Germ-line mutations in epidermal growth factor receptor (EGFR) are rare but may contribute to oncogenesis: a novel germ-line mutation in EGFR detected in a patient with lung adenocarcinoma.

Abstract

A subset of lung cancer patients harbour EGFR somatic mutations in their tumours and are candidates for treatment with EGFR tyrosine kinase inhibitors. In a few cases EGFR mutations have also been found in the germ line, suggesting a role in lung carcinogenesis. Objetives of this study were: 1) To analyze the EGFR gene mutations in a population diagnosed with lung adenocarcinoma from Northern Spain. 2) To determine the frequency of a new germ-line mutation found in our laboratory as well as the frequency in our population of three other EGFR germ-line mutations detected by other authors. 3) To determine whether the novel mutation detected may have a functional effect on the EGFR protein.
Tumour DNA samples were obtained from frozen or paraffin embedded tumour tissues. Samples of DNA from peripheral blood cells were obtained from 912 individuals with lung cancer recruited from the CAPUA study 12, 477 unrelated healthy donor individuals and 32 individuals with other types of cancer. EGFR gene exons 18 to 21 were studied by direct standard dideoxy sequencing. Specific mutations were determined either by direct sequencing or by specific RFLP analysis. Cell lines were transfected with EGFR-mutant plasmids and analysed by western blot with antibodies specific for total or phosphorylated-EGFR.
We found EGFR mutation in 12 of the 71 tumour samples (17%). One tumour contained two mutations. One mutation (p.R776G) was present as a germ line. Using an RFLP analysis, this mutation was not found in 954 alleles from healthy individuals studied, concluding that it is not a polymorphism. The mutation was not found either in genomic DNA from 912 lung cancer patients. Three additional EGFR germ-line mutations that were already described were not found in any of the studied samples. These observations show that EGFR mutated alleles are rare in the population. In vitro studies revealed that tyrosine autophosphorylation is enhanced in p.R776G-mutant EGFR when compared with wild-type EGFR. This enhanced autophosphorylation in the absence of ligand may be associated with a proliferative advantage.
Germ-line mutations in EGFR are rare but may contribute to oncogenesis.

Full text

Page 1

RESEARCH ARTICLEOpen Access
Germ-line mutations in epidermal growth factor
receptor (EGFR) are rare but may contribute to
oncogenesis: A novel germ-line mutation in EGFR
detected in a patient with lung adenocarcinoma
Irene Centeno1, Pilar Blay2, Iñigo Santamaría1, Aurora Astudillo3,4, Ana S Pitiot1, Fernando G Osorio5,
Patricia González-Arriaga6, Fernando Iglesias1,4, Primitiva Menéndez3, Adonina Tardón6, Jose M Freije5and
Milagros Balbín1*
Abstract
Background: A subset of lung cancer patients harbour EGFR somatic mutations in their tumours and are
candidates for treatment with EGFR tyrosine kinase inhibitors. In a few cases EGFR mutations have also been found
in the germ line, suggesting a role in lung carcinogenesis. Objetives of this study were: 1) To analyze the EGFR
gene mutations in a population diagnosed with lung adenocarcinoma from Northern Spain. 2) To determine the
frequency of a new germ-line mutation found in our laboratory as well as the frequency in our population of three
other EGFR germ-line mutations detected by other authors. 3) To determine whether the novel mutation detected
may have a functional effect on the EGFR protein.
Methods: Tumour DNA samples were obtained from frozen or paraffin embedded tumour tissues. Samples of DNA
from peripheral blood cells were obtained from 912 individuals with lung cancer recruited from the CAPUA study
[1,2], 477 unrelated healthy donor individuals and 32 individuals with other types of cancer. EGFR gene exons 18 to
21 were studied by direct standard dideoxy sequencing. Specific mutations were determined either by direct
sequencing or by specific RFLP analysis. Cell lines were transfected with EGFR-mutant plasmids and analysed by
western blot with antibodies specific for total or phosphorylated-EGFR.
Results: We found EGFR mutation in 12 of the 71 tumour samples (17%). One tumour contained two mutations.
One mutation (p.R776G) was present as a germ line. Using an RFLP analysis, this mutation was not found in 954
alleles from healthy individuals studied, concluding that it is not a polymorphism. The mutation was not found
either in genomic DNA from 912 lung cancer patients. Three additional EGFR germ-line mutations that were
already described were not found in any of the studied samples. These observations show that EGFR mutated
alleles are rare in the population. In vitro studies revealed that tyrosine autophosphorylation is enhanced in p.
R776G-mutant EGFR when compared with wild-type EGFR. This enhanced autophosphorylation in the absence of
ligand may be associated with a proliferative advantage.
Conclusions: Germ-line mutations in EGFR are rare but may contribute to oncogenesis
* Correspondence: mbalbin@hca.es
1Laboratorio de Oncología Molecular, Instituto Universitario de Oncología del
Principado de Asturias, Hospital Universitario Central de Asturias, (Celestino
Villamil s/n), Oviedo, (33006), Spain
Full list of author information is available at the end of the article
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
© 2011 Centeno et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.

