Development of reflective biosensor using fabrication of functionalized photonic nanocrystals.

Abstract

Photonic crystals (PCs) are periodic dielectric structures that have a band-gap that forbids propagation of a certain range of wavelengths of light. This property enables control of light with remarkable facility by modification of the band-gaps and produce effects that are impossible with conventional optics. Using chemically functionalized PCs, where the chemical functional group consists of amine and carboxyl group, in conjunction with a biomolecular probe material, the detection of pathogens and viral disease is possible, indicated by the shift in wavelength signal. Moreover, this system using the bioinspired PCs allows specific target detection in biosensor chip fields through control of the PCs. In this study, we demonstrated that two bacterial pathogens (Fusobacterium necrophorum and Acinetobacter baumannii) causing sepsis were detected by DNA-probe hybridization and a severe acute respiratory syndrome coronavirus was detected by antigen-antibody interaction using the functional PCs. Optical readout with the integrated sensor detecting the signals from PCs, allows for low cost and robust readout of resonance peak shift. This biosensor system using the functional PCs on the photonic crystal-fabricated chip can efficiently and effectively detect various targets, and be easily prepared with high productivity and economic property.

Full text

Page 1

Delivered by Ingenta to:
Korea Advanced Institute of Science & Technology (KAIST)
IP : 143.248.125.198
Mon, 05 Sep 2011 01:55:22
and carboxyl group, in conjunction with a biomolecular probe material, the detection of pathogens
and viral disease is possible, indicated by the shift in wavelength signal. Moreover, this system using
the bioinspired PCs allows specific target detection in biosensor chip fields through control of the
PCs. In this study, we demonstrated that two bacterial pathogens (Fusobacterium necrophorum and
Acinetobacter baumannii) causing sepsis were detected by DNA-probe hybridization and a severe
acute respiratory syndrome coronavirus was detected by antigen–antibody interaction using the
functional PCs. Optical readout with the integrated sensor detecting the signals from PCs, allows
for low cost and robust readout of resonance peak shift. This biosensor system using the functional
PCs on the photonic crystal-fabricated chip can efficiently and effectively detect various targets, and
be easily prepared with high productivity and economic property.
Keywords: PhotonicCrystal,Biomimetics,
NanoBiosensor.
RESEARCH ARTICLE
Copyright © 2011 American Scientific Publishers
All rights reserved
Printed in the United States of America
Journal of
Nanoscience and Nanotechnology
Vol. 11, 632–637, 2011
Development of Reflective Biosensor Using
Fabrication of Functionalized Photonic Nanocrystals
Tae Jung Park1?†, Seung-Kon Lee2?†, Seung Min Yoo1, Seung-Man Yang2, and Sang Yup Lee1?2?3?∗
1BioProcess Engineering Research Center, Center for Systems and Synthetic Biotechnology,
and Institute for the BioCentury, KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Korea
2Department of Chemical and Biomolecular Engineering (BK21 program),
KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Korea
3Department of Bio and Brain Engineering, Department of Biological Sciences,
and Bioinformatics Research Center, KAIST, 335 Gwahangno, Yuseong-gu, Daejeon 305-701, Korea
Photonic crystals (PCs) are periodic dielectric structures that have a band-gap that forbids propaga-
tion of a certain range of wavelengths of light. This property enables control of light with remarkable
facility by modification of the band-gaps and produce effects that are impossible with conventional
optics. Using chemically functionalized PCs, where the chemical functional group consists of amine
BiomolecularInteraction,OpticalDetection,
1. INTRODUCTION
Self-organized colloidal crystals are important for var-
ious applications including biosensors, catalytic sup-
ports, acoustic materials and macroporous matrices of
catalysts.1–3Additionally, the multi-dimensional colloidal
microstructures, which are self-assembled with differ-
ent sized particles, are potentially useful for microdis-
play devices and optical communications owing to the
structure-induced photonic band-gaps.3?4Recent progress
has produced high quality artificial opals by evapora-
tion of the liquid medium from colloidal suspension, and
fabricated inverse opal structures by using the colloidal
opals as templates.5?6Although their methods based on the
colloidal self-assembly could produce three-dimensional
microstructures without machinery, they were not practi-
cal due to the long process time required with extremely
∗Author to whom correspondence should be addressed.
†These authors contributed equally.
limited controllability in comparison to the conventional
lithographic technique. However, most of their feature
sizes were larger than the visible wavelength. As alterna-
tives, vertical dip-coating of colloidal particles on patterned
substrates7and capillary force induced deposition8?9have
been demonstrated for patterned colloidal microstructures.
To develop a pattern generation of colloidal crystals, a
crystallization process to build an optical biosensor array
chip by using colloidal photonic crystals was developed.
The time required for colloidal crystallization was remark-
ably reduced compared to the conventional vertical coat-
ing and evaporation induced processes because the present
method used a simple dip coating. The proposed pro-
cess enabled us to construct large-area colloidal structures
by consecutively fabricating them on the glass slide sur-
face. The built-in colloidal crystals can then serve as an
ideal integration platform of biomaterials and nanopho-
tonics because the colloidal crystals have few photonic
band-gaps that can be manipulated by the refractive index
mismatch between the colloidal particles and the solvent
632
J. Nanosci. Nanotechnol. 2011, Vol. 11, No. 1
1533-4880/2011/11/632/006doi:10.1166/jnn.2011.3269

