet (0.03%) causes growth
restriction and later obesity, hypertension (10), and increased
renin activity (43) in the offspring. Normal rat chow contains
0.3–0.5% sodium. This concentration would be excessive for
humans, but is necessary for growing rodents. The HS diet (3%
Na ? 8% NaCl) represents an ?5–10 times increase in sodium
intake from the rodents baseline, similar to human increase in
the industrial era (60). It was chosen to match the diets used
in previous studies (18, 53, 62) and because this salt intake in
pregnancy and lactation resulted in hypertension in the off-
Fig. 3. Expression of transcription and growth
factors in offspring kidneys. Representative
Western blots are shown. Values of the IS
group were taken as reference (100%). By
2-way ANOVA, there was no difference be-
tween sexes. The expression of glial cell-
derived neurotrophic factor (GDNF) and
sprouty-1 was higher in LS and HS offspring at
postnatal day 7. In HS offspring, the expression
of Pax-2 and FGF-2 were lower while WT-1
was higher. In LS offspring, the expression of
FGF-10 was lower. WT-1, Wilms’ tumor-1.
F350
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 9

spring rats (16). The diets were maintained during lactation to
maintain the same salt intake until the end of nephrogenesis,
i.e., until 8 days postnatally.
Brenner et al. (11) had proposed the hypothesis that bigger
glomeruli are more susceptible to delayed loss of renal func-
tion, presumably as a result of glomerular hyperfiltration (59).
The findings of higher creatinine clearance and bigger glom-
eruli in offspring of dams on HS are presumably associated
with glomerular hyperfiltration. In a model of low glomerular
numbers, i.e., offspring of rats of dams on a low-protein diet,
administration of anti-Thy1 antibody caused more aggressive
glomerulonephritis (51). An indirect indicator of the existence
of a relationship between nephron number and progression of
kidney disease in humans is the recent observation (26) that
low birth weight (a surrogate marker for reduced nephron
number) increases the risk of chronic kidney disease at adult-
hood.
It is of note that in the present study urinary albumin
excretion was higher in the offspring of pregnant rats on both
LS or HS, potentially a reflection of lower glomerular numbers.
Our results further support the observation by Sanders et al.
(58) of more severe albuminuria after salt loading in offspring
with reduced nephron numbers. A relationship between growth
restriction and albuminuria presumably exists in humans as
well: Keijzer-Veen et al. (33) noted that individuals with low
birth weight had more pronounced albuminuria at age 19 yr.
In the present study, the results were obtained by the design-
based fractionator method (48). The final number of glomeruli
in offspring of Sprague-Dawley dams on IS is in agreement
with data reported by others (5, 30). In contrast to our results,
Cardoso et al. (13) did not observe lower nephron number in
offspring of dams with increased sodium intake in pregnancy.
The discrepancy may be explained by a different sodium
exposition, different rat strain, but also by a less-exact method
to determine nephron number in the study of Cardoso et al.
Interestingly, the increased albuminuria in those offspring was
present in both studies.
We tried to identify factors potentially involved in the
modulation of nephrogenesis by maternal salt intake. In the
present study, offspring of pregnant rats on HS had not only
lower nephron numbers but also lower renal expression of
renin at birth. This finding is in agreement with observations
in the low-protein model of intrauterine growth restriction
(64). Similar to what was seen in offspring of dams on a
low-protein diet (3), the expression of AT2R was reduced at
term and on day 7 in offspring of dams on LS or HS as well.
In this model, however, the expression of renin, AT1R, and
ACE was higher 7 days after birth, possibly pointing to
transplacental modulation of the RAS by dietary salt of the
mother and potential partial escape from salt overload dur-
ing nursing. The postnatal activation of the RAS may
account for accelerated maturation of immature glomeruli in
the HS group.
One weakness of the study is that the dams were not
pair-fed, but no correlation was found between food intake of
the dam and total number of glomeruli of the offspring.
Fig. 4. Expression of the renin-angiotensin system (RAS) components in offspring kidneys. Representative Western blots are shown. Values of the IS group were
taken as reference (100%). By 2-way ANOVA, there was no difference between sexes; group differences are marked. In HS offspring, the expression of renin
and the ANG II type 1 receptor (AT1R) was lower at term, but the expression of renin, ACE, and AT1R receptor was higher 1 wk postnatally compared with
IS group. The expression of the AT2R was lower in both HS and LS compared with IS at term and at week 1.
