Reactive oxygen species scavenging by catalase is important for female Lutzomyia longipalpis fecundity and mortality.

Abstract

The phlebotomine sand fly Lutzomyia longipalpis is the most important vector of American visceral leishmaniasis (AVL), the disseminated and most serious form of the disease in Central and South America. In the natural environment, most female L. longipalpis are thought to survive for less than 10 days and will feed on blood only once or twice during their lifetime. Successful transmission of parasites occurs when a Leishmania-infected female sand fly feeds on a new host. Knowledge of factors affecting sand fly longevity that lead to a reduction in lifespan could result in a decrease in parasite transmission. Catalase has been found to play a major role in survival and fecundity in many insect species. It is a strong antioxidant enzyme that breaks down toxic reactive oxygen species (ROS). Ovarian catalase was found to accumulate in the developing sand fly oocyte from 12 to 48 hours after blood feeding. Catalase expression in ovaries as well as oocyte numbers was found to decrease with age. This reduction was not found in flies when fed on the antioxidant ascorbic acid in the sugar meal, a condition that increased mortality and activation of the prophenoloxidase cascade. RNA interference was used to silence catalase gene expression in female Lu. longipalpis. Depletion of catalase led to a significant increase of mortality and a reduction in the number of developing oocytes produced after blood feeding. These results demonstrate the central role that catalase and ROS play in the longevity and fecundity of phlebotomine sand flies.

Full text

Page 1

Reactive Oxygen Species Scavenging by Catalase Is
Important for Female Lutzomyia longipalpis Fecundity
and Mortality
Hector Diaz-Albiter1, Roanna Mitford1, Fernando A. Genta2, Mauricio R. V. Sant’Anna1, Rod J. Dillon1*
1Vector Group, Liverpool School of Tropical Medicine, Liverpool, United Kingdom, 2Instituto Oswaldo Cruz, Fundac ¸a ˜o Oswaldo Cruz and Instituto Nacional de Cie ˆncia e
Tecnologia – Entomologia Molecular, Rio, Brazil
Abstract
The phlebotomine sand fly Lutzomyia longipalpis is the most important vector of American visceral leishmaniasis (AVL), the
disseminated and most serious form of the disease in Central and South America. In the natural environment, most female L.
longipalpis are thought to survive for less than 10 days and will feed on blood only once or twice during their lifetime.
Successful transmission of parasites occurs when a Leishmania-infected female sand fly feeds on a new host. Knowledge of
factors affecting sand fly longevity that lead to a reduction in lifespan could result in a decrease in parasite transmission.
Catalase has been found to play a major role in survival and fecundity in many insect species. It is a strong antioxidant
enzyme that breaks down toxic reactive oxygen species (ROS). Ovarian catalase was found to accumulate in the developing
sand fly oocyte from 12 to 48 hours after blood feeding. Catalase expression in ovaries as well as oocyte numbers was found
to decrease with age. This reduction was not found in flies when fed on the antioxidant ascorbic acid in the sugar meal, a
condition that increased mortality and activation of the prophenoloxidase cascade. RNA interference was used to silence
catalase gene expression in female Lu. longipalpis. Depletion of catalase led to a significant increase of mortality and a
reduction in the number of developing oocytes produced after blood feeding. These results demonstrate the central role
that catalase and ROS play in the longevity and fecundity of phlebotomine sand flies.
Citation: Diaz-Albiter H, Mitford R, Genta FA, Sant’Anna MRV, Dillon RJ (2011) Reactive Oxygen Species Scavenging by Catalase Is Important for Female Lutzomyia
longipalpis Fecundity and Mortality. PLoS ONE 6(3): e17486. doi:10.1371/journal.pone.0017486
Editor: Paulo Ho, Instituto Butantan, Brazil
Received August 11, 2010; Accepted February 7, 2011; Published March 9, 2011
Copyright: ? 2011 Diaz-Albiter et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by Consejo Nacional de Ciencia y Tecnologı ´a (www.conacyt.mx) Fellow ref 207646; The Leverhulme Trust (www.leverhulme.co.
uk) ref F/00 808/C. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: r.j.dillon@liv.ac.uk
Introduction
The phlebotomine sand fly Lutzomyia longipalpis, Lutz and Neiva
1912 is the best studied and most important vector of American
Visceral Leishmaniasis (AVL) [1,2]. It is widely found in Latin
America, from the South of Mexico to the North of Argentina
[3,4]. Lu. longipalpis is a permissive vector to Leishmania infections
[5] and this together with its wide distribution in urban
environments [6] makes this sand fly species an ideal model to
study phlebotomine physiology to help develop future vector
control methods for the disruption of Leishmania transmission.
Previous studies in other blood-feeding insect vectors have
shown that reactive oxygen species (ROS) play an important role
in both reproductive output [7] and survival [8,9,10,11,12].
Biological damage related to ROS production has also been
implicated in the process of ageing in dipterans like Drosophila
melanogaster, previous work done on this species showed that
oxidative stress increases with age, while antioxidant enzyme
activity decreased over time [13,14,15].
ROS are regularly generated by mitochondrial electron
transport [16]. Partially reduced and highly reactive metabolites
of O2such as superoxide anion (O22?) and hydrogen peroxide
(H2O2) are formed during cellular respiration. These partially
reduced metabolites of O2are often referred to as reactive oxygen
species due to their higher reactivity in relation to molecular
oxygen [17]. Excessive release of ROS damages lipids, proteins,
and DNA [18] which leads to oxidative stress, loss of cell function,
and programmed cell death [19]. ROS are also actively released as
a response against bacterial and parasitic pathogens in different
insect species [8,20,21]. To regulate oxidative stress, the
eukaryotic cell produces different ROS-scavenging enzymes, such
as superoxide dismutase (which reduces O22? to H2O2),
glutathione peroxidase and catalase (which reduces H2O2 to
H2O) [17]. Although many studies have been published regarding
mechanisms to resist oxidative stress in Leishmania parasites
[22,23,24,25] there is little information on ROS-scavenging
molecular mechanisms on sand flies, despite the fact that putative
antioxidant enzymes have been found to be upregulated in two
different species of phlebotomine sand flies upon Leishmania
infection [26,27].
In order to investigate the biological role of ROS-scavenging in
fecundity and survival, we analysed the expression of catalase in
three different age groups of female sand flies. Fecundity and
catalase expression decreased with age. Catalase was incriminated
as an important component in the loss of fecundity using RNAi.
Dietary supplementation with an exogenous ROS-scavenger was
found to partially reverse the differences in fecundity and increase
mortality with a concomitant activation of the phenoloxidase (PO)
PLoS ONE | www.plosone.org1March 2011 | Volume 6 | Issue 3 | e17486