Page 2

Delivered by Ingenta to:
Korea Advanced Institute of Science & Technology (KAIST)
IP : 143.248.125.198
Mon, 05 Sep 2011 01:55:22
Therefore, this optical array chip combining colloidal
photonic crystals and bio-specific receptors have great
potential applications for detecting pathogens, viral dis-
eases and metals. Here, we introduce a simple label-free
optical biosensor technology by examining several differ-
ent DNA-DNA, protein–protein and protein–metal interac-
tions. The first was the bacterial pathogen detection, where
the biomolecule binds to target DNAs in a sequence-
specific manner in certain infectious bacteria. The second
is an optical biosensor with the severe acute respiratory
syndrome (SARS) coronavirus surface antigen, a protein
that binds to its specific antibody in an antigen–antibody
interaction-dependent manner. The third employs gold par-
ticle in a metal-binding affinity manner, which could be
applied into various metals with their specific binding
molecules. These systems using photonic band-gaps on
the colloidal crystal chip are essential for advancing fun-
damental biotechnological applications such as biosensors
and drug developments.10
RESEARCH ARTICLE
Park et al.
Development of Reflective Biosensor Using Fabrication of Functionalized Photonic Nanocrystals
medium. By tuning the refractive index mismatch, the
optical reflectance peaks are shifted due to the modifica-
tions of photonic band-gaps. With this property, sample
species can be detected immediately by optical signals
associated with photonic band-gaps. Therefore, microscale
colloidal crystal-array chips are useful for sample diag-
nostics and chemical or biosensors. In addition, the mod-
ulated photonic band-gaps of built-in colloidal crystals are
essential for constructing optic platforms. The photonic
crystal biosensors consist of a low-refractive-index poly-
mer grating coated with a film of high-refractive-index sil-
ica dioxide, attached to the bottom of a glass slide. Each
slide function as a test kit with a biosensor attached to
the base. Biomolecules, such as DNA and protein, are first
attached to the bottom of each slide. Then, interactions
of that biomolecule with other molecules, including tar-
gets can be observed. By examining the light reflected
from the photonic crystal, we can suggest when molecules
are added to, or removed from, the crystal surface. The
measurement technique can be used in a high-throughput
screening mode to rapidly identify molecules and inhibitor
drugs that prevent biomolecular binding.
2. EXPERIMENTAL DETAILS
2.1. Preparation of Opal Film by Monodisperse
Colloidal Suspensions
Uniform silica colloidal spheres were synthesized using
sol–gel chemistry from 14 ml of tetraethylorthosilcate
(TEOS 99.99%, Sigma-Aldrich, St. Louis, MO), 144 ml
of ethanol (HPLC grade, Merck, Whitehouse Station,
NJ), 7 ml of ammonium hydroxide (26%, Junsei, Tokyo,
Japan), and 18 ml of distilled water. The diameter of the
silica spheres was 738 nm, which the size distribution was
less than 5%, and the density was 7.36 wt%. Size and
distributions were characterized by a dynamic light scat-
tering system (Brookhaven Instruments Corp., Holtsville,
NY). Resulting colloidal particles were washed twice to
remove unreacted ingredients and residues and redispersed
in ethanol.
For the synthesis of bio-active colloidal particles, sur-
face of silica spheres were modified by amine contain-
ing silane coupling agent. 3-aminopropyltriethoxy silane
(APS, Sigma-Aldrich) and ammonium hydroxide were
added to the silica suspension and reacted for 6 h.
Monodisperse silica colloidal crystal films were deposited
on microscope cover glasses (12-545J, Fisher Scientific,
Pittsburgh, PA) by the dip-coating method. Cover glasses
were then treated by oxygen plasma (Harrick, Pleas-
antville, NY) for 1 min to enhance binding on colloidal
crystals by forming hydroxyl group on the surface. In order
to form a uniform colloidal crystal film, evaporation speed
of the colloidal suspensions was controlled by temperature
programmable water bath. The temperature was linearly
elevated from 18?C to 70?C for 6 h and preserved at
70?C for 2 h.
2.2. Preparation of Reference
Strains and Target DNAs
Reference bacteria were obtained from the American
Type Culture Collection (ATCC, Rockville, MD, USA)
and Korean Collection for Type Cultures (KCTC, Dae-
jeon, Korea). Polymerase chain reaction (PCR) for tar-
get DNAs preparation was performed with two primer
pairs using genomic DNA from Acintobacter bauman-
nii (KCTC 2771), Fusobacterium necrophorum (ATCC
25286) and Klebsiella pneumoniae (ATCC 700603). The
primer pairs used for the amplification were 1585Fw
(5?Phosphate-TTGTACACACCGCCCGTC-3?) and 23BR
(5?Cy5-TTCGCCTTTCCCTCACGGTACT-3?) for A. bau-
mannii and F. necrophorum, and MS37Fw (5?Phosphate-
AGGATGTTGGCTTAGAAGCAGCCA-3?) and MS38R
(5?Cy5-CCCGACAAGGAATTTCGCTACCTT-3?)
K. pneumoniae.11PCR was performed in 50 ?l reaction
solution containing 1× PCR buffer, 0.2 mM dNTPs, 1 unit
of Taq polymerase (Solgent Co. Ltd., Daejeon, Korea),
and 10 pmol each of upstream and downstream primers.
PCR was carried out under the following condition: 94?C
for 4 min; 30 cycles of 94?C for 30 s, 54?C for 30 s,
and 72
for 5 min. PCR amplicons (1239 bp for A. baumannii,
814 bp for F. necrophorum and 898 bp for K. pneumoniae,
respectively) were purified using PCR purification kit
(iNtRON Co., Ltd, Seongnam, Korea) according to the
manufacturer’s protocol and eluted with 50 ?l of elution
buffer. The purified samples were then incubated at 37?C
for 1 h with 2 units of lambda exonuclease (New England
Biolabs Inc., Ipswich, MA), which selectively degrades
the 5?-phosphorylated strand of the double-stranded DNA.
for
?C for 1 min; and a final extension at 72
?C
J. Nanosci. Nanotechnol. 11, 632–637, 2011
633