F351
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 10

The increased MBG levels in the amniotic fluid are most
probably the result of increased placental synthesis. MBG has
been identified in the placenta, and its increase in preeclampsia
have been well documented (22). In our study in offspring of
dams on HS or LS, the expression of ?1-Na?-K?-ATPase in
fetal kidneys at term was decreased in parallel with the eleva-
tion of MBG resembling the decrease of plasmalemmal ?1-
Na?-K?-ATPase observed in response to MBG in vitro (41).
Furthermore, 7 days after birth the expression of ?1-Na?-K?-
ATPase in the kidneys increased dramatically to values greatly
above controls, suggesting that high MBG levels were no
longer present. A causal role of MBG in regulating nephron
number is likely and needs further study. This is of special
interest in view of the findings that in preeclampsia blood
pressure was lowered by scavenging antibodies interfering
with cardiotonic steroids (2) and children of preeclamptic
mothers have higher blood pressure (23).
In line with the observation in Pax-2?/?mice which have
smaller kidneys (61), we observed downregulation of Pax-2 in
the offspring of dams on HS, also consistent with the hypoth-
esis that downregulation of Pax-2 by salt loading contributes to
the cessation of the formation of new glomeruli.
In line with its inhibitory role for Pax-2 (56), we observed
higher expression of WT-1 in the kidneys of the offspring of
dams on HS accompanied by lower Pax-2 expression in this
group. Moreover, the expression of WT-1 was increased ear-
lier, i.e., gestation day 21, and Pax-2 was reduced at a later
stage.
Contrary to what could be anticipated from studies in
GDNF-deficient mice (15), we did not observe suppression of
GDNF, which is known to support nephronogenesis; in fact, its
expression was higher in groups with lower nephron num-
ber. Most importantly, we demonstrated that the expression
of sprouty-1, an endogenous inhibitor of GDNF signaling
during kidney development (9), was increased even more,
probably causing a relative GDNF deficiency leading to
nephron deficit, further supporting the causal role of the
balance between sprouty-1 and GDNF for optimal nephron
number (9).
It is of note that in fetal life several different pathways
apparently contributed to the same net effect, low nephron
Fig. 5. Expression of Na?-K?-ATPase subunits in kidneys of the offspring. Representative Western blots and RT-PCR quantification are shown. The values of
the IS group were taken as reference (100%). By 2-way ANOVA, there was no difference between sexes; group differences are marked. At term, the expression
of both ?1- and ?3-subunits was lower in LS and HS offspring. This remained unchanged at 1 wk for the ?3- subunit, but the expression of the ?1-subunit at
1 wk was higher in LS and HS offspring.
Fig. 6. The concentration of marinobufagenin (MBG) in the amniotic fluid at
term was higher in both the HS and LS groups compared with IS.
F352
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 11

number. The upregulation of WT-1 and downregulation of
Pax-2 is in agreement with the observation in the low-protein
model (1), but our findings of elevated GDNF and lower
FGF-2 are opposite of the findings in that model (1).
In view of the ability of FGF-2 to induce nephronogenesis
(52), we observed that less FGF-2 expression was paralleled by
lower numbers of newly formed nephrons in the kidneys of
offspring of dams on HS, potentially consistent with a causal
role of FGF-2.
We demonstrated lower FGF-10 expression in offspring of
dams on LS accompanying lower number of glomeruli. This
observation is of potential relevance because removal of
FGF-10 in the setting of lack of GDNF signaling stops kidney
development (46).
We were able to demonstrate that an intervention in one
parameter (sodium intake in dams) resulted in modification
of different molecular pathways depending whether the
primary signal was “increased” (HS intake caused FGF-2
deficiency) or “decreased” (LS intake caused FGF-10 defi-
ciency). In summary, the low nephron number in the off-
spring of dams on a HS diet in the present study is probably
best explained by lower FGF-2 expression and modulation
of the RAS with subsequent accelerated maturation of
glomeruli. In the offspring of dams on LS, the decreased
nephron number is most probably due to lower FGF-10
expression.
The reduced expression of VEGF in kidneys of offspring
exposed to HS is probably explained by the reduced number of
glomeruli as VEGF is secreted by maturing podocytes at a late
stage of kidney development (35).
Taken together, the above findings indicate that both too
low and too high maternal salt intakes retard development of
new glomeruli, resulting in a nephron deficit. An interven-
tion in maternal diet translated into altered protein expres-
sion in the kidneys of the offspring extending beyond
development in utero. High maternal salt intake was further
accompanied by accelerated maturation of glomeruli, glo-
merulomegaly, and albuminuria in the offspring. If the
findings in the rat can be extrapolated to humans, both too
low and too high salt intake during pregnancy would be a
risk factor for hypertension and renal damage in the off-
spring.
