Role of inducible nitric oxide synthase in the pathogenesis of experimental leptospirosis.

Abstract

Nitric oxide (NO) produced by inducible nitric oxide synthase (iNOS) is a radical effector molecule of the innate immune system that can directly inhibit pathogen replication. In order to study subsequent iNOS kidney expression in experimental leptospirosis, Golden Syrian hamsters and C3H/HeJ mice were infected intraperitoneally with 10(2) or 10(7) virulent Leptospira interrogans serovar Copenhageni (LIC) strain Fiocruz L1-130. Results showed increased levels of iNOS mRNA and protein in kidneys of infected animals when compared to that in mock-infected animals. To get a deeper insight into the role of iNOS in experimental leptospirosis, both subject species were treated or not treated with 4-aminopyridine (4-AP, 0.3mg/kg), an iNOS inhibitor. Treatment of infected hamsters with 4-AP accelerated the mortality rate to 100% by one day and increased the mortality rate from 20 to 60% in mice at 14 days post-infection. In kidney tissues, 4-AP treatment increased the bacterial burden, as demonstrated through leptospiral DNA quantification by real-time PCR, and aggravated tubulointerstitial nephritis. In addition, iNOS inhibition reduced the specific humoral response against LIC when compared to that in untreated infected animals. According to these results, iNOS expression and the resulting NO have an important role in leptospirosis.

Full text

Page 1

This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Page 2

Author's personal copy
Role of inducible nitric oxide synthase in the pathogenesis of experimental
leptospirosis
Gabriela Prêtrea, Noelia Oliveraa, Maia Cédolaa, Santiago Haasea, Lucrecia Alberdia, Bibiana Brihuegab,
Ricardo M. Gómeza,*
aInstitute of Biotechnology and Molecular Biology, CCT-La Plata, CONICET-UNLP, La Plata, Argentina
bPathobiology Institute, National Agropecuarian Technology Institute, Castelar, Buenos Aires, Argentina
a r t i c l e i n f o
Article history:
Received 21 February 2011
Received in revised form
28 March 2011
Accepted 31 March 2011
Available online 8 April 2011
Keywords:
NO
Mice
Hamster
Immunohistochemistry
Leptospira
Pathology
a b s t r a c t
Nitric oxide (NO) produced by inducible nitric oxide synthase (iNOS) is a radical effector molecule of the
innate immune system that can directly inhibit pathogen replication. In order to study subsequent iNOS
kidney expression in experimental leptospirosis, Golden Syrian hamsters and C3H/HeJ mice were
infected intraperitoneally with 102or 107virulent Leptospira interrogans serovar Copenhageni (LIC) strain
Fiocruz L1e130. Results showed increased levels of iNOS mRNA and protein in kidneys of infected
animals when compared to that in mock-infected animals. To get a deeper insight into the role of iNOS in
experimental leptospirosis, both subject species were treated or not treated with 4-aminopyridine (4-AP,
0.3 mg/kg), an iNOS inhibitor. Treatment of infected hamsters with 4-AP accelerated the mortality rate to
100% by one day and increased the mortality rate from 20 to 60% in mice at 14 days post-infection. In
kidney tissues, 4-AP treatment increased the bacterial burden, as demonstrated through leptospiral DNA
quantification by real-time PCR, and aggravated tubulointerstitial nephritis. In addition, iNOS inhibition
reduced the specific humoral response against LIC when compared to that in untreated infected animals.
According to these results, iNOS expression and the resulting NO have an important role in leptospirosis.
? 2011 Elsevier Ltd. All rights reserved.
1. Introduction
Leptospirosis, an emerging infectious disease, is a worldwide
zoonosis of human and veterinary concern caused by spirochetes
of the genus Leptospira [1]. Although leptospirosis was formerly
associated with individuals whose workplace or geographical
location placed them in close proximity to wild or farm animals
[2], it has become prevalent in cities where sanitation is lacking
and has resulted in a growing population of wild rodent reser-
voirs that contaminate the environment through their urine [3,4].
Leptospirosis is a major economic burden for public health as
well as a farming concern since patient treatment requires
hospitalization and frequently renal dialysis [4], while livestock
and domestic animals can suffer from abortions, stillbirths,
premature live birth, infertility, reduced milk production and
death [3,4].
The central pathogenic mechanism in leptospirosis is the ability
of the pathogen to disseminate widely within the host during the
early or leptospiremic stage of infection. The leptospiruric stage
begins when the pathogens are no longer found in the bloodstream
and have started to colonize the kidney [3]. Most pathogenesis
studies of leptospirosis have employed hamsters or guinea pigs.
The use of mice to study experimental leptospirosis has long been
established with strain, age and Leptospira serovar affecting the
course of infection [5]. Mice resistant to infection by L. interrogans
serovar Pomona can be rendered susceptible by immunosuppres-
sion [6]. The mechanisms of resistance to primary infection are
mainly mediated humorally in mice [6,7]. C3H/HeJ mice, up to
3 weeks of age, are highly susceptible to infection with
L. interrogans serovar Icterohaemorrhagiae [8,9].
Nitric oxide (NO) is a short-lived free radical synthesized from L-
arginine by the catalytic reaction of NO synthases (NOS). The
mammalian NOS isoforms include two constitutively expressed
enzymes (cNOS), the neuronal (nNOS) and endothelial (eNOS), as
well as the inducible isoform NOS or iNOS [10]. It is accepted that
both cNOS isoforms are regulated predominantly at the post-
translational level,whereasiNOS
primarily by the rate of transcription [11,12]. Several molecules,
appearstoberegulated
* Corresponding author. Instituto de Bioctecnología y Biología Molecular, CCT-La
Plata, CONICET-UNLP, Calle 49 y 115, 1900 La Plata, Argentina. Tel.: þ54 0221 422
6977; fax: þ54 0221 422 4967.
E-mail address: rmg@biol.unlp.edu.ar (R.M. Gómez).
Contents lists available at ScienceDirect
Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath
0882-4010/$ e see front matter ? 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.micpath.2011.03.011
Microbial Pathogenesis 51 (2011) 203e208