Page 2

Background
One of the main goals of cancer research is to find a way
of selecting the appropriate patients for specific therapies.
A promising result regarding lung cancer was the discov-
ery that somatic activating mutations in the tyrosine
kinase domain of the EGFR gene identified a subset of
non-small cell lung cancer (NSCLC) patients that may
respond to tyrosine kinase inhibitors [3-5]. After this
seminal discovery, evidence accumulated in recent years
has supported the idea that patients harbouring these
mutations in their tumours show response to EGFR tyro-
sine kinase inhibitors [6,7]. Based on the results of the
latest phase III trials [8,9] gefitinib, an EGFR tyrosine
kinase inhibitor, has been approved in Europe for first
line treatment of adult patients with locally advanced or
metastatic NSCLC carrying activating EGFR somatic
mutations. Thus, introduction of mutational screening of
somatic mutations into clinical care is already a require-
ment for taking therapeutic decisions [10].
As recorded in the Sanger Institute Catalogue of
Somatic Mutations in Cancer data-base (COSMIC v49
Release) [11,12], curated from the recent literature, a
total of 22489 samples from lung cancer tumours have
been analyzed for EGFR tyrosine kinase domain muta-
tions. The number of samples with mutations is 4722,
with 5055 mutations detected, being p.L858R missense
mutation and in frame-deletions in exon19 the most fre-
quently detected alterations in EGFR. Resequencing stu-
dies provide an opportunity to find novel variants that
may be involved in the activity of the protein, and may
also allow us to find germ line alterations that support
implication of these genes in familial carcinogenesis.
In the course of our EGFR mutational screening in lung
adenocarcinoma patients from the area of Asturias, North-
ern Spain, we found a tumour sample with a double
somatic mutation in EGFR gene; one of the changes was
demonstrated to be present as a germ-line mutation. We
have determined the frequency in our population of the
new germ-line mutation as well as the frequency of three
additional EGFR germ-line mutations described earlier,
and we have investigated the impact of the novel mutation
on the biochemical properties of the EGFR protein.
Methods
Tissue procurement
Lung adenocarcinoma samples were obtained from frozen
or paraffin embedded tumour tissues and their paired nor-
mal tissues deposited in the Tumour Bank of Hospital
Universitario Central de Asturias (HUCA). Samples were
evaluated for tumour content prior to use for nucleic acid
extraction. RNA and DNA were purified using Trizol
method (Invitrogen) following manufacturer’s instructions.
In addition, genomic DNA was obtained from peripheral
blood cells of 912 individuals with lung cancer recruited
from the CAPUA study [1,2], 477 unrelated healthy donor
individuals aged 21-65 years recruited through the Blood
Bank of HUCA and 32 individuals with other types of can-
cer. All samples were obtained with informed consent.
The study was approved by the ethical committee of the
hospital and the research was done conformed to the
Helsinki Declaration.
Mutational analyses
EGFR exons 18 to 21 were amplified from genomic
DNA and EGFR tyrosine kinase domain was amplified
from cDNA when possible. Standard sequencing PCR
was set up with kit Big Dye Terminator®v1.1 (Applied
Biosystems) and analyzed in an ABIPrism310 (Applied
Biosystems). Primers used for the different PCRs are
listed in Table 1.
Detection of specific mutations in EGFR exons 20 and 21
EGFR exon 20 p.R776G mutation and exon 21 p.V843I
and p.P848L were detected by specific RFLP analysis
since nucleotide changes affect restriction sites for
HaeIII, RsaI and PstI respectively. All restriction frag-
ments were visualized on a 2% agarose gel. If no match-
ing restriction enzyme could be found, samples were
analyzed by direct sequencing. In addition, high sensibil-
ity mutation detection methods were also developed to
perform a mutational screening study for the most fre-
quent EGFR activating mutations. Briefly, an EGFR exon
19 hot spot region was amplified from 50 ng of genomic
DNA using primers 13 and 14 (Table 1). A 24 cycle-
PCR was done in standard conditions with 10 μmol of
Table 1 Primers used for EGFR PCR analysis
OligonucleotideSequence 5’ to 3’
1 (EGFR Exon 18R)
2 (EGFR Exon 19R)
3 (EGFR Exon 20F)
4 (EGFR Exon 20R)
5 (EGFR Exon 18F)
6 (EGFR Exon 19F2)
7 (EGFR Exon cDNA)
8 (EGFR Exon cDNA)
9 (EGFR Exon 21F2)
10 (EGFR Exon 21R2)
11 (EGFR Exon 20F)
12 (EGFR Exon 20F)
13 (EGFR Exon 19F)
14 (EGFR Exon 19R FAM*)
15 (EGFR Exon cDNA)
16 (EGFR Exon 21R Hex*)
17 (EGFR Exon 21 ASO L858R)
TCCCCACCAGACCATGAGAG
GAGGTTCAGAGCCATGGACC
CCATGAGTACGTATTTTGAAACTC
CATATCCCCATGGCAAACTCTTGC
CCTGCTGGGCCATGTCTGGC
GTGCATCGCTGGTAACATCC
CGAAGGCGCCACATCGTTC
GAGGAGATCTCGCTGGCAG
CCTGGCATGAACATGACCC
AATACAGCTAGTGGGAAGGC
GTGGAGGTGAGGCAGATGCC
GCGAAGCCACACTGACGTG
CCTGAGGTTCAGAGCCATGG
*GGACTCTGGATCCCAGAAGG
GAGGACCGTCGCTTGGTGCA
*CAATACAGCTAGTGGGAAG
CAAGATCACAGATTTTGGACG
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 2 of 8