ACKNOWLEDGMENTS
The skillful technical assistance of H. Andersen, S. Krasemann, Z. Antoni,
J. Moyers, and J. Müller is gratefully acknowledged.
The anti-marinobufagenin antibody and marinobufagenin conjugate were a
kind gift of A. Y. Bagrov and O. V. Fedorova, LCS/NIA/NIH, Baltimore, MD.
GRANTS
N. Koleganova, G. Piecha, and L.E. Becker were supported by fellowships
of the International Society of Nephrology. The Centre for Stochastic Geom-
etry and Advanced Bioimaging is supported by the Villum Foundation. The
study was supported by Collegium Nephrologicum, Heidelberg, Germany.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
1. Abdel-Hakeem AK, Henry TQ, Magee TR, Desai M, Ross MG,
Mansano RZ, Torday JS, Nast CC. Mechanisms of impaired nephro-
genesis with fetal growth restriction: altered renal transcription and growth
factor expression. Am J Obstet Gynecol 199: 252 e251–e257, 2008.
2. Adair CD, Luper A, Rose JC, Russell G, Veille JC, Buckalew VM. The
hemodynamic effects of intravenous digoxin-binding fab immunoglobulin
in severe preeclampsia: a double-blind, randomized, clinical trial. J Peri-
natol 29: 284–289, 2009.
3. Alwasel SH, Kaleem I, Sahajpal V, Ashton N. Maternal protein restric-
tion reduces angiotensin II AT1 and AT2 receptor expression in the fetal
rat kidney. Kidney Blood Press Res 33: 251–259, 2010.
4. Appel LJ, Brands MW, Daniels SR, Karanja N, Elmer PJ, Sacks FM.
Dietary approaches to prevent and treat hypertension: a scientific state-
ment from the American Heart Association. Hypertension 47: 296–308,
2006.
5. Armitage JA, Lakasing L, Taylor PD, Balachandran AA, Jensen RI,
Dekou V, Ashton N, Nyengaard JR, Poston L. Developmental program-
ming of aortic and renal structure in offspring of rats fed fat-rich diets in
pregnancy. J Physiol 565: 171–184, 2005.
6. Bagrov AY, Shapiro JI, Fedorova OV. Endogenous cardiotonic steroids:
physiology, pharmacology, and novel therapeutic targets. Pharmacol Rev
61: 9–38, 2009.
7. Balbi AP, Costa RS, Coimbra TM. Postnatal renal development of rats
from mothers that received increased sodium intake. Pediatr Nephrol 19:
1212–1218, 2004.
8. Barker DJP. Fetal origins of coronary heart disease. BMJ 311: 171–174,
1995.
9. Basson MA, Watson-Johnson J, Shakya R, Akbulut S, Hyink D,
Costantini FD, Wilson PD, Mason IJ, Licht JD. Branching morphogen-
esis of the ureteric epithelium during kidney development is coordinated
by the opposing functions of GDNF and Sprouty1. Dev Biol 299: 466–
477, 2006.
10. Battista MC, Oligny LL, St.-Louis J, Brochu M. Intrauterine growth
restriction in rats is associated with hypertension and renal dysfunction in
adulthood. Am J Physiol Endocrinol Metab 283: E124–E131, 2002.
11. Brenner BM, Garcia DL, Anderson S. Glomeruli and blood pressure.
Less of one, more the other? Am J Hypertens 1: 335–347, 1988.
12. Brion MJ, Leary SD, Lawlor DA, Smith GD, Ness AR. Modifiable
maternal exposures and offspring blood pressure: a review of epidemio-
logical studies of maternal age, diet, and smoking. Pediatr Res 63:
593–598, 2008.
13. Cardoso HD, Cabral EV, Vieira-Filho LD, Vieyra A, Paixao AD. Fetal
development and renal function in adult rats prenatally subjected to
sodium overload. Pediatr Nephrol 24: 1959–1965, 2009.
14. Contreras RJ, Wong DL, Henderson R, Curtis KS, Smith JC. High
dietary NaCl early in development enhances mean arterial pressure of
adult rats. Physiol Behav 71: 173–181, 2000.
15. Cullen-McEwen LA, Kett MM, Dowling J, Anderson WP, Bertram
JF. Nephron number, renal function, and arterial pressure in aged GDNF
heterozygous mice. Hypertension 41: 335–340, 2003.