Page 3

Delivered by Ingenta to:
Korea Advanced Institute of Science & Technology (KAIST)
IP : 143.248.125.198
Mon, 05 Sep 2011 01:55:22
RESEARCH ARTICLE
Development of Reflective Biosensor Using Fabrication of Functionalized Photonic Nanocrystals
Park et al.
Table I.
Probe DNAs used in this study.
Probe
DNAs
Length
(-mer)
Sequence
(5?→ 3?)
Acti23S01-4545 AACGTAGAGGGTGATATTCCCGTACAC
GAAAGGGCACACATAATG
GAAAGTCCTGTATTGGTAGTTTTCTTGC
GCTGTATCTCTTCTCCC
Fne02-45 45
2.3. DNA Immobilization and Hybridization
The 1 ?M probe DNAs (Acti23S01-45 and Fne02-45
in Table I) in phosphate-buffered saline (PBS) solution
were spotted on the surface of photonic crystal chips.
The chips were cross-linked by ultra-violet (UV) irradia-
tion (SpectroLinker™UV crosslinker, Krackeler Scientific
Inc., Albany, NY) and incubated at room temperature for
1 h. To remove the unbound probe DNAs, the chips were
washed with PBS solution twice for 1 min and then air-
dried. The target DNAs (15 ?l) were directly mixed with
the 2× PBS solution (15 ?l) and hybridized with chips at
30?C for 6 h. The chips were washed with PBS solution
twice for 1 min and then air-dried.
2.4. Preparation of Proteins and
Biomolecular Interactions
The antigenic surface protein of SARS coronavirus and its
antibody were prepared as previous report.12?13The gold
binding polypeptide (GBP, H2N-MHGKTQATSGTIQS-
COOH)13–15was synthesized by Peptron Inc. (Daejeon,
Korea) according to the manufacturer’s protocol. Gold col-
loid of 5 nm in diameter was purchased from Sigma. All
binding assays were performed with PBS solution for 1 h
at room temperature.
Fig. 1.
Schematic procedure for three-dimensional reflectance biosensor chip in this study.
2.5. Analytical Methods
Scanning
obtained by a Field Emission Scanning Electron Micro-
scope (Philips SEM 535M, Tokyo, Japan) equipped with
a schottky-based field emission gun. The modulation of
the optical reflectance peaks was observed by using a
150 W Xenon lamp as a light source. The reflectance spec-
tra of the opal films were collected by a monochrometer
with a microscope ×10 objective lens (LU Plan, Nikon,
Tokyo, Japan) and a collimation setup, and passed to an
optical detector. Optical images were taken by a CCD
camera (DS-U1, Nikon) mounted on a reflection-mode
microscope (L-150, Nikon). The optical reflectance spec-
tra were observed from the bottom sides of the films. The
angle of incident light was aligned normal to the surface.
electronmicroscopy (SEM)images were
3. RESULTS AND DISCUSSION
3.1. Fabrication and Functionalization of
Colloidal Crystals
Figure 1 illustrates the schematic diagram for the prepa-
ration procedure of a colloidal crystal-coated chip and
the binding strategy of biomolecules. Monodisperse sil-
ica spherical particles were synthesized using sol–gel
reaction16of ethanol and were coated to the glass substrate
by dip coating within 8.5% (w/v) silica emulsion solution.
Following washing and redispersion in distilled water, the
colloidal crystal-coated chip was functionalized with APS
for applying amine coating to the silica surface. The amine
groups interact with various biomolecules through the for-
mation of covalent chemical bond.
634
J. Nanosci. Nanotechnol. 11, 632–637, 2011