Page 3

Author's personal copy
including tumor necrosis factor a, interleukin 1b and lipopolysac-
charide (LPS), are able to mediate the regulation of iNOS expression
in most cells [13], including kidney tubular cells [14]. Moreover,
enhanced iNOS expression triggered by leptospires or a leptospira
outer membrane proteins (OMP) extract has been demonstrated in
Kupffer cells [15] and cultured kidney tubular cells [16,17], respec-
tively. iNOS is a high-output NOS compared with the low-output
cNOS isoforms [18]. At low concentrations, NO is a multitasking
biological mediator in the living organism. However, at higher
concentrations, NO may be cytotoxic. As a result, NO produced by
iNOSisaradicaleffectormoleculeoftheinnateimmunesystemthat
can directly inhibit pathogen replication [13,18].
In the present study, eventual kidney expression of iNOS and its
role in experimental leptospirosis were studied. For this, weanling
Golden Syrian hamsters as well as C3H/HeJ mice were used as
experimental models. Both species were inoculated with virulent
Leptospira interrogans serovar Copenhageni (LIC) strain Fiocruz
L1e130 and treated or not treated with an iNOS inhibitor. Results
showed an enhanced expression of iNOS compared to that from
uninfected animals and that enhanced mortality and morbidity
correlated with the renal bacterial burden in treated infected
animals when compared to untreated infected animals. In addition,
iNOS inhibition modulated the specific humoral response.
2. Results
2.1. Kidney iNOS expression
An iNOS expression study in kidneys was performed comparing
mock-infected with LIC-infected animals. Increased transcription of
iNOS mRNA was observed by real-time PCR (q-PCR) in kidneys of
both hamsters and mice at 5 to 7 and 14 days post-infection (dpi),
respectively (Fig. 1A). As expected, similar results were observed
when iNOS protein expression was evaluated by immunoblot
analysis (Fig. 1B). Further support for enhanced iNOS expression
was found by immunohistochemical assays when infected animals
were compared with mock-infected animals. While the last one
showed low levels of expression, high levels of iNOS antigen were
detected in the cytoplasm of the inflammatory infiltrate and in
tubular cells (Fig. 1C). In addition, the nitrite/nitrate concentration
in serum samples of mock-infected vs. infected animals showed
a significant increase in the infected animals (15 ? 8 vs.
175 ? 21 mM, P < 0.05).
In order to get a deeper insight into the role of iNOS in lepto-
spirosis, a specific iNOS inhibitor was used to compare several
parameters between LIC-infected animals that were either treated
or untreated with the iNOS inhibitor.
2.2. Clinical course
LIC induced a 100% mortality rate in hamsters and 20% in mice at
7 (Fig. 2A) and 14 (Fig. 2B) dpi, respectively. All hamsters that
received additional 4-AP treatment died 1 day earlier while C3H/
HeJ mice receiving additional 4-AP treatment had an increased
mortality rate of up to 60% at 14 dpi. Spontaneous death was not
observed in mock-infected or 4-AP-treated hamsters or mice
during the entire observation period (7 and 14 days, respectively).
2.3. Bacterial burden in kidney tissues
In order to study whether iNOS inhibition had an impact on
bacterial burden, leptospiral DNA was quantified by q-PCR and
expressed bycopy number per ng of DNA. Results showed that both
4-AP-treated hamsters and mice at 6 to 7 and 14 dpi, respectively,
had a greater bacterial burden in their kidneys when compared
with those in infected and PBS-treated animals (Fig. 3).
2.4. Histological findings
In order to evaluate if the higher mortality and leptospiral
burden observed after iNOS inhibition aggravated kidney involve-
ment at a histological level, a pathological examination was per-
formed. As expected, mock-infected as well as 4-AP-treated
uninfected mice did not show any histopathological findings
(Fig.4AandB).Incontrast,tubulointerstitialnephritiswasobserved
in infected animals. Kidney tissues from hamsters obtained at 6 to
7 dpi showed a well conserved cortical and medullary architecture.
A few glomeruli were shrunken or contracted; likewise some
tubules contained proteinaceous material mixed with erythrocytes.
An early mixed-cell infiltrate was occasionally noted near larger
vessels. The histopathological findings in miceweresimilar tothose
Fig.1. Upregulation of iNOS. (A). q-PCR analysis shows an enhanced expression of iNOS
transcript in samples from kidneys of LIC-infected animals compared to those from
mock-infected animals. Hamsters and mice were harvested at 6 to 7 and 14 days post-
infection (dpi), respectively. (B). Western blot analysis of iNOS expression in kidney
from mice at 14 dpi. b-actin was used as the loading control. (C). Representative slides
of immunohistochemical staining of iNOS in kidneys from mock-infected (upper panel)
or LIC-infected (lower panel) mice. 250? magnification. These results are represen-
tative of three different experiments. An * indicates a P value <0.05.
G. Prêtre et al. / Microbial Pathogenesis 51 (2011) 203e208
204