16. da Silva AA, de Noronha IL, de Oliveira IB, Malheiros DM, Heimann
JC. Renin-angiotensin system function and blood pressure in adult rats
after perinatal salt overload. Nutr Metab Cardiovasc Dis 13: 133–139,
2003.
17. Davies JA, Fisher CE. Genes and proteins in renal development. Exp
Nephrol 10: 102–113, 2002.
18. Ding Y, Lv J, Mao C, Zhang H, Wang A, Zhu L, Zhu H, Xu Z.
High-salt diet during pregnancy and angiotensin-related cardiac changes.
J Hypertens 28: 1290–1297, 2010.
19. Eccles MR, Yun K, Reeve AE, Fidler AE. Comparative in situ hybrid-
ization analysis of PAX2, PAX8, and WT1 gene transcription in human
fetal kidney and Wilms’ tumors. Am J Pathol 146: 40–45, 1995.
20. Elliott P, Walker LL, Little MP, Blair-West JR, Shade RE, Lee DR,
Rouquet P, Leroy E, Jeunemaitre X, Ardaillou R, Paillard F, Meneton
P, Denton DA. Change in salt intake affects blood pressure of chimpan-
zees: implications for human populations. Circulation 116: 1563–1568,
2007.
21. Fedorova OV, Kolodkin NI, Agalakova NI, Lakatta EG, Bagrov AY.
Marinobufagenin, an endogenous ?-1 sodium pump ligand, in hyperten-
sive Dahl salt-sensitive rats. Hypertension 37: 462–466, 2001.
22. Fedorova OV, Tapilskaya NI, Bzhelyansky AM, Frolova EV, Nikitina
ER, Reznik VA, Kashkin VA, Bagrov AY. Interaction of Digibind with
endogenous cardiotonic steroids from preeclamptic placentae. J Hypertens
28: 361–366, 2010.
23. Geelhoed JJ, Fraser A, Tilling K, Benfield L, Davey Smith G, Sattar
N, Nelson SM, Lawlor DA. Preeclampsia and gestational hypertension
F353
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from

Page 12

are associated with childhood blood pressure independently of family
adiposity measures: the Avon Longitudinal Study of Parents and Children.
Circulation 122: 1192–1199, 2010.
24. Guron G, Adams MA, Sundelin B, Friberg P. Neonatal angiotensin-
converting enzyme inhibition in the rat induces persistent abnormalities in
renal function and histology. Hypertension 29: 91–97, 1997.
25. Guyton AC. Blood pressure control—special role of the kidneys and body
fluids. Science 252: 1813–1816, 1991.
26. Hallan S, Euser AM, Irgens LM, Finken MJJ, Holmen J, Dekker FW.
Effect of intrauterine growth restriction on kidney function at young adult
age: The Nord Trøndelag Health (HUNT 2) Study. Am J Kidney Dis 51:
10–20, 2008.
27. Hansen J. Blood volume and exchangeable sodium in essential hyperten-
sion. Acta Med Scand 184: 517–523, 1968.
28. He FJ, MacGregor GA. How far should salt intake be reduced? Hyper-
tension 42: 1093–1099, 2003.
29. Hoppe CC, Evans RG, Bertram JF, Moritz KM. Effects of dietary
protein restriction on nephron number in the mouse. Am J Physiol Regul
Integr Comp Physiol 292: R1768–R1774, 2007.
30. Hoppe CC, Evans RG, Moritz KM, Cullen-McEwen LA, Fitzgerald
SM, Dowling J, Bertram JF. Combined prenatal and postnatal protein
restriction influences adult kidney structure, function, and arterial pres-
sure. Am J Physiol Regul Integr Comp Physiol 292: R462–R469, 2007.
31. Hoy WE, Hughson MD, Singh GR, Douglas-Denton R, Bertram JF.
Reduced nephron number and glomerulomegaly in Australian aborigines:
a group at high risk for renal disease and hypertension. Kidney Int 70:
104–110, 2006.
32. Hughson MD, Douglas-Denton R, Bertram JF, Hoy WE. Hypertension,
glomerular number, and birth weight in African Americans and white
subjects in the southeastern United States. Kidney Int 69: 671–678, 2006.
33. Keijzer-Veen MG, Schrevel M, Finken MJ, Dekker FW, Nauta J,
Hille ET, Frolich M, van der Heijden BJ, Dutch POPS19 Collabora-
tive Study Group. Microalbuminuria and lower glomerular filtration rate
at young adult age in subjects born very premature and after intrauterine
growth retardation. J Am Soc Nephrol 16: 2762–2768, 2005.