Page 4

Delivered by Ingenta to:
Korea Advanced Institute of Science & Technology (KAIST)
IP : 143.248.125.198
Mon, 05 Sep 2011 01:55:22
tron microscopy (SEM) analysis was performed. Figure 2
shows spherical crystals having approximately 720 nm
RESEARCH ARTICLE
Park et al.
Development of Reflective Biosensor Using Fabrication of Functionalized Photonic Nanocrystals
(a)
(b)
Fig. 2.
(b) surface-modified colloidal silica crystals. Enlarged images are located
on the right.
SEM images of (a) colloidal silica photonic crystals and
3.2. Pattern Generation of Crystal
Particles by Dip Coating
To observe the patterns of colloidal crystals, scanning elec-
Fig. 3.
X10 objective lens, Xenon lamp and a collimation setup. The angle of incident light was aligned normal to the surface. Spectrum analysis of photonic
crystals bound to (b) the pathogenic specific probes (Target, F. necrophorum and A. baumannii), (c) the clinically specific probes (Target, SARS
antibody), and (d) the metal (Target, gold nanoparticle).
(a) Optical setup for the reflectance analysis. The reflectance spectra of the opal films were collected by a monochrometer with a microscope
in diameter were assembled in a layer-by-layer pattern
on the glass slide. After functionalization with an amine
group on the surface of crystals, some surround mate-
rials were observed on the crystal patterns causing an
increase of particle size to approximately 785 nm in diam-
eter. This phenomenon may be caused from a formation of
chemical linkers around the crystal surface which causes
an alteration of band-gaps. Furthermore, the facing sur-
face of the silica colloidal crystals showed a hexagonal-
ordered arrangement with a face-centered cubic lattice.
These band-gaps with crystal patterns and photonic prop-
erties of silica colloidal particles could be the cause for
changes in optical reflectance properties, which are used
as signals in the biosensor.
3.3. Optical Biosensor Applications for Detecting
Various Biomolecular Interactions
To observe the characterization of an optical reflectance
spectrum of colloidal crystals, a specific optical instrumen-
tation setup was integrated into the computational analy-
sis system as shown in Figure 3(a). Optical images of
colloidal crystal patterns were taken by a CCD camera
mounted on a reflection-mode microscope. A 150W Xenon
J. Nanosci. Nanotechnol. 11, 632–637, 2011
635