Page 4

Author's personal copy
observedinhamstersandwere,inbothcases,moreintensein4-AP-
treated infected animals (Fig. 4C and D).
2.5. Humoral response
In order to analyze the critical defense mechanism involved in
leptospirosis as the specific humoral response, an ELISA assay with
dead leptospires as coating was performed. Results showed that
mice presented higher specific anti-LIC IgM and IgG antibodies in
PBS-treated infected animals than in 4-AP-treated infected animals,
with mock-infected animals showing minimal levels of the anti-
body (Fig. 5).
3. Discussion
The Leptospira used was able to induce significant mortality,
disease and iNOS expression in both weanling hamsters and C3H/
HeJ mice. Hamsters were infected with low inocula because this
produces similar disease kinetics and severity to those observed in
humans [19] and, together with guinea pigs, are animals widely
used for virulence testing [20]. In contrast, mice are relatively
resistant to infection and high inocula are required to produce
disease, a situation that may not parallel natural exposure [20].
However, since hamsters died during the first week of infection, the
use of mice allowed the study of the disease until the leptospiruric
stage.
Induction of iNOS expression in kidney tissues, not only in the
inflammatory infiltrate but also in the kidney tubular cells, partic-
ularly of the outer medulla, was expected since it has been previ-
ously shown that iNOS expression is triggered by live leptospires in
Kupffer cells [15], as well as by the leptospira OMP LipL32 in kidney
cells [17,21], human patients with leptospirosis shown high serum
nitric oxide levels [22] while in murine models of endotoxic shock,
iNOS expression has been observed mainly in the lung, spleen and
kidney of mice [23] or in the tubular and vascular structures of the
outer medulla of rats treated with LPS [24].
Although leptospirosis isanimportant cause of acute renalfailure
worldwide, the mechanisms of renal dysfunction have not yet been
fully studied [21]. The pathophysiology involves proximal tubular
dysfunction, augmenting distal sodium delivery, and, consequently,
potassium excretion by the intact distal tubule [25] with a defective
NaþeKþeCl?co-transporter (NKCC2) [26]. At a histological level,
tubulointerstitial nephritis, including interstitial edema and cellular
infiltrates in the tubulointerstitial area, is the main manifestation
during acute renal failure [27,28]. Several studies by Wang and
colleagues were performed in order to elucidate the mechanisms of
tubulointerstitial injury caused by leptospira infection. They showed
that a leptospira OMP extract on cultured mouse renal tubular
epithelialcellsactivatednucleartranscriptionfactorkappaB(NF-kB),
activator protein-1, and downstream genes expressed in medullary
thickascendinglimbcells[29].FurtherstudiesidentifiedthatLipL32,
a major outer membrane lipoprotein of pathogenic leptospires, can
trigger an increase in gene and protein expression of pro-
inflammatory enzymes and cytokines such as inducible nitric oxide
(iNOS), monocyte chemoattractant protein-1 (CCL2/MCP-1), regu-
lated upon activation, normal T-cell expressed and secreted
(RANTES), and tumor necrosis factor-alpha (TNF-a) in mouse prox-
imaltubulecells[17]throughatoll-likereceptor2(TLR2)-dependent
pathway [30].
LIC-infected mice receiving 4-AP treatment showed a more
intense tubulointerstitial nephritis than those only LIC-infected,
consistent with previous observations where iNOS inhibition was
showntoaggravate sepsisinducedbygroupBstreptococcus[31]and
Staphylococcus aureus [32] but in contrast to the improvement
observed after iNOS inhibition in nephrotoxic nephritis [33] and
experimental nephrectomy [34]. Taken together, these results
suggest that the benefit of iNOS inhibition may depend on whether
the kidney disease isofaninfectiousorigin.SincetheleptospiraOMP
LipL32 trigger iNOS in a dose-dependent manner [17], a possible
explanatory mechanism involved may be the higher leptospire
burden present in the kidney tissues of 4-AP-treated animals. The
higher bacterial burden present in the kidney may be a consequence
of both the reduced inhibiting replication effect of NO and/or the
well-known fact that the immune response shifts to a T helper 1
Fig. 3. Bacterial burden. Quantitative measurement of leptospiral DNA in kidney
samples from animals treated or untreated with 4-AP and infected with 107bacteria.
Animals were sacrificed at 6 to 7 (hamsters) or 14 (mice) days post-infection, and the
kidneys were removed for quantitative analysis of bacterial load by q-PCR of 16S rRNA
genes. Three pieces of each organ were analyzed in triplicate q-PCR and expressed as
copy number per ng of DNA. Bars represent mean ? standard error (SE) of assays from
a group of three mice. An * indicates a P value <0.05.
Fig. 2. Mortality rates. (A). Survival percentage of mock-infected (dark triangle), 4-AP-treated (square), LIC-inoculated (circle) or LIC-inoculated and 4-AP-treated (white triangle)
hamsters. (B). Survival percentage of mock-infected (dark triangle), 4-AP-treated (square), LIC-inoculated (circle) or LIC-inoculated and 4-AP-treated (white triangle) C3H/HeJ mice.
G. Prêtre et al. / Microbial Pathogenesis 51 (2011) 203e208
205