Page 3

fluorescent reverse primer and 20 μmol of the direct
one, in a final volume of 50 μL. Products were analyzed
through capillary electrophoresis in an automatic
sequencer ABIPrism310 (Applied Biosystems) and soft-
ware GenMapper. For detection of the p.L858R muta-
tion, an allele specific oligonucleotide multiple PCR was
performed. Primers 15 and 16 amplify the region
encompassing the mutation; the reverse primer is
marked with 5’HEX. Primer 17 is 858R allele-specific. A
multiple 26-cycle PCR was done in standard conditions
using 10 μmol of direct and reverse primers and 40
μmol of the allele-specific primer, in a final volume of
50 μL. Products were analyzed through capillary electro-
phoresis the same way as exon 19 deletions.
Construction of expression vectors encoding mutant EGFR
Vectors for mammalian expression containing human
EGFR were kindly donated by W. Pao (Memorial Sloan-
Kettering Cancer Center, NY). Plasmids containing p.
R776G mutation were constructed by inserting a BstXI
fragment obtained by PCR amplification of an EGFR seg-
ment from a cDNA carrying this mutation into a BstXI-
digested pcDNA3-EGFR vector. All constructs were fully
sequenced to confirm the absence of unwanted additional
mutations in the EGFR region.
Cell transfections and western blot analysis
HEK293T and COS-7 cells were transiently transfected,
using Lipofectamine™ LTX with PLUS™ (Invitrogen),
with the indicated plasmids and with a vector containing
the green fluorescent protein to check transfection effi-
ciency by fluorescence microscopy. Forty-eight hours after
transfection, lysates of these cells were used to quantify
levels of phosphorylated EGFR. Total cell protein, extracted
using RIPA buffer, were resolved by SDS-PAGE (8%) in
parallel duplicated gels, transferred to nitrocellulose mem-
branes and incubated with primary antibody ((Phospho-
EGFR Tyr-1045, or total EGFR; Cell Signalling Technology)
diluted 1/1000 in 5% BSA in TBS-T overnight at 4°C. Load-
ing control gels were run in additional electrophoresis gels,
blotted to nitrocellulose membrane and incubated with
antibodies to beta-actin. Membranes incubated with pri-
mary antibody were washed and incubated 1 hour at RT
with peroxidase labelled goat antirabbit antibody 1/2000
diluted in TBS-T containing 5% non-fat milk. Signals were
visualized with ECL system (Amersham Biosciences) and
lumino-image analyzer LAS3000 (Fujifilm), following the
manufacturer’s instructions.
Results
Analysis of EGFR gene mutations in a lung cancer
population from Northern Spain
We selected a group of 62 frozen lung adenocarcinomas
and their corresponding normal matching tissue from
patients that were subjected to surgery from years 2001
to 2006 at HUCA and completely sequenced EGFR
exons 18 to 21. In addition, 9 samples from transbron-
chial biopsies were also analyzed for mutational status
of the EGFR Tyrosine kinase domain. Results of the
detected mutations are shown in Table 2. The obtained
results showed mutation in 12 of the 71 tumour samples
(17%), one of which contained two mutations. Regarding
smoking status, gender and mutation presence, 7 out of
13 detected mutations were found in lung tumours from
women; 6 of them were non smokers and the remaining
one was a former smoker. In the male group, 6 muta-
tions were detected, 4 of which corresponded to non
smokers and the 2 remaining mutations were detected
in the same patient, a smoker male. Therefore, in our
cohort, EGFR mutations are more frequent in women
and patients who have never smoked, as reported in
previous studies [13].
Detection of a novel germ-line mutation and population
frequency study
One of the tumour samples harboured two coexistent
EGFR mutations c.2326C > G p.R776G in exon 20 and
c.2573T > G p.L858R in exon 21. Analysis of matched
non tumoral tissue and available DNA from peripheral
blood revealed that one of the mutations (p.R776G) was
present as a germ-line alteration, since it was present
both in the tumoral and non tumoral tissue as well as in
genomic DNA obtained from peripheral blood. This sam-
ple belonged to a 47 year-old man with a 50 pack-year
smoking history, who was diagnosed with a stage IIIA
(pT3N2M0) undifferenciated lung adenocarcinoma. He
was initially treated with surgery, but died of metastatic
disease one year later. Genealogical information of this
patient revealed that one of his siblings died of cancer
but unfortunately no samples were available to study and
no other healthy family members were requested to be
analyzed, for ethical reasons.
To determine if this germ-line mutation was a poly-
morphism present in the population, we analysed 477
available healthy donor individuals using a RFLP analysis
with HaeIII restriction enzyme. The mutation was not
found in 954 alleles from control individuals studied. We
also searched for the presence of this mutation in genomic
DNA from another group of 912 lung cancer patients, 285
of them with familial cancer history and a cohort of 32
patients with other types of cancer. We did not find any
additional sample harbouring the p.R776G EGFR mutation
as a germ-line alteration, so it can be concluded that
p.R776G mutation is a rare event.
Three more EGFR germ-line mutations have been
recently described: p.T790M [14,15] in exon 20, and
p.V843I and p.P848L in exon 21 [16,17]. We analyzed the
frequency of these germ-line mutations in a set of 285
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 3 of 8