Page 2

cascade. These results show that both fecundity and survival are
affected by endogenous and exogenous ROS-scavenging in female
Lutzomyia longipalpis.
Results
Age-related decrease of fecundity
To evaluate the effect of ageing in fecundity, females of different
age groups were blood fed and dissected to examine difference in
developing oocyte numbers. Female Lu. longipalpis from the older
age group showed a decrease in the number of developing oocytes
dissected five days after blood feeding in comparison to younger
sand flies(fig. 1). Female Lu. longipalpis that were bloodfed 3 and 6
days post-emergence (PE) showed no significant difference in
oocyte numbers. However, sand flies bloodfed at 9 days PE
showed a significant decrease in oocyte numbers after dissecting 5
days after blood feeding (fig. 1; P,0.005, ANOVA).
ROS-scavenging reverses age related loss of fecundity
To evaluate the role of ROS scavenging in age-related decrease
of fecundity, 9 day old female Lu. longipalpis were fed a sucrose
meal supplemented with a ROS-scavenger upon emergence until
end of the experiment. Sand flies were offered a 70% sucrose
solution supplemented with 20 mM ascorbic acid and subsequent-
ly blood-fed on day 9 PE. 20 mM ascorbic acid was chosen after
evaluating mortality of sand flies when offered 100, 50, 20, 10 and
5 mM ascorbic acid in 70% sucrose (data not shown). The number
of developing oocytes dissected 5 days after blood feeding was
significantly higher (fig. 2; P,0.0001, t-test) in sand flies that
received a sugar meal supplemented with 20 mM ascorbic acid in
comparison to control sand flies fed on 70% sucrose solution. This
suggests that exogenous ROS-scavenging can reverse age-related
loss of fecundity in sand flies blood fed 9 days PE.
Catalase activity is reduced in developing oocytes of
older flies and ROS scavengers reverse catalase depletion
Flies were assayed at 24 h and 48 h to find out if catalase
accumulated in developing oocytes. Ovaries of Lu. longipalpis
dissected 6 days PE contained higher catalase enzymatic activity at
48 h compared to 24 h after blood feeding (fig. 3A; P,0.0001 , t-
test). Moreover, mRNA expression of catalase increased with
oocyte development from 12 to 48 hours after blood feeding
(fig. 3B).
To further understand the role of endogenous ROS-scavenging
and ageing, flies from different age groups were assayed for
catalase LlonKat1 expression. Flies from different age groups (3, 6
and 9 days PE) showed a decrease in expression in ovaries
dissected at 48 hours after blood feeding (fig 3c; P=0.001,
ANOVA). Interestingly, when 9 day old sand flies were fed with a
20 mM ascorbic acid supplemented sugar meal, catalase LlonKat1
mRNA expression was significantly higher compared to flies of the
same age fed on sucrose only (fig 3c; P,0.002, t-test). The results
show that a) catalase accumulates in the developing oocyte as
shown by increase in enzymatic activity and relative expression, b)
catalase expression is age-dependant and is lower in older flies and
c) the dietary supplementation with an exogenous ROS-scavenger
increases catalase expression in older flies.
Lutzomyia longipalpis catalase sequence was already described
[26,27] and was retrieved from the GenBank (ABV60342.1). It
codes for a protein (named LlonKat1 in this study) with molecular
Figure 1. Effect of age at blood feed on subsequent fecundity
of female Lu. longipalpis. Bars represents average number of oocytes
dissected 5 days after blood meal 6 SEM. Sand flies were blood-fed at
3, 6 and 9 days Post-Emergence. Asterisk indicates statistical difference
at P,0.005 (ANOVA). Results represent two independent biological
replicates.
doi:10.1371/journal.pone.0017486.g001
Figure 2. Effect of ascorbic acid supplementation on fecundity
in Lu. longipalpis. Flies were blood-fed 9 days Post-Emergence and bar
chart represents average number of oocytes dissected 5 days after
blood meal 6 SEM (combined samples derived from 2 independent
experiments). Sand flies fed on 20 mM ascorbic acid-supplemented
70% sucrose solution show significantly higher oocyte numbers in
comparison to control sand flies (P,0.0001, t-test).
doi:10.1371/journal.pone.0017486.g002
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org2March 2011 | Volume 6 | Issue 3 | e17486

Page 3

mass of 57682 Da and isoelectric point of 8.28, without a signal
peptide and mitochondrial or peroxisomal targeting sequences of
types 1 and 2. LlonKat1 has high identity (ranging from 46–73%)
to catalase sequences from other insects, crustaceans, yeast and
mammals and lower identity to the bacterial catalase from
Pseudomonas syringae (fig. 4). LlonKat1 sequence contains the
conserved residues His73 and Asn147 (catalytic), Ser113,
Val115, Phe152, Phe160, Leu298, Met349, Arg353, Tyr357
(heme binding/coordination) and His193, Arg202, Ile301, Gln304
(putative NADPH binding pocket) (fig. 4).
Catalase gene RNAi mediated depletion leads to a
decrease in sand fly fecundity
The gene sequence of Lu. longipalpis catalase was obtained from
a cDNA library constructed from sand fly whole bodies (NSFM-
142e04.q1k [27]) and aligned with a previous described catalase
obtained from Lu. longipalpis midguts (GenBank Accession number:
EU124624.1) , showing a high level of identity (99%) and
similarity (99%) (fig. S1). As any other sequence from Lu. longipalpis
was identified as putative catalase, either in the whole body or
midgut cDNA libraries, this gene is probably a single copy gene in
Lu. longipalpis. To confirm the role of endogenous ROS-scavenging
in fecundity catalase was depleted using RNAi. Flies injected with
144 ng of dsRNA for catalase (dsCAT) showed a dramatic
decrease in oocyte number dissected 48 hours after blood feeding
(fig. 5A; P,0.005, ANOVA) compared to sand flies injected with a
non-related dsRNA (dsGFP) and uninjected sand flies. A change in
appearance of ovaries was observed during dissections with
matured ovaries, in sand flies injected with dsRNA for catalase,
appearing underdeveloped in comparison to both mock-injected
and uninjected controls (fig. 5B). A dsRNA-mediated significant
reduction in catalase expression in whole flies was observed by
RT-PCR (fig. 5C), with no effects on the catalase expression in the
midgut (data not shown). These results confirm that endogenous
ROS-scavenging in developing oocytes plays a major role in
female Lu. longipalpis fecundity.
Effect of ROS-scavenging in the survival of sand flies
To evaluate the role of exogenous ROS scavenging in survival,
female Lu. longipalpis were fed with an antioxidant-supplemented
sugar meal upon emergence. Mortality was recorded from day 1 PE
up to day 7 PE. Survival curves depict an increase in mortality due
Figure 3. Changes in catalase in the developing oocyte of Lu. longipalpis. (A) Catalase activity of developing oocytes after blood feeding. Six
day old female Lu. longipalpis were blood-fed and dissected at 24 and 48 hours. Enzymatic activity in the developing oocytes was significantly higher
at 48 hours compared to 24 hours after blood feeding (P,0.0001 , T-test). Bar charts represent mean 6 SE of combined samples from 2 independent
experiments. (B) Relative expression of catalase LlongKat1 mRNA in developing oocytes dissected at 12, 24 and 48 hours from 6 days-old blood-fed
female Lu longipalpis, (n=three groups of 20 females each). Asterisk indicates statistical difference at P,0.05 (ANOVA). Bar charts represent mean 6
SEM of combined samples from 2 independent experiments. (C) Age-related decrease of catalase mRNA relative expression in developing oocyte.
Flies were blood-fed at 3, 6 and 9 days Post-Emergence (n=three groups of 15 females each) and whole ovaries were dissected 48 hours after blood
feeding. Relative expression was statistically different in all 3, 6 and 9 days old flies (P=0.001, ANOVA). A 4thgroup (n=15 females) fed on an ascorbic
acid-supplemented sugar solution upon emergence (9-AscA) showed catalase relative expression levels similar to groups of younger flies fed on 70%
sucrose solution, and statistically higher than the non-treated, 9 DPE group (P,0.002, t-test). Bar charts represent mean 6 SEM of combined samples
from 2 independent experiments.
doi:10.1371/journal.pone.0017486.g003
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org3March 2011 | Volume 6 | Issue 3 | e17486