34. Keller G, Zimmer G, Mall G, Ritz E, Amann K. Nephron number in
patients with primary hypertension. N Engl J Med 348: 101–108, 2003.
35. Kitamoto Y, Tokunaga H, Tomita K. Vascular endothelial growth factor
is an essential molecule for mouse kidney development: glomerulogenesis
and nephrogenesis. J Clin Invest 99: 2351–2357, 1997.
36. Kreutz R, Kovacevic L, Schulz A, Rothermund L, Ketteler M, Paul M.
Effect of high NaCl diet on spontaneous hypertension in a genetic rat
model with reduced nephron number. J Hypertens 18: 777–782, 2000.
37. Langley-Evans SC, Welham SJ, Sherman RC, Jackson AA. Weanling
rats exposed to maternal low-protein diets during discrete periods of
gestation exhibit differing severity of hypertension. Clin Sci (Lond) 91:
607–615, 1996.
38. Larsen WJ. Development of the urogenital system In: Human Embryol-
ogy (3rd ed.). New York: Churchill Livingstone, 2001, p. 265–314.
39. Leandro SM, Furukawa LN, Shimizu MH, Casarini DE, Seguro AC,
Patriarca G, Coelho MS, Dolnikoff MS, Heimann JC. Low birth weight
in response to salt restriction during pregnancy is not due to alterations in
uterine-placental blood flow or the placental and peripheral renin-angio-
tensin system. Physiol Behav 95: 145–151, 2008.
40. Lever AF, Beretta-Piccoli C, Brown JJ, Davies DL, Fraser R, Rob-
ertson JI. Sodium and potassium in essential hypertension. Br Med J (Clin
Res Ed) 283: 463–468, 1981.
41. Liu J, Periyasamy SM, Gunning W, Fedorova OV, Bagrov AY,
Malhotra D, Xie Z, Shapiro JI. Effects of cardiac glycosides on sodium
pump expression and function in LLC-PK1 and MDCK cells. Kidney Int
62: 2118–2125, 2002.
42. Lopatin DA, Ailamazian EK, Dmitrieva RI, Shpen VM, Fedorova OV,
Doris PA, Bagrov AY. Circulating bufodienolide and cardenolide sodium
pump inhibitors in preeclampsia. J Hypertens 17: 1179–1187, 1999.
43. Lopes KL, Furukawa LN, de Oliveira IB, Dolnikoff MS, Heimann JC.
Perinatal salt restriction: a new pathway to programming adiposity indices
in adult female Wistar rats. Life Sci 82: 728–732, 2008.
44. Mancia G, De Backer G, Dominiczak A, Cifkova R, Fagard R,
Germano G, Grassi G, Heagerty AM, Kjeldsen SE, Laurent S, Nar-
kiewicz K, Ruilope L, Rynkiewicz A, Schmieder RE, Boudier HAS,
Zanchetti A. 2007 Guidelines for the Management of Arterial Hyperten-
sion: The Task Force for the Management of Arterial Hypertension of the
European Society of Hypertension (ESH) and of the European Society of
Cardiology (ESC). J Hypertens 25: 1105–1187, 2007.
45. Marin EC, Balbi AP, Francescato HD, Alves da Silva CG, Costa RS,
Coimbra TM. Renal structure and function evaluation of rats from dams
that received increased sodium intake during pregnancy and lactation
submitted or not to 5/6 nephrectomy. Ren Fail 30: 547–555, 2008.
46. Michos O, Cebrian C, Hyink D, Grieshammer U, Williams L, D’Agati
V, Licht JD, Martin GR, Costantini F. Kidney development in the
absence of Gdnf and Spry1 requires Fgf10. PLoS Genet 6: e1000809,
2010.
47. Moritz KM, Wintour EM, Dodic M. Fetal uninephrectomy leads to
postnatal hypertension and compromised renal function. Hypertension 39:
1071–1076, 2002.
48. Nyengaard JR. Stereologic methods and their application in kidney
research. J Am Soc Nephrol 10: 1100–1123, 1999.
49. Odenwald T, Nakagawa K, Hadtstein C, Roesch F, Gohlke P, Ritz E,
Schaefer F, Schmitt CP. Acute blood pressure effects and chronic
hypotensive action of calcimimetics in uremic rats. J Am Soc Nephrol 17:
655–662, 2006.