Page 4

samples of our group from NSCLC patients with familial
cancer antecedents. Table 3 shows the samples analyzed
for each mutation. None of these mutations were
detected in our studied population, neither the control
population nor the group of samples from lung cancer
patients. It can be concluded that p.R776G, as well as
p.T790M, p.V843I and p.P848L are rare mutant EGFR
alleles.
In vitro EGFR p.R776G analysis
To determine if both EGFR alleles were affected in the
tumour sample where a double mutation was found, we
first determined if both mutations were located in cis or
in trans. Figure 1 depict the strategy developed to deter-
mine if p.R776G and p.L858R were located in the same
strand of DNA. Thus, taking into account that c.2326C
> G mutation causing p.R776G amino acid change gen-
erates a new HaeIII restriction site, when an exon 21
PCR fragment containing these mutations was digested
with HaeIII, two different bands could be distinguished
from the heterozygous tumour sample: one 276 bp frag-
ment (wt for p.R776) and one 248 bp fragment (mutated
for p.R776G). Sequence analysis of both fragments
revealed that the base change yielding an Arg at position
858 was present in the same band as the mutation yield-
ing Gly at position 776. It was concluded then that both
mutations were located in cis, that is, they occurred in
the same allele.
EGFR mutant vector constructions were performed
based on a pcDNA3.1 plasmid containing human wild-
type EGFR cDNA; the EGFR tyrosine kinase domain
was replaced with the corresponding p.R776G mutant
variant and the resultant construction was used to trans-
fect 293EBNA and COS7 cells. Forty-eight hours after
transfection cell lysates were analyzed by western blot
using primary antibodies anti Phospho-EGFR. In vitro
analyses showed that in the absence of ligand (EGF), an
enhanced tyrosine autophosphorylation can be observed
in cells transfected with the plasmid containing EGFR-
R776G when compared to those transfected with wild-
type EGFR (Figure 2).
Discussion
In recent years, mutational screening and re-sequencing
of potential oncogenes in tumours allowed the identifi-
cation of hot spots for mutations and also new genes
not previously involved in tumour genesis [12,18]. Iden-
tification of somatic mutations in exons coding for tyro-
sine kinase domain of EGFR in tumours from patients
with NSCLC and their association with response with
targeted therapies, has led to the introduction of muta-
tional screening of tumours in the clinic. A substantial
number of tumours have already been studied and in
addition to somatic mutations, few germ line mutations
have been found.
In this work we have described the identification of a
new germ line mutation p.R776G in EGFR in a patient suf-
fering from NSCLC. In order to rule out that this muta-
tion could be a polymorphism, we analysed 954 alleles
from healthy donors and did not find this variation. In
addition, we have searched for the presence of this muta-
tion in 285 genomic DNA samples from patients with
lung cancer and some history of familial cancer, and 627
samples from patients with lung cancer and no familial
Table 2 Distribution of EGFR somatic mutation’s frequency from lung adenocarcinoma tissues and transbronchial
biopsies, depending on gender and smoking condition
EGFR mutations
Sex Smoking statusExon 19Exon 20 Exon 21
Male (n = 55) Yes (n = 47)
1 (p.R776G)
1 (p.L858R)
No (n = 8)
2 (p.E746_A750del)
1 (p.E746_S752del)
1 (p.L858R)
Female (n = 16)Yes (n = 7)
1 (p.E746_A750del)
No (n = 9)
2 (p.E746_T751del)
1 (p.E746_S752delinsV)
1 (p.D761_E762insEAFQ)
2 (p.L858R)
Table 3 Number of patients analyzed for p.R776G, p.T790M, p.V843I and p.P848L mutation presence in genomic DNA
Analyzed samples
Mutation NSCLC + FCH + SSNSCLC + FCH + NSS NSCLC + NFCH + SSNSCLC + NFCH + NSSOther Healthy donorsTotal
p.R776G
p.T790M
p.V843I
p.P858L
268
268
268
268
17
17
17
17
59631 32477
1421
285
316
316
31
31
NSCLC: non small cell lung cancer; FCH: familiar cancer history; NFCH: no familiar cancer history; SS: smoking status; NSS: non smoking status; Other: patients
with other types of cancer.
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 4 of 8

Page 5

????????
????????
????????
248 bp fragment
sequencing
?????????????? ??? ??????? ?????? ??????
???????? ????? ?? ?????? ???? ??????????????
HaeIII
55 bp
?? ??????
????? ??????
276 bp 199 bp
199 bp 248 bp
28 bp
HaeIII digestion
HaeIII
HaeIII HaeIII
HaeIII
55 bp
????
????
?????????????
?????
HaeIII HaeIII
HaeIII
????
???
???
????
T T G G G C G
G G
Figure 1 Strategy developed to resolve if p.R776G and p.L858R were located in cis. Taking into account that c.2326C > G mutation
causing p.R776G amino acid change generates a new HaeIII restriction site, when an exon 21 PCR fragment containing these mutations was
digested with HaeIII, two different bands could be distinguished from the heterozygous tumour sample: one 276 bp fragment (wt for the
position c.2326) and one 248 bp fragment (mutated at this position). Sequence analysis of 248 bp fragment revealed that the p.L858R mutation
was present in the same band as the p.R776G mutation.
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 5 of 8