Page 4

to exogenous ROS-scavenging by an exogenous antioxidant
(fig. 6A). In order to assess whether the higher mortality rate was
related to an effect on sand fly immune homeostasis , phenoloxidase
(PO) activity was measured in control and antioxidant-supplement-
ed females. Spontaneous PO is defined as the activity measured
upon reaction with 3,4 dihydroxy-DL-phenylalanine (DOPA), and
corresponds to the enzyme that is already activated in physiological
conditions and total activity was the activity observed after in vitro
activation of the enzyme, by preincubating the sample with bovine
trypsin. Sand flies fed on ascorbic acid-supplemented sucrose
showed a significant increase in spontaneous PO (fig. 6B; P,0.05 ,
t-test) but no difference in total PO activity.
To further investigate if ROS-scavenging was implicated in
increased mortality, catalase LlonKat1 was depleted via RNAi
injection in female Lu. longipalpis and mortality was recorded from
day 1 PE up to day 7 PE. Mortality rates was higher in knocked
down (dsCAT) sand flies (fig. 7), compared to flies injected with a
non-related dsRNA (dsGFP) and non-injected flies. These results
show that ROS-scavenging by either endogenous or exogenous
antioxidants play an important role in female Lu. longipalpis survival.
Discussion
The present study suggests for the first time that catalase-
mediated ROS scavenging has a significant impact on female Lu.
longipalpis fecundity and survival. Female Lu. longipalpis from
different age groups showed differences in developing oocytes
numbers, with the oldest (9 days PE) presenting the lowest number
of oocytes (fig. 1). The age-related loss of fecundity could be
reversed with dietary supplementation of a potent exogenous
ROS-scavenger (fig. 2). This underlines the importance of catalase
in the reproductive success of blood sucking dipterans. Evidence
from other dipterans show that aging results in increase of
oxidative stress and loss of enzymatic antioxidant efficiency
[13,14,28]. Moreover, inactivation or silencing of catalase in
Drosophila melanogaster [29], Musca domestica [30], Rhodnius prolixus
[31]and Anopheles gambiae [9] led to increased mortality due to
increase in ROS levels. It is likely that accumulation of ROS in
older flies could account for the decrease of female sand fly
fecundity due to an increase in oxidative stress, loss of antioxidant
enzymatic efficiency or both. In An gambiae, fecundity of female
Figure 4. Amino acid sequence alignment of selected catalases. Sequences were retrieved from GenBank (GB), Protein Data Bank (PDB) or
from Peroxibase (PB). The listed proteins are respectively from Lutzomyia longipalpis (GB:ABV60342.1), Aedes aegypti (PB:5267), Anopheles gambiae
(PB:5269), Bombyx mori (PB:5266), Drosophila pseudoobscura (PB:5273), Haemonchus contortus (PB:5270), D. melanogaster (GB:NP_536731.1), Glossina
morsitans morsitans (GB:ADD20421.1), Culex quinquefasciatus (GB:XP_001848573.1), Penaeus vannamei (PB:5278), Saccharomyces cerevisiae
(PDB:1A4E), Bos taurus (PDB:8CAT), Pseudomonas syringae (PDB:1M7S). Conserved residues in catalases are with black background, consensus
alternatives are shaded. The symbols ., +, and * mark catalytic, heme binding and NADPH binding residues, respectively. The symbol # mark
residues that define heme orientation. All sequences are from clade 3 of monofunctional catalases, with the exception of Psyr, which is a clade 2
enzyme. In catalases from clade 2 (Psyr numbering), heme orientation (His-IV) is defined by residues 301 (never Leu) and 350 (frequently Leu). In
catalases from clade 3, these positions are commonly occupied by Leu and non-Leucine residues, respectively. NADPH binding catalases have the
signature (Btau numbering) His 193, Arg 202, Val 301 and His 304, which is not present in catalases from clades 1 (not shown) and 2 (Psyr). Insect
catalases share some of the NADPH binding residues, but not all. However, catalytic residues and heme binding residues are fully conserved in all
sequences.
doi:10.1371/journal.pone.0017486.g004
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org4March 2011 | Volume 6 | Issue 3 | e17486