Page 5

Delivered by Ingenta to:
Korea Advanced Institute of Science & Technology (KAIST)
IP : 143.248.125.198
Mon, 05 Sep 2011 01:55:22
the surface antigenic envelope by the SARS-coronavirus
specific polyclonal antibody. SARS is a newly emerged
disease of global significance because of its highly conta-
gious nature. Early detection and identification of SARS
coronavirus-infected patients, and actions to prevent trans-
mission, are absolutely critical in prevention of another
SARS outbreak.17As shown in Figure 3(c), optical scan-
ning spectrum was shifted to the right, indicating that the
diameter of the colloidal crystals was increased by the
binding of biomolecules. Finally, specific binding interac-
tion between metal particles and metal binding polypep-
tides were observed using crystal chips. Figure 3(d) shows
the optical spectra of the sequential binding of GBPs and
gold colloids of 5 nm in diameter. From these results,
we propose that photonic colloidal crystals can be used
for the optical detection of biological interactions, DNA
hybridizations, protein–protein binding, and protein–metal
binding, indicated by the shift in wavelength of optical
spectra.18This allows optical colorimetric detection with
specific optic devices by means of wavelength scanning
and reflectance analysis. These spectra have a localized
surface plasmon resonance (LSPR)-like characteristics,
where the LSPR spectra shift in response to changes in
the refractive index resulting from the absorbance against
the thickness and diameter of nanoparticles on the chip
surface.19Therefore, the colloidal-based LSPR signal may
be used for the quantitative determination of analyte as a
label-free optical biosensor.20?21
RESEARCH ARTICLE
Development of Reflective Biosensor Using Fabrication of Functionalized Photonic Nanocrystals
Park et al.
lamp was used as a light source for the measurement of the
reflectance data collected by an objective lens and passed
to an optical detector.
To examine the detection of specific pathogens on
the amine-coated colloidal crystal chips, two probe
DNAs (Acti23S01-45 and Fne02-45) were immobilized
on the chip and hybridized with three target DNAs from
A. baumannii, F. necrophorum, and K. pneumoniae,
respectively. As shown in Figure 3(b), A. baumannii and
F. necrophorum showed strong signals specific to each
strain at the positions of the corresponding probe DNAs
derived from their respective sequences, suggesting that
microbial pathogens could be specifically detected and
identified. In contrast, no distinctive signal in reflectance
intensity was shown using the target DNAs from K. pneu-
monia as a negative control, which is similar to that
observed with only colloidal crystal without probe DNA
as another negative control. It indicates that nonspecific
adsorption and cross reactivity between probe DNAs and
target DNAs did not occur.
Additionally, antigen–antibody interaction for detect-
ing the SARS was confirmed by sequential binding on
4. CONCLUSIONS