Page 6

cancer antecedents. We have not found this mutation in
any other patient. Three other germ line mutations in
EGFR have been described: the first is p.T790M, that has
been found in at least five families [14,15,19,20], p.V843I,
described in two cases [17,21] and p.P848L [22]. It is inter-
esting to mention that p.T790M was the first mutation in
NSCLC associated with resistance to therapy with tyrosine
kinase inhibitors [23-25]. We also studied if these muta-
tions were present in our cohort of individuals with lung
cancer and familial history of cancer but we did not find
any of them. Moreover, the sequencing of the entire exon
20 of EGFR did not reveal any other alteration in this
gene. Vikis et al [26] also analyzed a number of families
with high susceptibility to lung cancer for the presence of
p.T790M mutation and did not find this alteration in any
of 237 probands. Girard et al [20] found p.T790M as
germ-line in 2 of 369 cases of never smokers with NSCLC,
both patients with a family history significant for lung can-
cer. Concerning p.V843I and p.P848L no studies with a
large group of samples was performed previously to the
present work. From these results, we can conclude that p.
R776G, p.T790M, p.V843I and p.P848L are rare EGFR
alleles that have been found in germ line from patients
suffering lung cancer.
Regarding the possibility that these mutations can
represent cancer susceptibility alleles, several studies
have been performed on p.T790M allele (reviewed by
Suda et al [27]). Its detection as a somatic mutation in
tumours supports this option. Moreover, this mutation
has also been found together with the activating p.L858R
mutation, both in tumours and in cell lines that never
were in contact with tyrosine kinase inhibitor treatments,
suggesting that p.T790M might be also growth promot-
ing. Bell et al [14] observed that this mutation seems to
occur in cis with the p.L858R activating mutation. Kinase
activity of EGFR p.T790M mutant has been reported as
indistinguishable from wild-type EGFR [23,25], but Vikis
et al [26] reported that p.T790M mutation alone causes
increased phosphorylation levels. Godin-Heymann et al
have shown that, although p.T790M mutation has a
moderate effect on EGFR function, when combined with
p.L858R or p.746_750del show a remarkable enhance-
ment of EGFR activity [28]. Finally, animal models gener-
ated to inducibly express the p.T790M mutation have
been also shown to develop lung tumours [29]. The
latency of developing tumours is longer in those mice
with p.T790M mutation alone than those bearing both
p.T790M and p.L858R.
In relation to p.R776G, the novel germ line mutation
revealed in this work, some lines of evidence similar to the
p.T790M mutation would also support its possible role as
a cancer susceptibility allele. Mutations at this position in
the EGFR gene have also been discovered in tumours as
somatic mutations [30]. In the tumour sample analyzed in
this work, the p.R776G mutation was found together with
a p.L858R activating somatic mutation in cis. A double
mutation p.R776G/p.L858R was found by Wu et al [30]
and the patient harbouring these two mutations did not
respond to tyrosine-kinase inhibitor therapy. Alterations at
R776 position giving rise to a different amino acid substi-
tution (p.R776C) have also been described as somatic
mutations and in conjunction with p.L858R [5,31]. Preli-
minary studies by transfection of cell lines with EGFR
mutant constructs revealed that in the absence of ligand
(EGF), an enhanced tyrosine autophosphorylation can be
observed in cells harbouring the plasmid containing
EGFR-R776G when compared with wild-type EGFR, pro-
viding biochemical evidence of the functional relevance of
this mutation.
Further analysis encompassing single and double
mutant constructs will help to clarify the role of these
alterations on EGFR function and in tumour genesis. It is
tempting to speculate that, since p.R776G has appeared
as germ-line mutation, it would have a weaker effect on
EGFR functions than the double mutations detected
within the tumours. Functional analyses of these mutants
need to be evaluated by cellular assays, for example with
tagged constructs [32], by transformation assays and by
P-EGFR
(Tyr1045)
EGFR
COS-7
WT
-
WT
+
R776G
-
R776G
+
EGF
293 EBNA
P-EGFR
(Tyr1045)
WT
-
WT
+
R776G
-
R776G
+
EGF
EGFR
?-Actin
?-Actin
Figure 2 Anti-Phospho-EGFR immunoblot analysis. COS-7 and
293 EBNA cells were transiently transfected as described. All EGFR
constructs are expressed at similar levels. EGFR activity (phospho-
EGFR level) is increased in p.R776G mutant, both in presence or in
absence of ligand.
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 6 of 8