Page 5

mosquitoes declined with age, with reduction of number of eggs
oviposited and number of larvae hatched per female [7]. We did
not measure differences in fecundity in terms of larval develop-
ment but it is likely that the age-related differences in fertility
would have resulted in less viable larvae being produced from
older flies, as they would be presumably exposed for a longer
periods to oxidative damage.
Catalase enzymatic activity as well as catalase LlonKat1 mRNA
relative expression increased in the ovaries of older female sand
flies (6 days PE) after the blood feeding (figs. 3a and b). Protein
expression and accumulation increased upon blood feeding in
maturing ovaries of mosquitoes due to nutrient allocation for egg
production [32,33]. It has been shown in different insect species
that antioxidant activity increases in the ovaries to protect the
embryo from oxidative damage [34,35]. It is conceivable that such
Figure 5. RNAi-mediated depletion of catalase LlonKat1 in
female Lu. Longipalpis and its effect on fecundity. (A) Average
number of developing oocytes dissected 48 hours days after blood
meal 6 SEM (combined samples derived from 2 independent
experiments). Asterisk indicates statistical significance at P,0.005(AN-
OVA). (B) Relative development of female Lu. longipalpis ovaries
observed upon catalase gene knockdown by RNAi, in comparison to
mock-injected and uninjected control sand flies. Bar=1 mm. (C)
Relative expression of catalase LlongKat1 mRNA in whole fly
homogenates from dsRNA-injected catalase knock-down sand flies.
Bar charts represent mean 6 SEM of combined samples from at least 2
independent experiments. Asterisk indicates statistical difference at
P,0.05 (ANOVA).
doi:10.1371/journal.pone.0017486.g005
Figure 6. Effect of dietary supplementation of ascorbic acid on
mortality of sugar fed Lu. longipalpis. (A) Female sand flies were
offered a 70% sucrose solution supplemented with 20 mM ascorbic
acid or a non-supplemented sucrose solution. Experimental flies
(sucrose +20 mM ascorbic acid) exhibited a significantly lower survival
rate compared to control flies, (p,0.001, Kaplan-Meier, Log Rank x2
test). (B) Spontaneous and total phenoloxidase (PO) activity in Lu.
longipalpis females after 7 days of feeding with 70% sucrose solution or
70% sucrose solution supplemented with 20 mM ascorbic acid.
Spontaneous PO activity in ascorbic acid supplemented flies was
significantly higher than control flies (P,0.05 , T-test). Results are mean
6 SEM from 2 independent experiments with 10 sand flies per
experiment.
doi:10.1371/journal.pone.0017486.g006
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org5 March 2011 | Volume 6 | Issue 3 | e17486

Page 6

accumulation of catalase in sand fly ovaries also provides the
means to protect developing eggs from oxidative damage.
Additional support for this hypothesis was given by the dramatic
decrease in developing oocyte numbers upon successful catalase
gene depletion by RNAi in female sand flies (fig. 5A and b).
Interestingly, oral delivery of ascorbic acid seemed to stimulate
catalase LlonKat1 mRNA expression in older flies to levels similar
to that of younger flies (fig. 3C). It has been shown that age-related
accumulation of ROS/oxidative stress leads to loss of efficiency in
cellular processes [13,14,15,28,36], therefore it is possible that
ROS-scavenging by an exogenous antioxidant slowed or lowered
such deleterious effects in either catalase LlonKcat1 mRNA or in
other molecules involved in its upregulation. On the other hand, it
has been shown that ascorbate is a potent inhibitor of catalase
[37], the inhibition being independent of substrate concentration
and pH and strongly influenced by temperature. Furthermore,
catalase incubation with ascorbate leads to degradative changes to
the catalase molecule [38]. In our experiments, the increase in
catalase gene expression might reflect a compensation response to
replenish normal catalase levels in the sand fly body after catalase
was degraded, by an unknown mechanism, during ascorbic acid
supplementation with the sugar meal.
Catalase LlonKcat1 does not have a signal peptide or targeting
sequences to mitochondria or peroxisomes. These features suggest
a cytosolic location but this needs confirmation. Based on the
identities with other catalases retrieved from Peroxibase [39],
LlonKat1 seems to belong to the monofunctional clade 3 of
catalases, which includes sequences from bacteria, archaebacteria,
protists, fungi, plants and animals. These enzymes have small
subunits with molecular mass ranging from 43–75 kDa [40],
which is consistent with LlonKat1 monomer predicted molecular
mass (57.7 kDa). All conserved catalytic and heme binding
residues are present in LlonKat1 sequence, suggesting a full
catalytic activity, and the presence of residues Leu298, Met349
indicate that His70 is above the ring III of the heme molecule (His-
III orientation), as seen in other clade 3 catalases [41].
ROS-scavenging by dietary supplementation of ascorbic acid
(fig. 6a) led to a reduction in sand fly survival. When antioxidants
were provided to a susceptible strain of Anopheles gambiae to
Plasmodium infection, a similar but more drastic effect was observed
with female mosquitoes [7]. Magwere et al. [42] observed that
antioxidant supplementation did not extend the lifespan of wild
type Drosophila. Similarly, Bayne et al. [43] showed that
overexpression of MnSOD and catalase, despite protecting
Drosophila from oxidative stress, were detrimental for lifespan and
physical fitness of the insects. Kang et al. [44] observed a reduction
in the lifespan of Anopheles stephensi when the mosquitoes were
bloodfed with the antioxidant MnTBAP in comparison with the
buffer control. It has been hypothesized that a minimal level of
ROS might be required to maintain the balance of the gut
microbiota and that a baseline level of ROS activity might be
crucial for basic midgut physiology. Previous studies done with
other dipteran species had showed that ROS release constitutes a
first line of defence against pathogens in the midgut [45].
Experiments in D. melanogaster have demonstrated the existence
of a midgut-specific active ROS releasing system against orally
delivered bacteria [8]. In the present study, higher activities of
spontaneous PO were recorded and this might be due to an
increase in microbial infection associated with sand flies that fed
on an ascorbic acid-supplemented sugar meal. In insects, PPO
activation is often related to bacterial or fungal infections [45].
Since only the soluble form of PO was measured (see Material and
Methods), it is more likely that the activity was related to the
immune response rather than to the melanisation of the adult
cuticle or egg shell. PO has already been described in gut tissues or
adhered hemocytes in other dipterans [46]. It is possible that
mortality in our experimental group fed with sucrose supplement-
ed with ascorbic acid may be due to a decrease in ROS production
inside the midgut and that ROS activity, similar to the events in
certain strains of mosquitoes, may play a role in sand fly immunity
towards opportunistic microbes or be involved in important
cellular signalling pathways [47,48].
There is evidence of other antioxidant enzymes with catalase-
like functions found in the sand fly midgut, such as peroxiredoxins
[26,27]. These are a family of thioredoxin-dependent peroxidases,
found in several insect species [49,50,51,52], that function as
ROS-scavengers as well as other cellular processes. However their
efficiency in converting H2O2was found to be significantly lower
compared to catalase [53]. We are currently investigating the role
of these antioxidant enzymes in ROS detoxification and fecundity
and survival of female sand flies, as well as studies to confirm if
proliferation of bacteria due to ROS reduction could account for
the differences in sand fly survival.
Recent studies on transgenic Anopheles stephensi (the leading malaria
vector in India and parts of Asia and the Middle East) overexpressing
the protein kinase AKT gene increased the insulin signalling in the
mosquito midgut, significantly reducing mosquito lifespan and
inhibiting P. falciparum development [54]. The role of genes involved
in stress responses in Plasmodium survival within the mosquito midgut
was investigated by Jaramillo-Gutierrez et al. [55]. RNAi gene
knockdown of the OXR1 gene (oxidation resistance gene) in Anopheles
gambiaeshowed that this gene regulates the basal levelsof catalase and
glutathione peroxidase expression and that OXR1 gene knockdown
decreased Plasmodium berghei oocyst formation. The finding of a Lu.
longipalpis OXR1 gene homologue (unpublished) will shed some light
intotheregulationofROSproductionwithinthesandflygutandwill
also help to understand how ROS production impacts Leishmania
development in the sand fly midgut.
Figure 7. Survival in female Lu. Longipalpis after RNAi-mediated
depletion of catalase LlonKat1. Experimental group (dsCAT)
exhibits a significantly lower survival rate compared to both dsGFP
and pricked control groups, (P,0.0001, Kaplan-Meier, Log Rank x2test).
Results represent mean 6 SEM of 3 independent biological replicates.
doi:10.1371/journal.pone.0017486.g007
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org6 March 2011 | Volume 6 | Issue 3 | e17486