In conclusion, a fabrication method of colloidal crys-
tals on the surface of a glass slide was developed using
monodisperse silica colloidal crystals rapidly packed into
an ordered state without formation of cracks. This col-
loidal crystal chip is useful for simple diagnosis and
biosensors with small amounts of sample. Since the sil-
ica colloidal crystals are complementary to each other
in photonic band-gaps, they could span a wide range of
refractive indices of the solvent media. Also, photonic
crystals with modulated photonic band-gaps employed in
this study can be applied to photonic devices. Finally,
the present crystallization method of colloidal particles
may be employed repeatedly in a high-throughput man-
ner for any number of applications due to the ease in
manufacturing the chips using the dip-coating procedure
in solvent media by means of sensing DNA hybridiza-
tion for pathogen detections, protein–protein interaction
for the SARS detection and gold metal binding. Our con-
cept should be extended to the development of an immobi-
lization matrix as a biomolecular array chip, and thus it is
expected to open new opportunities for nanobiotechnolog-
ical applications, such as in inhibitor screening. While the
photonic crystal biosensor was demonstrated for protein–
protein, DNA–DNA and protein–metal interactions, anal-
ogous experiments with various biomolecular interactions
are also possible.
Acknowledgments: This research was supported by
WCU (World Class University) program through the
National Research Foundation of Korea funded by
the Ministry of Education, Science and Technology
(R322009000101420). Also, it was supported in part by
the IT Leading R&D Support Project from the Ministry of
Knowledge Economy through KEIT.
References and Notes
1. U. Kamp, V. Kitaev, G. Freymann, G. A. Ozin, and S. A. Mabury,
Adv. Mater. 17, 438 (2005).
2. P. Mach, M. Dolinski, K. Baldwin, J. Rogers, C. Kerbage,
C. Windeler, and B. Eggleton, Appl. Phys. Lett. 80, 4294 (2002).
3. T. A. Taton and D. J. Norris, Nature 416, 685 (2002).
4. J. H. Moon, S. Yang, and S.-M. Yang, Appl. Phys. Lett. 88, 121101
(2006).
5. E. Kim, Y. Xia, and G. M. Whitesides, Adv. Mater. 8, 245 (1996).
6. P. Yang, A. H. Rizvi, B. Messer, B. F. Chmelka, G. M. Whitesides,
and G. D. Stucky, Adv. Mater. 13, 427 (2001).
7. S. M. Yang, H. Miguez, and G. A. Ozin, Adv. Funct. Mater. 12, 425
(2002)
8. J. H. Moon, S. Kim, G.-R. Yi, Y. H. Lee, and S.-M. Yang, Langmuir
20, 2033 (2004).
9. M. Abkarian, J. Nunes, and H. A. Stone, J. Am. Chem. Soc.
126, 5978 (2004).
10. L. L. Chan, M. Pineda, J. T. Heeres, P. J. Hergenrother, and B. T.
Cunningham, ACS Chem. Biol. 3, 437 (2008).
11. S. M. Yoo, S. Y. Lee, K. H. Chang, S. Y. Yoo, N. C. Yoo, K. C.
Keum, W. M. Yoo, J. M. Kim, and J. Y. Choi, Mol. Cell. Probes
23, 171 (2009).
12. S. J. Lee, J. P. Park, T. J. Park, S. Y. Lee, S. Lee, and J. K. Park,
Anal. Chem. 77, 5755 (2005).
13. T. J. Park, M. S. Hyun, H. J. Lee, S. Y. Lee, and S. Ko, Talanta
79, 295 (2009).
636
J. Nanosci. Nanotechnol. 11, 632–637, 2011