Page 5

Author's personal copy
(Th1)-like response as a result of chronic administration of an iNOS-
selective blocker [35]. In fact, a reduced specific humoral response,
critically important in limiting leptospira dissemination [6,7], was
observed in addition to a worsening interstitial infiltrate, possibly
leading to significant functional deterioration.
As NO from iNOS has been linked to important pathophysio-
logical functions in kidney tubular cells, including upregulation of
Naþand HCO3transport [36], it may be possible that enhanced
iNOS expression has an important role in the renal dysfunction
observed during leptospirosis [16,37] since inhibition of cNOS by
the NO generated by iNOS after LPS administration has been
previously shown to provoke renal dysfunction in rats [38]. More-
over, autoimmune tubulointerstitial nephritis has been associated
with a progressive reduction in glomerular filtration rate, where
induction of iNOS with increased NO production may have an
important role, most likely by inhibiting normal eNOS activity that
leads to unopposed vasoconstriction by pressor hormones, like
angiotensin II and catecholamines, consequently reducing renal
plasma flow and the glomerular filtration rate [35]. Moreover,
important roles have been assigned to the concomitant oxidative
and nitrosative stress and the subsequent peroxynitrite formation
in the ensuing renal dysfunction. Scavenging peroxynitrite using
seleno-organic compounds like ebselen provides renal protection
against ischemic injury [39].
The present results unveil new pathogenic mechanisms in
leptospirosis and encourage further studies for the development of
new therapeutic strategies.
4. Conclusions
In Leptospira-infected hamsters and mice, an upregulation of
iNOS expression was observed both at transcriptional and trans-
lational levels. The specific inhibition of iNOS increased mortality
and bacterial kidney burden, while aggravating tubulointerstitial
nephritis, and reduces specific humoral response. According these
results, iNOS expression and resulting NO may have an important
role in the kidney dysfunction observed in leptospirosis.
5. Experimental/materials and methods
5.1. Bacteria
A virulent Leptospira interrogans serovar Copenhageni (LIC)
strain Fiocruz L1e130 was used. It was cultured at 30?C under
Fig. 4. Histopathology. Representative hematoxylin and eosin staining from 14 days post-infection showing kidneys of (A) mock-infected, (B) 4-AP treated, (C) LIC-infected and (D)
LIC-infected 4-AP-treated mice. A and B show a normal appearance. Mild tubulointerstitial nephritis is observed in C while tubulointerstitial nephritis of intermediate severity is
observed in D. 150? magnification.
Fig. 5. Humoral response. An ELISA assay was performed to detect anti-LIC IgM and
IgG antibodies in the sera of 4-AP treated and untreated infected C3H/HeJ mice. Sera
from mock-infected animals were used as controls. Microtiter plates were coated with
106heat-inactivated LIC and incubated with serum dilutions. Data represent the mean
absorbance at 492 nm ? standard deviation from triplicate wells. An * indicates a P
value <0.05.
Table 1
Primers used in q-PCR assays.
Gene product Primer
name
Primer sequence (50e30)Amplicon
length (bp)
16S RNAFw
Rev
Fw
Rev
Fw
Rev
CATTCATGTTTCGAATCATTTCAAA
GGCCCAAGTTCCTTCTAAAAG
CAGCTGGGCTGTACAAAC
CATTGGAAGTGAAGCGTTTCG
CGTCATCCATGGCGAACTG
GCTTCTTTGCAGCTCCTTCGT
331
iNOS95
b-Actin98
G. Prêtre et al. / Microbial Pathogenesis 51 (2011) 203e208
206