Page 7

Current vector control strategies rely on spraying of residual
insecticides to control vector population. Insect transgenesis and
paratransgenesis are novel strategies that aim at reducing insect
vectorial capacity by using genetic manipulation of disease vectors,
rendering them incapable or less efficient to transmit a given
pathogen [56] or even reducing the longevity and fecundity of a
given insect vector. This study shows that catalase is a key gene in
determining survival and fecundity of phlebotomine sand flies and
future developments may warrant this gene being included as a
potential target to reduce female sand fly fitness and reproductive
capacity in the field.
Materials and Methods
Insects
All experiments were carried out using insectary-reared Lu.
longipalpis from a colony first started with individuals caught in
Jacobina, Brazil. Insects were kept under standard laboratory
conditions [57]. Insects were fed with 70% w/v sucrose solution in
cotton wool (unless stated differently in experiments), kept under a
photoperiod of 8 hours light/16 hours darkness, temperature of
27uC (62) and a relative humidity of .80% inside the rearing
cages. Rabbit blood feeding was via a Hemotek membrane feeder
(Discovery Workshops, UK) at 37uC. All procedures involving
animals were performed in accordance with UK Government
(Home Office) and EC regulations.
Fecundity assays
Female Lu. longipalpis were allowed to mate under regular
rearing conditions and fed with rabbit blood at three, six and nine
days post-emergence (DPE). A batch of .500 flies was released
into a large (20 m3) rearing cage and groups of ,100 individuals
were transferred to medium sized cages (5 m3) at 3, 6 and 9 DPE
and blood-fed as above. Fifteen fully-engorged females were then
transferred to a new medium rearing cage. Insects were dissected
five days later to count developing oocytes.
ROS-scavenger feeding
Fecundity assays were carried out as described above with
female Lu. longipalpis fed on a 70% sucrose solution supplemented
with 20 mM ascorbic acid and blood-fed at 9 DPE. Supplemented
sucrose-meal was freshly changed daily and continued after blood-
feeding. A 9 DPE control group was reared under the same
conditions but fed with a 70% sucrose solution. Only fully
engorged insects from both groups were selected for the
experiments.
Ovarian Catalase Activity
Ovaries were collected from 5 female sand flies at 24 and 48 hrs
post blood feeding (PBF). Samples were homogenised in 50 ul of
0.15 M NaCl solution, kept on ice and transferred to a 280uC
freezer until needed. Before assays, samples were centrifuged at
5000 RPM for 2 minutes and 1 ml of the supernatant was diluted
in 24.9 ml of 0.15 M NaCl solution. Catalase activity was
determined using Amplex Red Catalase Assay Kit (Invitrogen
Ltd) following the manufacture’s protocol. Enzyme-specific
activities were expressed as units/mg of protein. One unit of
catalase activity was defined as 1 mM of H2O2 consumed per
minute. All assays were carried out in triplicate. Fluorescence was
measured using a Varioskan fluorescence spectrometer (Thermo
Electron) with an excitation wavelength of 560 nm and an
emission wavelength of 590 nm. Ovarian catalase activity was
normalised using the total amount of protein in the whole body
(minus dissected ovaries) using the BIORADH Protein assay
reagent following the manufacturer’s protocol and using bovine
serum protein as standard. Endpoint absorbance was measured at
595 nm in a 96 well plate with a microplate reader (VersaMax
Microplate Reader, Molecular Devices Inc.).
Ovarian Catalase Expression
Six DPE sand flies were blood fed and ovaries from 10 sand flies
(two pools of 5 flies) were dissected at 12, 24 and 48 hours PBF,
homogenised in 50 ml of TRI ReagentH (Ambion, Austin, TX) and
kept at 280uC until needed. RNA was extracted following the
manufacturer’s protocol. Total RNA was quantified using a
NanodropH(NanoDrop Technologies, Wilmington, USA) and
normalised to 10 ng/ml. RT-PCR was carried out with Super-
ScriptH III One-Step RT-PCR System with PlatinumH Taq DNA
Polymerase Kit (Invitrogen, San Diego, CA) performing 19 cycles
and following the manufacture’s protocol (primers listed on
table 1). Relative expression of catalase was normalised using a
housekeeping gene (AM088777, 60S ribosomal protein L3). RT-
PCR products were analysed by 1.5% agarose/ethidium bromide
gel electrophoresis and reduction in catalase expression was
determined by densitometric measurement of bands using the
softwares GeneSnap/GeneTools (Syngene, UK).
Age-related expression of ovarian catalase
To measure catalase LlongKat1 mRNA expression levels in
different age groups, 3, 6 and 9 DPE sand flies were blood fed and
ovaries from 10 sand flies (two pools of 5 flies) were dissected at
48 hours PBF. Additionally, to evaluate the effect of feeding a
ROS-scavenger in age-related expression of ovarian catalase, a
Table 1. Oligonucleotides for dsRNA synthesis and Reverse Transcriptase PCR.
Oligonucleotide59-39sequenceSize (bp)
dsCAT484 Forward TAATACGACTCACTATAGGGTGTTGCAGGGACGTCTCTTTGCC 524
dsCAT484 reverseTAATACGACTCACTATAGGGAGGTTGGAGCACTTCTTGCGTTCG
dsGFP ForwardTAATACGACTCACTATAGGGACGTAAACGGCCACAAGTTC 693
dsGFP Reverse TAATACGACTCACTATAGGGCTTGTACAGCTCGTCCATGCC
RT CAT484 Forward TGTTGCAGGGACGTCTCTTTGCC484
RT CAT484 ReverseAGGTTGGAGCACTTCTTGCGTTCG
RT Ribo60S ForwardTCTCATCGGAAGTTTTCTGC850
RT Ribo60 ReverseGGCTTGTGACACCCTTGAAT
doi:10.1371/journal.pone.0017486.t001
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org7March 2011 | Volume 6 | Issue 3 | e17486

