Insulin-like growth factor-binding protein-3 suppresses tumor growth via activation of caspase-dependent apoptosis and cross-talk with NF-κB signaling

Department of Pathology, Medical College of Virginia Campus, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23298-0662, USA.
Cancer letters (Impact Factor: 5.62). 08/2011; 307(2):200-10. DOI: 10.1016/j.canlet.2011.04.004
Source: PubMed


Nuclear factor-kappaB (NF-κB) is constitutively activated in a variety of human cancers including prostate cancer and involved in tumorigenesis, tumor progression and chemo-resistance. Insulin-like growth factor-binding protein-3 (IGFBP-3) is a potent tumor suppressor and is significantly suppressed in a variety of cancers. Diverse biological effects of IGFBP-3 have been reported to be both dependent and independent of the IGF/IGF-I receptor (IGF-IR) axis. The precise underlying mechanisms of IGF/IGF-IR-independent, antiproliferative actions of IGFBP-3 are yet to be elucidated. We found an inverse correlation between NF-κB activity and IGFBP-3 expression during prostate cancer progression using an in vitro prostate cancer progression model. Restoration of IGFBP-3 resulted in significant inhibition of constitutively elevated NF-κB activity in prostate cancer cells. IGFBP-3 further inhibited the expression of NF-κB-regulated angiogenic factors such as VEGF and IL-8, and cell adhesion molecules, ICAM-1 and VCAM-1. This inhibitory action of IGFBP-3 was IGF/IGF-IR-independent since IGFBP-3 mutant devoid of IGF binding affinity had a similar inhibitory effect. We identified that IGFBP-3 degrades the key NF-κB regulatory molecules-IκBα and p65-NF-κB proteins through activation of caspase-8 and -3/-7, thereby inhibiting elevated NF-κB activity in prostate cancer. Finally intratumoral administration of IGFBP-3 resulted in significant tumor suppression as well as sensitization of antitumor effect of doxorubicin. Our findings indicate that IGFBP-3 exerts antitumor effects via IGF-independent mechanisms which involve activation of caspase-dependent apoptosis and cross-talk with NF-κB signaling. The use of IGFBP-3 as a cancer therapeutic with this distinctive suppression mechanism may offer alternate means to treat chemotherapy resistant tumors.