Page 7

tumorigenicity studies in animal models. It will also be
interesting to test the sensibility of these mutants to TK
inhibitors in order to gain information of clinical value.
Mutations in genes coding for proteins with tyrosine
kinase activity have been one of the genetic alterations
most frequently detected in cancer over the last years
[33]. Pathways activated by these proteins usually lead to
proliferative advantages, thus they have received much
consideration, given their association with malignant pro-
liferation. Regarding the role of receptor tyrosine kinase
alterations in familial carcinogenesis, germ line mutations
in KIT have been described in familial gastrointestinal
stromal tumours (GIST), RET mutations are involved
familial medullary thyroid cancers and other endocrine
cancer predisposition syndromes and MET mutations
have been found in papillary renal cancer syndrome
among others [34]. Somatic mutations in these genes
have also been described in sporadic tumours and in the
case of GIST, activating mutations in KIT are predictors
of response to targeted therapy with imatinib [35-37].
Taking these examples as precedent, it is reasonable to
hypothesize that germ-line mutations in the EGFR gene
could be involved in lung cancer pathogenesis, and
probably in other tumours in whose development EGFR
deregulation can play a role. Although there have been
reported some evidences of mendelian inheritance in
the pathogenesis of lung cancer [38], the intrinsic
genetic factors controlling susceptibility to this malig-
nancy might be hidden by strong environmental factors
like cigarette smoking and air pollution, implicated in
the mutagenesis of many other genes controlling path-
ways involved in the development of these tumours
[18,39].
More studies are needed in large cohorts of cancer
patients with familiar history of cancer in order to link
EGFR germ-line mutations to development of the dis-
ease, but these results and precedent observations do
suggest that EGFR is a candidate to be involved in
familial oncogenesis.
Conclusions
Germ-line mutations in EGFR gene are rare but may
contribute to oncogenesis.
Acknowledgements
This work was supported by grants from Fundación Mutua Madrileña and
Fundación Caja Rural de Asturias. We thank Dr. C. López-Otín (Dept. of
Biochemistry and Molecular Biology, University of Oviedo) and Dr. C. Suarez-
Nieto (Instituto Universitario de Oncología del Principado de Asturias IUOPA)
for support and advice, Dr. M.V. Alvarez (Laboratory of Genetics, Hospital
Universitario Central de Asturias) for genomic DNA samples from unrelated
healthy individuals and Dr. W. Pao (Memorial Sloan-Kettering Cancer Center,
NY) for EGFR-containing mammalian expression plasmids. A.T. is member of
Centro de Investigación Biomédica en Red (CIBER) de Epidemiología y Salud
Pública. IUOPA is supported by RTICC and Obra Social Cajastur.
Author details
1Laboratorio de Oncología Molecular, Instituto Universitario de Oncología del
Principado de Asturias, Hospital Universitario Central de Asturias, (Celestino
Villamil s/n), Oviedo, (33006), Spain.2Unidad de Cáncer Familiar, Servicio de
Oncología Médica, Instituto Universitario de Oncología del Principado de
Asturias, Hospital Universitario Central de Asturias, (Celestino Villamil s/n),
Oviedo, (33006), Spain.3Servicio de Anatomía Patológica, Hospital
Universitario Central de Asturias, (Celestino Villamil s/n), Oviedo, (33006),
Spain.4Banco de Tumores, Instituto Universitario de Oncología del
Principado de Asturias, Hospital Universitario Central de Asturias. (Celestino
Villamil s/n), Oviedo, (33006), Spain.5Departamento de Bioquímica y Biología
Molecular, Instituto Universitario de Oncología del Principado de Asturias,
Universidad de Oviedo, (Campus del Cristo), Oviedo, (33006), Spain.6Unidad
de Epidemiología Molecular, Instituto Universitario de Oncología del
Principado de Asturias, Facultad de Medicina, Universidad de Oviedo,
(Campus del Cristo), Oviedo, (33006), Spain.
Authors’ contributions
IC: carried out mutational analysis, genetic studies and plasmid
constructions. PB: participated in design of the study, analysis of clinical data
and helped in draft the manuscript. AA, PM: performed pathological review
and selections of all tumour samples and analyses of clinical data. IS, ASP, FI:
participated in mutational analysis. FGO, JMF: carried out transfections and
western blot analyses and participated in review of the manuscript. PGA, AT:
provided samples and clinical data. MB: designed the study and drafted the
manuscript. All authors approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: 7 December 2010 Accepted: 16 May 2011
Published: 16 May 2011
References
1.Fernandez-Rubio A, Lopez-Cima MF, Gonzalez-Arriaga P, Garcia-Castro L,
Pascual T, Marron MG, Tardon A: The TP53 Arg72Pro polymorphism and
lung cancer risk in a population of Northern Spain. Lung Cancer 2008,
61(3):309-316.
2.Lopez-Cima MF, Gonzalez-Arriaga P, Garcia-Castro L, Pascual T, Marron MG,
Puente XS, Tardon A: Polymorphisms in XPC, XPD, XRCC1, and XRCC3
DNA repair genes and lung cancer risk in a population of northern
Spain. BMC Cancer 2007, 7:162.
3.Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA,
Brannigan BW, Harris PL, Haserlat SM, Supko JG, Haluska FG, Louis DN,
Christiani DC, Settleman J, Haber DA: Activating mutations in the
epidermal growth factor receptor underlying responsiveness of non-
small-cell lung cancer to gefitinib. N Engl J Med 2004, 350(21):2129-2139.
4.Paez JG, Janne PA, Lee JC, Tracy S, Greulich H, Gabriel S, Herman P, Kaye FJ,
Lindeman N, Boggon TJ, Naoki K, Sasaki H, Fujii Y, Eck MJ, Sellers WR,
Johnson BE, Meyerson M: EGFR mutations in lung cancer: correlation with
clinical response to gefitinib therapy. Science 2004, 304(5676):1497-1500.
5.Pao W, Miller V, Zakowski M, Doherty J, Politi K, Sarkaria I, Singh B, Heelan R,
Rusch V, Fulton L, Mardis E, Kupfer D, Wilson R, Kris M, Varmus H: EGF
receptor gene mutations are common in lung cancers from “never
smokers” and are associated with sensitivity of tumors to gefitinib and
erlotinib. Proc Natl Acad Sci USA 2004, 101(36):13306-13311.
6.Sequist LV, Engelman JA, Lynch TJ: Toward noninvasive genomic
screening of lung cancer patients. J Clin Oncol 2009, 27(16):2589-2591.
7.Sharma SV, Bell DW, Settleman J, Haber DA: Epidermal growth factor
receptor mutations in lung cancer. Nat Rev Cancer 2007, 7(3):169-181.
8. Mitsudomi T, Morita S, Yatabe Y, Negoro S, Okamoto I, Tsurutani J, Seto T,
Satouchi M, Tada H, Hirashima T, Asami K, Katakami N, Takada M,
Yoshioka H, Shibata K, Kudoh S, Shimizu E, Saito H, Toyooka S, Nakagawa K,
Fukuoka M: Gefitinib versus cisplatin plus docetaxel in patients with non-
small-cell lung cancer harbouring mutations of the epidermal growth
factor receptor (WJTOG3405): an open label, randomised phase 3 trial.
The lancet oncology 11(2):121-128.
9.Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N,
Sunpaweravong P, Han B, Margono B, Ichinose Y, Nishiwaki Y, Ohe Y,
Yang JJ, Chewaskulyong B, Jiang H, Duffield EL, Watkins CL, Armour AA,
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 7 of 8