Page 8

group of 9 days old sand flies was fed with ascorbic acid-
supplemented sucrose solution as described above, blood fed and
dissected at 48 hours. RNA was extracted and checked for catalase
relative expression as above.
RNAi-mediated catalase knockdown
Sense and anti-sense catalase-specific primers flanked by the T7
promoter site (Table 1) PCR amplified a 484 bp product from a
plasmid obtained from a whole body Lu. longipalpis normalised
cDNA library [27] that was used as template for double-stranded
RNA synthesis dsRNA. Transcription reactions and column
purification were carried out using the Megascript RNAi Kit
(AmbionH) following the manufacturer’s protocol. dsRNA purity
was assessed by 1.5% agarose/ethidium bromide gel electropho-
resis and dsRNA was quantitated using a Nanodrop ND-1000
Spectrophotometer (LabTech, UK). dsRNA was eluted with
nuclease-free water at 65uC, concentrated to 4.5 mg/mL with a
ChristH RVC 2–25 rotational vacuum concentrator and stored at
280uC until needed. Enhanced Green Fluorescent protein (eGFP)
dsRNA was produced from a 653 bp amplicon of the pEGFP-N1
expression plasmid (Clontech) and used as a ‘mock’ injected
control. RNAi was achieved by dsRNA injections as previously
described [58]. After injections, sand flies were transferred to cages
and kept with access to 70% sucrose solution ad libitum. Developing
oocytes were dissected and counted 48 hours after blood feeding.
Non-injected flies of the same age and kept under the same
conditions were used as second control. Three pools of three whole
sand flies were collected from each group to evaluate knockdown
by RT-PCR.
Survival assays
To assess sand fly survival mediated by ROS-scavenging related
to catalase activity, RNAi-mediated catalase knock down was
carried out in a group of 50 sand flies. Flies were injected with
dsRNA for catalase (dsCAT) as described above. To exclude
wound-related mortality, all dead flies at 24 hrs post-injections
were removed and were not included in the experiment. Dead
sand flies were counted and removed from the cage daily from day
2 to 7 after injection. Flies injected with dsRNA for GFP (dsGFP)
and a needle-pricked group were used as controls. To assess
exogenous ROS-scavenging related survival, 50 female Lu.
longipalpis were collected upon emergence and sugar fed on a
70% w/v sucrose solution supplemented with 20 mM ascorbic
acid. Dead sand flies were counted and removed from the cage
every day until day seven. A group of sand flies fed with 70%
sucrose was used as a control.
Phenoloxidase assays
Phenoloxidase activity was determined by measuring the
production of dopachrome from 3,4 dihydroxy-DL-phenylalanine
(DOPA) [59,60]. Briefly, single flies were homogenized in 60 mL of
PBS and centrifuged at 25,000 g for 5 min at 4uC to recover the
soluble fraction. 20 mL of supernatant was mixed with 10 mL of
PBS (spontaneous PO) or trypsin solution (for total PO activity;
1 mg/mL in PBS, FLUKA cat. no. 93614), incubated for 20 min
at 37uC followed by the addition of 20 mL of a saturated solution
of DOPA (4 mg/mL in PBS) and absorbance (490 nm) measured
by kinetic assay for 1 h at 5 minutes intervals in a microplate
reader at 30uC.
The PO activity was measured to ensure that activity was
proportional to protein concentration and incubation time.
Independent experiments showed that the PO activity was stable
in the conditions above. Controls with no enzyme or no substrate
were included. One unit of enzyme (U) is defined as the amount
that produces 0.001 unit of absorbance/min.
Sequence analysis
The coding sequence of LlonKat1 was analyzed using the
algorithms pI/Mw tool [61] , signal IP [62], PTS1 Predictor [63],
PeroxiP [64], TargetP [62] based at the EXPASY Proteomics
Server (http://expasy.org/). Selected amino acid sequences of
catalases were aligned with catalase LlonKat1 using the ClustalW
Multiple Alignment tool in BioEdit Sequence Alignment Editor
(http://www.mbio.ncsu.edu/BioEdit/BioEdit.html).
was generated using Boxshade (http://www.ch.embnet.org/
software/BOX_form.html).
Alignment
Statistical analysis
Comparisons between means of two independent groups were
carried put using a pair-wise t-test. Multiple comparisons were
done by one-way ANOVA. Survival curves were analyzed with
the Kaplan-Meier Log Rank x2test. Significance was considered
when P,0.05. All data were analysed with the use of the SPSS
Data Editor software (version 17.0, SPSS Inc).
Supporting Information
Figure S1
sequence of Lutzomyia longipalpis catalase, translated
from a whole body (GeneDB NSFM-142e04.q1k [27]) and
a midgut-specific(GenBank
EU124624.1 [26]) cDNA library. Sequences show a 99%
identity and a 99% similarity. . Represents the targeted region for
dsRNA-mediated gene silencing.
(DOC)
Structure-based alignment of the aminoacid
Accession number:
Acknowledgments
We thank Davina Moor for her technical assistance.
Author Contributions
Conceived and designed the experiments: HDA MRVS FAG RJD.
Performed the experiments: HDA RM FAG. Analyzed the data: HDA RM
FAG. Contributed reagents/materials/analysis tools: RJD. Wrote the
paper: HDA MRVS FAG RJD.
References
1. Lainson R, Rangel E (2005) Lutzomyia longipalpis and the eco-epidemiology of
American visceral leishmaniasis, with particular reference to Brazil: a review.
Memo ´rias do Instituto Oswaldo Cruz 100: 811–827.
2. Soares RPP, Turco SJ (2003) Lutzomyia longipalpis (Diptera: Psychodidae:
Phlebotominae): a review. Anais da Academia Brasileira de Cie ˆncias 75: 301–330.
3. Grimaldi G, Tesh RB (1993) Leishmaniases of the New World: current concepts
and implications for future research. Clinical Microbiology Reviews 6: 230–250.
4. Romero GAS, Boelaert M (2010) Control of Visceral Leishmaniasis in Latin
America: A Systematic Review. PLoS Negl Trop Dis 4: e584.
5. Myskova J, Svobodova M, Beverley S, Volf P (2007) A lipophosphoglycan-
independent development of Leishmania in permissive sand flies. Microbes and
infection 9: 317–324.
6. Costa C (2008) Characterization and speculations on the urbanization of visceral
leishmaniasis in Brazil. Cadernos de Sau ´de Pu ´blica 24: 2959–2963.
7. DeJong RJ, Miller LM, Molina-Cruz A, Gupta L, Kumar S, et al. (2007)
Reactive oxygen species detoxification by catalase is a major determinant of
fecundity in the mosquito Anopheles gambiae. Proceedings of the National
Academy of Sciences 104: 2121.
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org8March 2011 | Volume 6 | Issue 3 | e17486