Page 6

Author's personal copy
aerobic conditions in liquid EMJH medium (Difco, USA) supple-
mented with rabbit serum (vol/vol: 10%) and enriched with 0.015%
L-asparagine (wt/vol), 0.001% sodium pyruvate (wt/vol), 0.001%
calcium chloride (wt/vol), 0.001% magnesium chloride (wt/vol),
0.03% peptone (wt/vol) and 0.02% meat extract (wt/vol). Virulence
of LIC was maintained by iterative passages in Golden Syrian
hamsters.
5.2. Animals
Golden Syrian hamsters (Mesocricetus auratus) were purchased
from the National Atomic Energy Commission (Ezeiza, Argentina)
and were used at 21e35 days of age. Three-week old C3H/HeJ
inbred mice were purchased from Biol (Buenos Aires, Argentina).
All animals were givenwater and laboratoryanimal food ad libitum.
All procedures used in the experiments were approved by the
Ethics Committee of the Faculty of Exact Sciences, National
University of La Plata.
5.3. Experimental design
Animals were equally split into 4 groups: (a) intraperitoneally
(ip) inoculated animals with 0.5 ml of PBS containing 102
(hamsters) or 107bacterias (mice); (b) as in (a) plus ip administered
aminopyridine (AP) daily at 0.30 mg/kg weight (LD50: 21 mg/kg
weight); (c) ip inoculated animals with 0.5 ml of PBS; and (d) as in
(c) plus AP as in (b). Animals from groups a and c received a daily
PBS injection. Groups of 3 animals were sacrificed at 6 to 7
(hamsters) or 14 (mice) days post-inoculation (dpi) or when they
appeared moribund, and their blood and kidney were then har-
vested. Routinely, one part was frozen at ?70?C for further studies
and the other fixed with buffered 4% paraformaldehyde for histo-
logical examination and immunoperoxidase labeling. The effec-
tiveness of 4-AP treatment was confirmed by measuring serum
nitrate/nitrite levels (data not shown).
5.4. Histopathology and immunohistochemistry
The procedurehas beenpreviouslydescribed in Ref. [40]. Briefly,
after rehydratation, the tissue Pro-Bond Plus sections were heated
three times for 5 min in a 10 mM citrate buffer in a microwave oven.
The sections were then cooled and immersed in 3% H2O2for 15 min
to inhibit endogenous peroxidase activity. To block non-specific
antigen sites, sections were incubated with PBS with 5% of
normal goat serum for 20 min at room temperature. Sections were
then incubated with the primary polyclonal anti-iNOS antiserum
(Cayman USA) diluted 1:100 for 1 h at room temperature. After
several washes with PBS, specimens were incubated with
secondary antibody (goat anti-rabbit immunoglobulin) conjugated
toperoxide-labeled dextranpolymer (DAKO EnVision) for 20 min at
room temperature and again washed with PBS. Diaminobenzidine/
hydrogen peroxidase substrate (DAB) was added for 2e10 min to
reach the appropriateintensityand slides wererinsed with distilled
water to stop the staining reaction. Immunostained sections were
counterstained with hematoxylin for 1 min, washed under tap
water, rinsed with distilled water and dehydrated in increasing
ethanol concentrations followed by xylene (each treatment, 5 min).
Finally, the sections were mounted onto a coverslip in a non-