50. Piecha G, Kokeny G, Nakagawa K, Koleganova N, Geldyyev A,
Berger I, Ritz E, Schmitt CP, Gross ML. Calcimimetic R-568 or
calcitriol: equally beneficial on progression of renal damage in subtotally
nephrectomized rats. Am J Physiol Renal Physiol 294: F748–F757, 2008.
51. Plank C, Ostreicher I, Hartner A, Marek I, Struwe FG, Amann K,
Hilgers KF, Rascher W, Dotsch J. Intrauterine growth retardation
aggravates the course of acute mesangioproliferative glomerulonephritis in
the rat. Kidney Int 70: 1974–1982, 2006.
52. Plisov SY, Yoshino K, Dove LF, Higinbotham KG, Rubin JS, Peran-
toni AO. TGF beta 2, LIF and FGF2 cooperate to induce nephrogenesis.
Development 128: 1045–1057, 2001.
53. Porter JP, King SH, Honeycutt AD. Prenatal high-salt diet in the
Sprague-Dawley rat programs blood pressure and heart rate hyperrespon-
siveness to stress in adult female offspring. Am J Physiol Regul Integr
Comp Physiol 293: R334–R342, 2007.
54. Priyadarshi S, Valentine B, Han C, Fedorova OV, Bagrov AY, Liu J,
Periyasamy SM, Kennedy D, Malhotra D, Xie Z, Shapiro JI. Effect of
green tea extract on cardiac hypertrophy following 5/6 nephrectomy in the
rat. Kidney Int 63: 1785–1790, 2003.
55. Rothenpieler UW, Dressler GR. Pax-2 is required for mesenchyme-to-
epithelium conversion during kidney development. Development 119:
711–720, 1993.
56. Ryan G, Steele-Perkins V, Morris JF, Rauscher FJ, Dressler GR.
Repression of Pax-2 by WT1 during normal kidney development. Devel-
opment 121: 867–875, 1995.
57. Sanchez MP, Silos-Santiago I, Frisen J, He B, Lira SA, Barbacid M.
Renal agenesis and the absence of enteric neurons in mice lacking GDNF.
Nature 382: 70–73, 1996.
58. Sanders MW, Fazzi GE, Janssen GMJ, Blanco CE, De Mey JGR. High
sodium intake increases blood pressure and alters renal function in
intrauterine growth-retarded rats. Hypertension 46: 71–75, 2005.
59. Schreuder MF, Nauta J. Prenatal programming of nephron number and
blood pressure. Kidney Int 72: 265–268, 2007.
60. Tobian L. Dietary sodium chloride and potassium have effects on the
pathophysiology of hypertension in humans and animals. Am J Clin Nutr
65: 606S–611S, 1997.
61. Torres M, Gomez-Pardo E, Dressler GR, Gruss P. Pax-2 controls
multiple steps of urogenital development. Development 121: 4057–4065, 1995.
62. Vidonho AF Jr, da Silva AA, Catanozi S, Rocha JC, Beutel A, Carillo
BA, Furukawa LN, Campos RR, de Toledo Bergamaschi CM,
Carpinelli AR, Quintao EC, Dolnikoff MS, Heimann JC. Perinatal salt
restriction: a new pathway to programming insulin resistance and dyslip-
idemia in adult Wistar rats. Pediatr Res 56: 842–848, 2004.
63. Villar-Martini VC, Carvalho JJ, Neves MF, Aguila MB, Mandarim-
de-Lacerda CA. Hypertension and kidney alterations in rat offspring from
low protein pregnancies. J Hypertens 27, Suppl 6: S47–S51, 2009.
64. Woods LL, Ingelfinger JR, Nyengaard JR, Rasch R. Maternal protein
restriction suppresses the newborn renin-angiotensin system and programs
adult hypertension in rats. Pediatr Res 49: 460–467, 2001.
65. Woods LL, Rasch R. Perinatal ANG II programs adult blood pressure,
glomerular number, and renal function in rats. Am J Physiol Regul Integr
Comp Physiol 275: R1593–R1599, 1998.
66. Woods LL, Weeks DA, Rasch R. Programming of adult blood pressure
by maternal protein restriction: role of nephrogenesis. Kidney Int 65:
1339–1348, 2004.
F354
SALT AND FETAL PROGRAMMING
AJP-Renal Physiol • VOL 301 • AUGUST 2011 • www.ajprenal.org
on February 4, 2012
ajprenal.physiology.org
Downloaded from