Page 9

8. Ha E-M, Oh C-T, Ryu J-H, Bae Y-S, Kang S-W, et al. (2005) An Antioxidant
System Required for Host Protection against Gut Infection in Drosophila.
Developmental Cell 8: 125–132.
9. Magalhaes DEB T, Beier JC, Foy BD (2008) Silencing an Anopheles gambiae
catalase and sulfhydryl oxidase increases mosquito mortality after a blood meal.
Archives of Insect Biochemistry and Physiology 68: 134–143.
10. Graca-Souza AV, Maya-Monteiro C, Paiva-Silva GO, Braz GR, Paes MC, et al.
(2006) Adaptations against heme toxicity in blood-feeding arthropods. Insect
Biochem Mol Biol 36: 322–335.
11. Citelli M, Lara FA, Vaz IS, Oliveira PL (2007) Oxidative stress impairs heme
detoxification in the midgut of the cattle tick, Rhipicephalus (Boophilus)
microplus. Molecular & Biochemical Parasitology 151: 81–88.
12. Walshe DP, Ooi CP, Lehane MJ, Haines LR, Stephen JS, et al. (2009) Chapter
3 The Enemy Within: Interactions Between Tsetse, Trypanosomes and
Symbionts Advances in Insect Physiology: Academic Press. pp 119–175.
13. Das N, Levine R, Orr W, Sohal R (2001) Selectivity of protein oxidative damage
during aging in Drosophila melanogaster. Biochemical Journal 360: 209.
14. Sohal R, Arnold L, Orr W (1990) Effect of age on superoxide dismutase,
catalase, glutathione reductase, inorganic peroxides, TBA-reactive material,
GSH/GSSG, NADPH/NADP+ and NADH/NAD+ in Drosophila melanoga-
ster. Mechanisms of Ageing and Development 56: 223–235.
15. Ferguson M, Mockett R, Shen Y, Orr W, Sohal R (2005) Age-associated decline
in mitochondrial respiration and electron transport in Drosophila melanogaster.
Biochemical Journal 390: 501.
16. Loft S, Vistisen K, Ewertz M, Tjonneland A, Overvad K, et al. (1992) Oxidative
DNA damage estimated by 8-hydroxydeoxyguanosine excretion in humans:
influence of smoking, gender and body mass index. Carcinogenesis 13:
2241–2247.
17. Thannickal VJ, Fanburg BL (2000) Reactive oxygen species in cell signaling.
American Journal of Physiology-Lung Cellular and Molecular Physiology 279:
L1005–L1028.
18. Freeman BA, Crapo JD (1982) FREE-RADICALS AND TISSUE-INJURY.
Laboratory Investigation 47: 412–426.
19. Nordberg J, Arner ESJ (2001) Reactive oxygen species, antioxidants, and the
mammalian thioredoxin system. Free Radical Biology and Medicine 31:
1287–1312.
20. Leto TL, Geiszt M (2006) Role of Nox family NADPH oxidases in host defense.
Antioxidants & Redox Signaling 8: 1549–1561.
21. Molina-Cruz A, DeJong RJ, Charles B, Gupta L, Kumar S, et al. (2008)
Reactive Oxygen Species Modulate Anopheles gambiae Immunity against
Bacteria and Plasmodium. Journal of Biological Chemistry 283: 3217.
22. Miller MA, McGowan SE, Gantt KR, Champion M, Novick SL, et al. (2000)
Inducible Resistance to Oxidant Stress in the Protozoan Leishmania chagasi.
Journal of Biological Chemistry 275: 33883–33889.
23. Levick MP, Tetaud E, Fairlamb AH, Blackwell JM (1998) Identification and
characterisation of a functional peroxidoxin from Leishmania major. Molecular
and Biochemical Parasitology 96: 125–137.
24. Mandal G, Wyllie S, Singh N, Sundar S, Fairlamb AH, et al. (2007) Increased
levels of thiols protect antimony unresponsive Leishmania donovani field isolates
against reactive oxygen species generated by trivalent antimony. Parasitology
134: 1679–1687.
25. Mehta A, Shaha C (2006) Mechanism of metalloid-induced death in Leishmania
spp.: Role of iron, reactive oxygen species, Ca2+, and glutathione. Free Radical
Biology and Medicine 40: 1857–1868.
26. Jochim RC, Teixeira CR, Laughinghouse A, Mu J, Oliveira F, et al. (2008) The
midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA
libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum
chagasi-infected sand flies. BMC Genomics 9: 15.
27. Dillon RJ, Ivens AC, Churcher C, Holroyd N, Quail MA, et al. (2006) Analysis
of ESTs from Lutzomyia longipalpis sand flies and their contribution toward
understanding the insect-parasite relationship. Genomics 88: 831–840.
28. Yan LJ, Sohal RS (2000) Prevention of flight activity prolongs the life span of the
housefly, Musca domestica, and attenuates the age-associated oxidative damage
to specific mitochondrial proteins. Free Radical Biology and Medicine 29:
1143–1150.
29. Mackay W, Bewley G (1989) The genetics of catalase in Drosophila
melanogaster: isolation and characterization of acatalasemic mutants. Genetics
122: 643.
30. Allen R, Farmer K, Sohal R (1983) Effect of catalase inactivation on levels of
inorganic peroxides, superoxide dismutase, glutathione, oxygen consumption
and life span in adult houseflies (Musca domestica). Biochemical Journal 216:
503.
31. Paes M, Oliveira M, Oliveira P (2001) Hydrogen peroxide detoxification in the
midgut of the blood-sucking insect, Rhodnius prolixus. Archives of Insect
Biochemistry and Physiology 48: 63–71.
32. Wheeler D (1996) The role of nourishment in oogenesis. Annual Review of
Entomology 41: 407–431.
33. Ahmed A, Baggott S, Maingon R, Hurd H (2002) The costs of mounting an
immune response are reflected in the reproductive fitness of the mosquito
Anopheles gambiae. Oikos. pp 371–377.
34. Logullo C, Moraes J, Dansa-Petretski M, Vaz IS, Masuda A, et al. (2002)
Binding and storage of heme by vitellin from the cattle tick, Boophilus microplus.
Insect Biochemistry and Molecular Biology 32: 1805–1811.
35. Freitas DRJ, Rosa RM, Moraes J, Campos E, Logullo C, et al. (2007)