aqueous permanent mounting medium and observed under
a Nikon E200 photomicroscope.
5.5. Immunoblotting
This was performed as previously described in Ref. [41]. The
membrane containing the blotted proteins was washed with PBS-
Tween (PBS-T) and incubated with anti-iNOS (1:?1000) or anti-
actin (1:?1000), respectively, in 5% non-fat dry milk-PBS-T. After
the washings, the membrane was incubated with anti-rabbit or
mouse IgG (HRP)-conjugate (1:5000) in 5% non-fat dry milk-PBS-T
for 1 h. The bands wererevealed with ECL reagents (GE Healthcare).
5.6. DNAeRNA isolation and RT-PCR
Total DNA or RNA was isolated from the kidney by mechanical
homogenization and Trizol (Invitrogen), as recommended by the
manufacturer. The DNA or RNA was resuspended in 100 ml
nuclease-free water (Epicenter) and quantified with a spectropho-
tometer (Nanodrop spectrophotometer ND-1000). Previous to
cDNA synthesis, DNase treatment was performed with an RNase-
free DNase Kit (Qiagen). cDNA was synthesized from 500 ng of
total RNA with 15 mM of random hexamers and SuperScript III
reverse transcriptase, according to manufacturer instructions.
5.7. Real-time PCR
For q-PCR studies, PCR amplification and analysis were per-
formed with a Line-Gene instrument and software (Bioer). The
TAQurate green real-time PCR MasterMix (Epicentre Biotechnol-
ogies) was used for all reactions, following manufacturer instruc-
tions. Standard cDNA samples with 10-fold serial dilutions were
used for PCR efficiency calculations. Cycle threshold (Ct) values
were obtained for each individual reaction, and the Ct of the 16S-
DNA bacterial gene or the ubiquitously host expressed actin was
subtracted to obtain the bacterial burden or iNOS normalized
values, respectively. Primer sequences and sizes of the amplified
fragments are shown in Table 1.
5.8. ELISA
Murine IgM and IgG antibodies against leptospira were detected
by ELISA. The plates were covered with 106heat-inactivated LIC per
well. All serum samples were diluted 1:20 and evaluated for total
IgM or IgG using rabbit anti-mice IgM or IgG antibodies (1:5000;
Sigma) and an HRP-conjugated goat anti-rabbit antibody (1:5000;
Sigma). The absorbance was read at a wavelength of 492 nm (Tecan
Absorbance Microplate Reader, Switzerland).
5.9. Griess reaction
Measuring serum nitrite/nitrate levels by Griess reaction was
performed as described before in Ref. [42].
5.10. Statistical analysis
Datawere expressed as the mean ? S.E.M. and were analyzed by
one-way analysis of variance (ANOVA) followed by Bonferroni
multiple comparison test to determine significant differences
between groups. P values <0.05 were considered statistically
significant.
Acknowledgments
This work was supported by grants from Universidad Nacional
de La Plata (Project X592) and Agencia Nacional de Promoción
Científica y Tecnológica (ANPCyT) PICT 07-00642 and PICT 07-
00028 (RMG). RMG is a scientific researcher and MC hold
a fellowship from the CONICET. GP and NO holds ANPCyT
fellowships.
G. Prêtre et al. / Microbial Pathogenesis 51 (2011) 203e208
207