Page 8

Fukuoka M: Gefitinib or carboplatin-paclitaxel in pulmonary
adenocarcinoma. N Engl J Med 2009, 361(10):947-957.
Pirker R, Herth FJ, Kerr KM, Filipits M, Taron M, Gandara D, Hirsch FR,
Grunenwald D, Popper H, Smit E, Dietel M, Marchetti A, Manegold C,
Schirmacher P, Thomas M, Rosell R, Cappuzzo F, Stahel R: Consensus for
EGFR mutation testing in non-small cell lung cancer: results from a
European workshop. J Thorac Oncol 2010, 5(10):1706-1713.
Bamford S, Dawson E, Forbes S, Clements J, Pettett R, Dogan A, Flanagan A,
Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of
Somatic Mutations in Cancer) database and website. Br J Cancer 2004,
91(2):355-358.
Forbes SA, Bindal N, Bamford S, Cole C, Kok CY, Beare D, Jia M, Shepherd R,
Leung K, Menzies A, Teague JW, Campbell PJ, Stratton MR, Futreal PA:
COSMIC: mining complete cancer genomes in the Catalogue of Somatic
Mutations in Cancer. Nucleic Acids Res 2010.
Rosell R, Moran T, Queralt C, Porta R, Cardenal F, Camps C, Majem M,
Lopez-Vivanco G, Isla D, Provencio M, Insa A, Massuti B, Gonzalez-Larriba JL,
Paz-Ares L, Bover I, Garcia-Campelo R, Moreno MA, Catot S, Rolfo C,
Reguart N, Palmero R, Sanchez JM, Bastus R, Mayo C, Bertran-Alamillo J,
Molina MA, Sanchez JJ, Taron M: Screening for epidermal growth factor
receptor mutations in lung cancer. N Engl J Med 2009, 361(10):958-967.
Bell DW, Gore I, Okimoto RA, Godin-Heymann N, Sordella R, Mulloy R,
Sharma SV, Brannigan BW, Mohapatra G, Settleman J, Haber DA: Inherited
susceptibility to lung cancer may be associated with the T790M drug
resistance mutation in EGFR. Nat Genet 2005, 37(12):1315-1316.
Prudkin L, Tang X, Wistuba II: Germ-line and somatic presentations of the
EGFR T790M mutation in lung cancer. J Thorac Oncol 2009, 4(1):139-141.
Sequist LV, Joshi VA, Janne PA, Bell DW, Fidias P, Lindeman NI, Louis DN,
Lee JC, Mark EJ, Longtine J, Verlander P, Kucherlapati R, Meyerson M,
Haber DA, Johnson BE, Lynch TJ: Epidermal growth factor receptor
mutation testing in the care of lung cancer patients. Clin Cancer Res
2006, 12(14 Pt 2):4403s-4408s.
Ikeda K, Nomori H, Mori T, Sasaki J, Kobayashi T: Novel germline mutation:
EGFR V843I in patient with multiple lung adenocarcinomas and family
members with lung cancer. Ann Thorac Surg 2008, 85(4):1430-1432.
Ding L, Getz G, Wheeler DA, Mardis ER, McLellan MD, Cibulskis K,
Sougnez C, Greulich H, Muzny DM, Morgan MB, Fulton L, Fulton RS,
Zhang Q, Wendl MC, Lawrence MS, Larson DE, Chen K, Dooling DJ, Sabo A,
Hawes AC, Shen H, Jhangiani SN, Lewis LR, Hall O, Zhu Y, Mathew T, Ren Y,
Yao J, Scherer SE, Clerc K, et al: Somatic mutations affect key pathways in
lung adenocarcinoma. Nature 2008, 455(7216):1069-1075.
Tibaldi C, Giovannetti E, Vasile E, Boldrini L, Gallegos-Ruiz MI, Bernardini I,
Incensati R, Danesi R, Cappuzzo F, Peters GJ, Fontanini G: Inherited
germline T790M mutation and somatic epidermal growth factor
receptor mutations in non-small cell lung cancer patients. J Thorac Oncol
2011, 6(2):395-396.
Girard N, Lou E, Azzoli CG, Reddy R, Robson M, Harlan M, Orlow I, Yatabe Y,
Nafa K, Ladanyi M, Viale A, Kris MG, Riely G, Miller V, Klein RJ, Matsuo K,
Pao W: Analysis of genetic variants in never-smokers with lung cancer
facilitated by an Internet-based blood collection protocol: a preliminary
report. Clin Cancer Res 2011, 16(2):755-763.
Ohtsuka K, Ohnishi H, Kurai D, Matsushima S, Morishita Y, Shinonaga M,
Goto H, Watanabe T: Familial Lung Adenocarcinoma Caused by the EGFR
V843I Germ-Line Mutation. J Clin Oncol 2011, 29(8):e191-192.
Sequist LV, Dziadziuszko R: Update on epidermal growth factor receptor
inhibitor development in lung cancer. J Thorac Oncol 2006, 1(7):740-743.
Kobayashi S, Ji H, Yuza Y, Meyerson M, Wong KK, Tenen DG, Halmos B: An
alternative inhibitor overcomes resistance caused by a mutation of the
epidermal growth factor receptor. Cancer Res 2005, 65(16):7096-7101.
Kwak EL, Sordella R, Bell DW, Godin-Heymann N, Okimoto RA,
Brannigan BW, Harris PL, Driscoll DR, Fidias P, Lynch TJ, Rabindran SK,
McGinnis JP, Wissner A, Sharma SV, Isselbacher KJ, Settleman J, Haber DA:
Irreversible inhibitors of the EGF receptor may circumvent acquired
resistance to gefitinib. Proc Natl Acad Sci USA 2005, 102(21):7665-7670.