Relationship between glutathione S-transferase, catalase, oxygen consumption,
lipid peroxidation and oxidative stress in eggs and larvae of Boophilus microplus
(Acarina: Ixodidae). Comparative Biochemistry and Physiology - Part A:
Molecular & Integrative Physiology 146: 688–694.
36. Sohal R, Agarwal S, Dubey A, Orr W (1993) Protein oxidative damage is
associated with life expectancy of houseflies. Proceedings of the National
Academy of Sciences of the United States of America 90: 7255.
37. Orr C (1967) Studies on Ascorbic Acid. I. Factors Influencing the Ascorbate-
Mediated Inhibition of Catalase*. Biochemistry 6: 2995–3000.
38. Orr C (1967) Studies on Ascorbic Acid. II. Physical Changes in Catalase
Following Incubation with Ascorbate or Ascorbate and Copper (II)*.
Biochemistry 6: 3000–3006.
39. Koua D, Cerutti L, Falquet L, Sigrist C, Theiler G, et al. (2008) PeroxiBase: a
database with new tools for peroxidase family classification. Nucleic Acids
Research.
40. Zamocky M, Furtmu ¨ller P, Obinger C (2008) Evolution of catalases from
bacteria to humans. Antioxidants & Redox Signaling 10: 1527–1548.
41. Chelikani P, Fita I, Loewen P (2004) Diversity of structures and properties
among catalases. Cellular and molecular life sciences 61: 192–208.
42. Magwere T, West M, Riyahi K, Murphy MP, Smith RAJ, et al. (2006) The
effects of exogenous antioxidants on lifespan and oxidative stress resistance in
Drosophila melanogaster. Mechanisms of Ageing and Development 127:
356–370.
43. Bayne A, Mockett R, Orr W, Sohal R (2005) Enhanced catabolism of
mitochondrial superoxide/hydrogen peroxide and aging in transgenic Drosoph-
ila. Biochemical Journal 391: 277.
44. Kang M, Mott T, Tapley E, Lewis E, Luckhart S (2008) Insulin regulates aging
and oxidative stress in Anopheles stephensi. Journal of Experimental Biology
211: 741.
45. Hoffmann JA (2003) The immune response of Drosophila. Nature 426: 33–38.
46. Gillespie S, Smith G, Osbourn A (2004) Microbe-vector interactions in vector-
borne diseases Cambridge University Press.
47. Morey M, Corominas M, Serras F (2003) DIAP1 suppresses ROS-induced
apoptosis caused by impairment of the selD/sps1 homolog in Drosophila.
Journal of cell science 116: 4597.
48. Kamata H, Hirata H (1999) Redox regulation of cellular signalling. Cellular
signalling 11: 1–14.
49. Wang Q, Chen K, Yao Q, Zhao Y, Li Y, et al. (2008) Identification and
characterization of a novel 1-Cys peroxiredoxin from silkworm, Bombyx mori.
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular
Biology 149: 176–182.
50. Hu Z, Lee K, Choo Y, Yoon H, Lee S, et al. (2009) Molecular cloning and
characterization of 1-Cys and 2-Cys peroxiredoxins from the bumblebee
Bombus ignitus. Comparative Biochemistry and Physiology Part B: Biochemistry
and Molecular Biology.
51. Radyuk S, Klichko V, Spinola B, Sohal R, Orr W (2001) The peroxiredoxin
gene family in Drosophila melanogaster. Free Radical Biology and Medicine 31:
1090–1100.
52. Kim I, Lee K, Hwang J, Ahn M, Li J, et al. (2005) Molecular cloning and
characterization of a peroxiredoxin gene from the mole cricket, Gryllotalpa
orientalis. Comparative Biochemistry and Physiology Part B: Biochemistry and
Molecular Biology 140: 579–587.
53. Wood ZA, Schro ¨der E, Robin Harris J, Poole LB (2003) Structure, mechanism
and regulation of peroxiredoxins. Trends in Biochemical Sciences 28: 32–40.
54. Corby-Harris V, Drexler A, Watkins J, Antonova Y, Pakpour N, et al. (1003)
Activation of Akt Signaling Reduces the Prevalence and Intensity of Malaria
Parasite Infection and Lifespan in Anopheles stephensi Mosquitoes. Plos
Pathogens 6: e1001003.
55. Jaramillo-Gutierrez G, Molina-Cruz A, Kumar S, Barillas-Mury C The
Anopheles gambiae Oxidation Resistance 1 (OXR1) Gene Regulates Expression
of Enzymes That Detoxify Reactive Oxygen Species.
56. Coutinho-Abreu I, Ramalho-Ortigao M (2010) Transmission blocking vaccines
to control insect-borne diseases: a review. Memo ´rias do Instituto Oswaldo Cruz
105: 1–12.
57. Modi G Care and maintenance of phlebotomine sandfly colonies.
58. Sant’Anna MRV, Alexander B, Bates PA, Dillon RJ (2008) Gene silencing in
phlebotomine sand flies: Xanthine dehydrogenase knock down by dsRNA
microinjections. Insect Biochemistry and Molecular Biology 38: 652–660.
59. Pomerantz S (1963) Separation, purification, and properties of two tyrosinases
from hamster melanoma. Journal of Biological Chemistry 238: 2351.
60. Genta F, Souza R, Garcia E, Azambuja P (2010) Phenol oxidases from
Rhodnius prolixus: Temporal and tissue expression pattern and regulation by
ecdysone. Journal of Insect Physiology.
61. Walker J (2005) The proteomics protocols handbook Humana Pr Inc.
62. Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in
the cell using TargetP, SignalP and related tools. Nature protocols 2: 953–971.
63. Neuberger G, Maurer-Stroh S, Eisenhaber B, Hartig A, Eisenhaber F (2003)
Motif refinement of the peroxisomal targeting signal 1 and evaluation of taxon-
specific differences. Journal of molecular biology 328: 567–579.
64. Emanuelsson O, Elofsson A, von Heijne G, Cristobal S (2003) In silico
prediction of the peroxisomal proteome in fungi, plants and animals. Journal of
molecular biology 330: 443–456.
ROS Scavenging by Catalase in Lu. longipalpis
PLoS ONE | www.plosone.org9 March 2011 | Volume 6 | Issue 3 | e17486