Page 7

Author's personal copy
References
[1] Levett PN. Leptospirosis. Clin Microbiol Rev 2001;14:296e326.
[2] Feigin RD, Anderson DC. Human leptospirosis. CRC Crit Rev Clin Lab Sci 1975;
5:413e67.
[3] Faine S, Adler B, Bolin C. Leptospira and leptospirosis. Melbourne Australia:
MediSci; 1999.
[4] Ko AI, Galvao Reis M, Ribeiro Dourado CM, Johnson Jr WD, Riley LW, Salvador
Leptospirosis Study Group. Urban epidemic of severe leptospirosis in Brazil.
Lancet 1999;354:820e5.
[5] Faine S. Factors affecting the development of the carrier state in leptospirosis.
J Hyg (Lond) 1962;60:427e34.
[6] Adler B, Faine S. Host immunological mechanisms in the resistance of mice to
leptospiral infections. Infect Immun 1977;17:67e72.
[7] Chassin C, Picardeau M, Goujon JM, Bourhy P, Quellard N, Darche S, et al. TLR4-
and TLR2-mediated B cell responses control the clearance of the bacterial
pathogen, Leptospira interrogans. J Immunol 2009;183:2669e77.
[8] Pereira MM, Andrade J, Marchevsky RS. Ribeiro dos Santos R. Morphological
characterization of lung and kidney lesions in C3H/HeJ mice infected with
Leptospira interrogans serovar icterohaemorrhagiae: defect of CD4þ and
CD8þ T-cells are prognosticators of the disease progression. Exp Toxicol
Pathol 1998;50:191e8.
[9] Nally JE, Fishbein MC, Blanco DR, Lovett MA. Lethal infection of C3H/HeJ and
C3H/SCID mice with an isolate of Leptospira interrogans serovar copenhageni.
Infect Immun 2005;73:7014e7.
[10] Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases: structure,
function and inhibition. Biochem J 2001;357:593e615.
[11] Stuehr DJ. Mammalian nitric oxide synthases. Biochim Biophys Acta 1999;
1411:217e30.
[12] Aktan F. iNOS-mediated nitric oxide production and its regulation. Life Sci
2004;75:639e53.
[13] Kleinert H, Pautz A, Linker K, Schwarz PM. Regulation of the expression of
inducible nitric oxide synthase. Eur J Pharmacol 2004;500:255e66.
[14] Markewitz BA, Michael JR, Kohan DE. Cytokine-induced expression of a nitric
oxide synthase in rat renal tubule cells. J Clin Invest 1993;91:2138e43.
[15] Marangoni A, Accardo S, Aldini R, Guardigli M, Cavrini F, Sambri V, et al.
Production of reactive oxygen species and expression of inducible nitric oxide
synthase in rat isolated Kupffer cells stimulated by Leptospira interrogans and
Borrelia burgdorferi. World J Gastroenterol 2006;12:3077e81.
[16] Yang CW, Wu MS, Pan MJ. Leptospirosis renal disease. Nephrol Dial Transplant
2001;16(Suppl. 5):73e7.
[17] Yang C-W, Wu M-S, Pan M-J, Hsieh W-J, Vandewalle A, Huang C- C. The
Leptospira outermembraneprotein
nephritis-mediated gene expression in mouse proximal tubule cells. J Am Soc
Nephrol 2002;13:2037e45.
[18] Lowenstein CJ, Padalko E. iNOS (NOS2) at a glance. J Cell Sci 2004;117:
2865e7.
[19] Silva EF, Santos CS, Athanazio DA, Seyffert N, Seixas FK, Cerqueira GM, et al.
Characterization of virulence of Leptospira isolates in a hamster model.
Vaccine 2008;26:3892e6.
[20] Ko AI, Goarant C, Picardeau M. Leptospira: the dawn of the molecular genetics
era for an emerging zoonotic pathogen. Nat Rev Microbiol 2009;7:736e47.
[21] Yang C- W. Leptospirosis renal disease: understanding the initiation by Toll-
like receptors. Kidney Int 2007;72:918e25.
[22] Maciel EA, Athanazio DA, Reis EA, Cunha FQ, Queiroz A, Almeida D, et al. High
serum nitric oxide levels in patients with severe leptospirosis. Acta Trop 2006;
100:256e60.
[23] Kan W, Zhao KS, Jiang Y, Yan W, Huang Q, Wang J, et al. Lung, spleen, and
kidney are the major places for inducible nitric oxide synthase expression in
LipL32 inducestubulointerstitial
endotoxic shock: role of p38 mitogen-activated protein kinase in signal