1 Follower
9 Reads
  • Source
    • "A report on the effects of IGFBP-3 on cell adhesion states that inhibition of endocytosis did not influence IGFBP-3 actions [40]. Researchers have shown that IGFBP-3 can inhibit the expression of nuclear factor-kappa B–regulated angiogenic factors and cell adhesion molecules such as ICAM-1 in tumorigenic prostate cell lines [41]. Other researchers reported that IGFBP-3 inhibited TNF-α-induced nuclear factor-kappa B activity in human colonic carcinoma cells [42]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Insulin-like growth factor binding protein-3 (IGFBP-3) is cytoprotective in the retina. The goal of this study was to investigate whether IGFBP-3 inhibits monocyte-endothelial cell adhesion associated with hyperglycemia. Human retinal vascular endothelial cells (RECs) were grown in normal (5 mM), medium (15 mM), or high glucose medium (25 mM) for 72 h. After 48 h, cells were transfected with endothelial-cell-specific, non-IGF binding IGFBP-3 plasmid DNA (IGFBP-3NB) at 1 μg/ml for 24 h. Cells were serum starved for 16 h and treated with tumor necrosis factor-alpha (TNF-α; 10 ng/ml) for 4 h. Cell proteins were extracted and analyzed for intercellular adhesion molecule-1 (ICAM-1) expression with enzyme-linked immunosorbent assay. Additional RECs were plated onto attachment factor-coated slides, grown to 90% confluence in high glucose medium, and transfected with IGFBP-3 NB plasmid DNA or ICAM-1 small interfering RNA before treatment with or without TNF-α (10 ng/ml) for 4 h. Slides were then mounted in a parallel-plate flow chamber and subjected to a continuous flow of U937 human monocytes (10(5)/ml) in culture medium at shear stresses of 2 dynes/cm(2), with continual exposure to TNF-α. In high ambient glucose, overexpression of IGFBP-3 in RECs significantly decreased ICAM-1 expression when compared to the TNF-α-treated samples, whereas TNF-α increased monocyte-endothelial cell adhesion. IGFBP-3 significantly decreased monocyte adhesion to RECs in the high glucose condition. RECs transfected with ICAM-1 siRNA also had a decreased number of monocytes attached compared with the scrambled siRNA control. Data suggest that IGFBP-3 reduces monocyte-endothelial cell adhesion through decreased ICAM-1 levels in a hyperglycemic environment. This is the first demonstration of the role of IGFBP-3 in inhibiting monocyte-endothelial cell adhesion.
    Molecular vision 04/2013; 19:796-803. · 1.99 Impact Factor
  • Source
    • "One lg of purified total RNA was used for RT-PCR analysis using the ThermoScript RT-PCR System (Invitrogen). Semi-quantitative RT-PCR was performed as described previously described [22]. The sequences of the forward and reverse primers were as follows: GRP78 fwd, 5 0 - CTGGGTACATTTGATCTGACTGG -3 0 ; rev, 5 0 - GCATCCTGGTGGCTTTCCAGCCATTC -3 0 , b2-microglobulin (b2 M) fwd, 5 0 - GTGCTCGCGCTACTCTCTCT-3 0 ; rev, 5 0 -CGGCAGGCATACTCATCTTT-3 0 . "
    [Show abstract] [Hide abstract]
    ABSTRACT: IGFBP-3 is known to possess intrinsic biological activities such as anti-tumor property in addition to its IGF/IGF-R axis-dependent actions in a variety of human cancers including breast cancer. To investigate the molecular mechanisms underlying the intrinsic biological actions of IGFBP-3 on breast cancer cells, we performed yeast two-hybrid screening and found GRP78, known to cause drug-resistance, as a binding partner of IGFBP-3. Overexpression of IGFBP-3 in antiestrogen-resistant LCC9 cells showed that IGFBP-3 interacted with GRP78, resulting in disruption of the GRP78-caspase-7 complex, thereby activating caspase-7, and further inducing apoptosis. Combination of overexpression of IGFBP-3 and application of siRNAs against GRP78 led to decrease in cell viability upon ICI 182,780 treatment. These data suggest that IGFBP-3 could sensitize antiestrogen-resistant breast cancer cells to ICI 182,780 by preventing the anti-apoptotic function of GRP78.
    Cancer letters 07/2012; 325(2):200-6. DOI:10.1016/j.canlet.2012.07.004 · 5.62 Impact Factor
  • Source
    • "Table S3). The most highly upregulated gene was Igfbp3 (↑12.19), which has been shown to induce rapid apoptosis in a non-IGF-dependant manner and has antiproliferative effects via the transforming growth factor β (TGF-β) signalling pathway [Han et al., 2011; Lee et al., 2005]. The downregulated genes included those linked with NF-κB signalling (Ccl5, Prdx2, T2bp, Hivep3, Tac1, Srxn1), cell proliferation (Pfkfb3), cell survival (Bdkrb1), cell signalling (Gng4, Lif, Otos, A2m, Rspo3), and cell cycling (Rnd1) (Supp. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Pseudoachondroplasia (PSACH) results from mutations in cartilage oligomeric matrix protein (COMP) and the p.D469del mutation within the type III repeats of COMP accounts for approximately 30% of PSACH. To determine disease mechanisms of PSACH in vivo, we introduced the Comp D469del mutation into the mouse genome. Mutant animals were normal at birth but grew slower than their wild-type littermates and developed short-limb dwarfism. In the growth plates of mutant mice chondrocyte columns were reduced in number and poorly organized, while mutant COMP was retained within the endoplasmic reticulum (ER) of cells. Chondrocyte proliferation was reduced and apoptosis was both increased and spatially dysregulated. Previous studies on COMP mutations have shown mutant COMP is co-localized with chaperone proteins, and we have reported an unfolded protein response (UPR) in mouse models of PSACH-MED (multiple epiphyseal dysplasia) harboring mutations in Comp (T585M) and Matn3, Comp etc (V194D). However, we found no evidence of UPR in this mouse model of PSACH. In contrast, microarray analysis identified expression changes in groups of genes implicated in oxidative stress, cell cycle regulation, and apoptosis, which is consistent with the chondrocyte pathology. Overall, these data suggest that a novel form of chondrocyte stress triggered by the expression of mutant COMP is central to the pathogenesis of PSACH.
    Human Mutation 01/2012; 33(1):218-31. DOI:10.1002/humu.21631 · 5.14 Impact Factor
Show more