Pao W, Miller VA, Politi KA, Riely GJ, Somwar R, Zakowski MF, Kris MG,
Varmus H: Acquired resistance of lung adenocarcinomas to gefitinib or
erlotinib is associated with a second mutation in the EGFR kinase
domain. PLoS Med 2005, 2(3):e73.
Vikis H, Sato M, James M, Wang D, Wang Y, Wang M, Jia D, Liu Y, Bailey-
Wilson JE, Amos CI, Pinney SM, Petersen GM, de Andrade M, Yang P,
Wiest JS, Fain PR, Schwartz AG, Gazdar A, Gaba C, Rothschild H, Mandal D,
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Kupert E, Seminara D, Viswanathan A, Govindan R, Minna J, Anderson MW,
You M: EGFR-T790M is a rare lung cancer susceptibility allele with
enhanced kinase activity. Cancer Res 2007, 67(10):4665-4670.
Suda K, Onozato R, Yatabe Y, Mitsudomi T: EGFR T790M mutation: a
double role in lung cancer cell survival? J Thorac Oncol 2009, 4(1):1-4.
Godin-Heymann N, Bryant I, Rivera MN, Ulkus L, Bell DW, Riese DJ,
Settleman J, Haber DA: Oncogenic activity of epidermal growth factor
receptor kinase mutant alleles is enhanced by the T790M drug
resistance mutation. Cancer Res 2007, 67(15):7319-7326.
Regales L, Balak MN, Gong Y, Politi K, Sawai A, Le C, Koutcher JA, Solit DB,
Rosen N, Zakowski MF, Pao W: Development of new mouse lung tumor
models expressing EGFR T790M mutants associated with clinical
resistance to kinase inhibitors. PLoS One 2007, 2(8):e810.
Wu JY, Wu SG, Yang CH, Gow CH, Chang YL, Yu CJ, Shih JY, Yang PC: Lung
cancer with epidermal growth factor receptor exon 20 mutations is
associated with poor gefitinib treatment response. Clin Cancer Res 2008,
14(15):4877-4882.
Kosaka T, Yatabe Y, Endoh H, Kuwano H, Takahashi T, Mitsudomi T:
Mutations of the epidermal growth factor receptor gene in lung cancer:
biological and clinical implications. Cancer Res 2004, 64(24):8919-8923.
de Gunst MM, Gallegos-Ruiz MI, Giaccone G, Rodriguez JA: Functional
analysis of cancer-associated EGFR mutants using a cellular assay with
YFP-tagged EGFR intracellular domain. Mol Cancer 2007, 6:56.
Stratton MR, Campbell PJ, Futreal PA: The cancer genome. Nature 2009,
458(7239):719-724.
Garber JE, Offit K: Hereditary cancer predisposition syndromes. J Clin
Oncol 2005, 23(2):276-292.
Demetri GD, von Mehren M, Blanke CD, Van den Abbeele AD, Eisenberg B,
Roberts PJ, Heinrich MC, Tuveson DA, Singer S, Janicek M, Fletcher JA,
Silverman SG, Silberman SL, Capdeville R, Kiese B, Peng B, Dimitrijevic S,
Druker BJ, Corless C, Fletcher CD, Joensuu H: Efficacy and safety of
imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J
Med 2002, 347(7):472-480.
Heinrich MC, Corless CL, Demetri GD, Blanke CD, von Mehren M,
Joensuu H, McGreevey LS, Chen CJ, Van den Abbeele AD, Druker BJ,
Kiese B, Eisenberg B, Roberts PJ, Singer S, Fletcher CD, Silberman S,
Dimitrijevic S, Fletcher JA: Kinase mutations and imatinib response in
patients with metastatic gastrointestinal stromal tumor. J Clin Oncol
2003, 21(23):4342-4349.
Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, Ishiguro S,
Kawano K, Hanada M, Kurata A, Takeda M, Muhammad Tunio G,
Matsuzawa Y, Kanakura Y, Shinomura Y, Kitamura Y: Gain-of-function
mutations of c-kit in human gastrointestinal stromal tumors. Science
1998, 279(5350):577-580.
Sellers TA, Bailey-Wilson JE, Elston RC, Wilson AF, Elston GZ, Ooi WL,
Rothschild H: Evidence for mendelian inheritance in the pathogenesis of
lung cancer. J Natl Cancer Inst 1990, 82(15):1272-1279.
Pleasance ED, Stephens PJ, O-Meara S, McBride DJ, Meynert A, Jones D,
Lin ML, Beare D, Lau KW, Greenman C, Varela I, Nik-Zainal S, Davies HR,
Ordonez GR, Mudie LJ, Latimer C, Edkins S, Stebbings L, Chen L, Jia M,
Leroy C, Marshall J, Menzies A, Butler A, Teague JW, Mangion J, Sun YA,
McLaughlin SF, Peckham HE, Tsung EF, et al: A small-cell lung cancer
genome with complex signatures of tobacco exposure. Nature
463(7278):184-190.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2407/11/172/prepub
doi:10.1186/1471-2407-11-172
Cite this article as: Centeno et al.: Germ-line mutations in epidermal
growth factor receptor (EGFR) are rare but may contribute to
oncogenesis: A novel germ-line mutation in EGFR detected in a patient
with lung adenocarcinoma. BMC Cancer 2011 11:172.
Centeno et al. BMC Cancer 2011, 11:172
http://www.biomedcentral.com/1471-2407/11/172
Page 8 of 8