transduction of inducible nitric oxide synthase expression. Shock 2004;21:
281e7.
[24] Chou DE, Cai H, Jayadevappa D, Porush JG. Regional expression of inducible
nitric oxide synthase in the kidney stimulated by lipopolysaccharide in the
rat. Exp Physiol 2002;87:153e62.
[25] Magaldi AJ, Yasuda PN, Kudo LH, Seguro AC, Rocha AS. Renal involvement in
leptospirosis: a pathophysiologic study. Nephron 1992;62:332e9.
[26] Lin CL, Wu MS, Yang CW, Huang CC. Leptospirosis associated with hypo-
kalaemia and thick ascending limb dysfunction. Nephrol Dial Transplant
1999;14:193e5.
[27] Ooi BS, Chen BT, Tan KK, Khoo OT. Human renal leptospirosis. Am J Trop Med
Hyg 1972;21:336e41.
[28] Penna D, De Brito T, Pupo A. Kidney biopsy in human leptospirosis. Am J Trop
Med Hyg 1963;12:896e970.
[29] Yang CW, Wu MS, Pan MJ, Hong JJ, Yu CC. Leptospira outer membrane protein
activates NF-kappa B and downstream genes expressed in medullary thick
ascending limb cells. J Am Soc Nephrol 2000;11:2017e26.
[30] Yang C-W, Hung C-C, Wu M-S, Tian Y-C, Chang C-T, Pan M-J, et al. Toll-like
receptor 2 mediates early inflammation by leptospiral outer membrane
proteins in proximal tubule cells. Kidney Int 2006;69:815e22.
[31] Puliti M, von Hunolstein C, Bistoni F, Orefici G, Tissi L. Inhibition of nitric oxide
synthase exacerbates group B streptococcus sepsis and arthritis in mice. Infect
Immun 2004;72:4891e4.
[32] Sakiniene E, Bremell T, Tarkowski A. Inhibition of nitric oxide synthase (NOS)
aggravates Staphylococcus aureus septicaemia and septic arthritis. Clin Exp
Immunol 1997;110:370e7.
[33] Bremer V, Tojo A, Kimura K, Hirata Y, Goto A, Nagamatsu T, et al. Role of
nitric oxide in rat nephrotoxic nephritis: comparison between inducible
and constitutive nitric oxide synthase. J Am Soc Nephrol 1997;8:
1712e21.
[34] Fujihara CK, Mattar AL, Vieira Jr JM, Malheiros DM, Noronha Ide L,
Goncalves AR, et al. Evidence for the existence of two distinct functions for the
inducible NO synthase in the rat kidney: effect of aminoguanidine in rats with
5/6 ablation. J Am Soc Nephrol 2002;13:2278e87.
[35] Gabbai FB, Hammond TC, Thomson SC, Khang S, Kelly CJ. Effect of acute iNOS
inhibition on glomerular function in tubulointerstitial nephritis. Kidney Int
2002;61:851e4.
[36] Wang T. Role of iNOS and eNOS in modulating proximal tubule transport and
acid-base balance. Am J Physiol Ren Physiol 2002;283:F658e62.
[37] Liang M, Knox FG. Production and functional roles of nitric oxide in the
proximal tubule. Am J Physiol Regul Integr Comp Physiol 2000;278:
R1117e24.
[38] Schwartz D, Mendonca M, Schwartz I, Xia Y, Satriano J, Wilson CB, et al.
Inhibition of constitutive nitric oxide synthase (NOS) by nitric oxide generated
by inducible NOS after lipopolysaccharide administration provokes renal
dysfunction in rats. J Clin Invest 1997;100:439e48.
[39] Goligorsky MS, Brodsky SV, Noiri E. Nitric oxide in acute renal failure: NOS
versus NOS. Kidney Int 2002;61:855e61.
[40] Gomez RM, Vieira ML, Schattner M, Malaver E, Watanabe MM, Barbosa AS,
et al. Putative outer membrane proteins of Leptospira interrogans stimulate
human umbilical vein endothelial cells (HUVECS) and express during infec-
tion. Microb Pathog 2008;45:315e22.
[41] Pacienza N, Pozner RG, Bianco GA, D’Atri LP, Croci DO, Negrotto S, et al. The
immunoregulatory glycan-binding protein galectin-1 triggers human platelet
activation. FASEB J 2008;22:1113e23.
[42] Gomez RM, Levander OA, Sterin-Borda L. Reduced inotropic heart response in
selenium-deficient mice relates with inducible nitric oxide synthase. Am J
Physiol Heart Circ Physiol 2003;284:H442e8.
G. Prêtre et al. / Microbial Pathogenesis 51 (2011) 203e208
208