Inhibition of soluble epoxide hydrolase confers cardioprotection and prevents cardiac cytochrome P450 induction by benzo(a)pyrene.

Abstract

We recently demonstrated that benzo(a)pyrene (BaP) causes cardiac hypertrophy by altering arachidonic acid metabolism through the induction of the expression of CYP ω-hydroxylases and soluble epoxide hydrolase (sEH) enzymes. The inhibition of CYP ω-hydroxylase enzymes partially reversed the BaP-induced cardiac hypertrophy. Therefore, it is important to examine whether the inhibition of sEH also confers cardioprotection. For this purpose, male Sprague-Dawley rats were injected intraperitoneally daily with either the sEH inhibitor 1-(1-methanesulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea (TUPS; 0.65 mg/kg), BaP (20 mg/kg), or the combination of BaP (20 mg/kg) and TUPS (0.65 mg/kg) for 7 days. Thereafter, the heart, liver, and kidney were harvested, and the heart to body weight ratio was measured. The expression of the hypertrophic markers, sEH, heme oxygenase-1, and CYP450 enzymes was determined. Our results demonstrate that BaP alone significantly induced the expression of sEH and CYP ω-hydroxylases in the heart, liver, and kidney tissues. Treatment with TUPS significantly reversed the BaP-mediated induction of the hypertrophic markers, completely prevented the increase in the heart to body weight ratio, and reduced the BaP-induced CYP1A1, CYP1B1, CYP4F4, and CYP4F5 genes in the heart. The current study demonstrates the cardioprotective effect of sEH inhibitor, TUPS, against BaP-induced cardiac hypertrophy and further confirms the role of sEH and CYP450 enzymes in the development of cardiac hypertrophy.

Full text

Page 1

ORIGINAL ARTICLE
Inhibition of Soluble Epoxide Hydrolase Confers
CardioprotectionandPreventsCardiacCytochromeP450
Induction by Benzo(a)pyrene
Mona E. Aboutabl, MSc,* Beshay N. M. Zordoky, MSc,*
Bruce D. Hammock, PhD,† and Ayman O. S. El-Kadi, PhD*
Abstract: We recently demonstrated that benzo(a)pyrene (BaP) causes
cardiac hypertrophy by altering arachidonic acid metabolism through
the induction of the expression of CYP v-hydroxylases and soluble
epoxidehydrolase(sEH)enzymes.TheinhibitionofCYPv-hydroxylase
enzymes partially reversed the BaP-induced cardiac hypertrophy.
Therefore, it is important to examine whether the inhibition of sEH
also confers cardioprotection. For this purpose, male Sprague-Dawley
rats were injected intraperitoneally daily with either the sEH inhibitor
1-(1-methanesulfonyl-piperidin-4-yl)-3-(4-trifluoromethoxy-phenyl)-urea
(TUPS; 0.65 mg/kg), BaP (20 mg/kg), or the combination of BaP
(20 mg/kg) and TUPS (0.65 mg/kg) for 7 days. Thereafter, the heart,
liver, and kidney were harvested, and the heart to body weight ratio
was measured. The expression of the hypertrophic markers, sEH,
heme oxygenase-1, and CYP450 enzymes was determined. Our
results demonstrate that BaP alone significantly induced the expres-
sion of sEH and CYP v-hydroxylases in the heart, liver, and kidney
tissues. Treatment with TUPS significantly reversed the BaP-
mediated induction of the hypertrophic markers, completely pre-
vented the increase in the heart to body weight ratio, and reduced the
BaP-induced CYP1A1, CYP1B1, CYP4F4, and CYP4F5 genes in the
heart. The current study demonstrates the cardioprotective effect of
sEH inhibitor, TUPS, against BaP-induced cardiac hypertrophy and
further confirms the role of sEH and CYP450 enzymes in the de-
velopment of cardiac hypertrophy.
Key Words: benzo(a)pyrene, cardiac hypertrophy, cytochrome P450,
soluble epoxide hydrolase inhibitor, TUPS
(J Cardiovasc PharmacolTM2011;57:273–281)
INTRODUCTION
Polycyclic aromatic hydrocarbons are common envi-
ronmental contaminants that have been highly associated with
the development of several cardiovascular diseases.1Human
exposure to benzo(a)pyrene (BaP) may be continuous, where it
exists in heavily polluted air, drinking water, smoked foods,
and cigarette smoke.2It is also produced upon forest and
rangeland fires, volcanic eruptions, aluminum smelting, waste
incineration, motor vehicle operation, and coal tar distilla-
tion.3,4BaP is the prototypical example of the polycyclic
aromatic hydrocarbons, which are known to activate the aryl
hydrocarbon receptor (AhR).5Several epidemiological and
clinical studies linked the exposure to AhR ligands and AhR
activation to the pathogenesis of different cardiovascular
diseases.1,3Moreover, activation of the AhR signaling path-
ways has been previously correlated with the development
of cardiac hypertrophy.1The potent AhR ligand 2,3,7,8-
tetrachlorodibenzo-p-dioxin (TCDD) caused cardiac hyper-
trophy in chicken embryo that was characterized by increase in
heart size.6This was accompanied by induction in cardiac
muscle proteins and hypertrophic genes.1
Wepreviouslydemonstrated
3-methylcholanthrene (3-MC) and BaP, induced the expres-
sion of the hypertrophic markers, atrial natriuretic peptide
(ANP), and brain natriuretic peptide (BNP) and the heart
to body weight ratio, reflecting the induction of cardiac
hypertrophy in male Sprague-Dawley rats.7In H9c2 cardio-
myoblasts, AhR ligands, TCDD, and b-naphthoflavone caused
a significant induction of ANPand BNP that was accompanied
by an increase in the cells surface area, which further
confirmed the hypertrophic effect of these AhR ligands.8
Different mechanisms have been proposed for the role
of AhR in the development of cardiac hypertrophy.1The first
mechanisminvolvestheinductionofreactiveoxygenspecies.The
second mechanism involves the induction of hypertrophic genes
like ANP, BNP, and beta-myosin heavy chain by AhR ligands.9
In addition, AhR ligands were found to alter the metabolism
of arachidonic acid and to contribute in the pathogenesis of
hypertrophy through increasing the 20-hydroxyeicosatetraenoic
acid (20-HETE) to total epoxyeicosatrienoic acids (EETs) ratio.7
EETs are the major cardioprotective products of
arachidonic acid metabolism by CYP450. Also, EETs are
substrates of the soluble epoxide hydrolase enzyme (sEH),
which is the enzyme responsible for the conversion of EETs to
the biologically less active dihydroxyeicosatrienoic acids
(DHETs) and thus reducing their beneficial cardiovascular
effect.10Moreover, the gene encoding sEH enzyme, EPHX2,
was found to be significantly induced in different models of
that AhRligands,
Received for publication September 14, 2010; accepted November 4, 2010.
From the *Faculty of Pharmacy and Pharmaceutical Sciences, University of
Alberta, Edmonton, AB, Canada; and †Department of Entomology and
Cancer Research Center, University of California, Davis, CA.
Supported by a grant from the Heart and Stroke Foundation of Alberta, NWT,
and Nunavut to A. O. S. El-Kadi. M. E. Aboutabl is the recipient of
Egyptian Government Scholarship. B. N. M. Zordoky is the recipient of
Alberta Innovates-Health Solutions Studentship.
The authors declare no conflicts of interest.
Reprints: Ayman O. S. El-Kadi, PhD, Faculty of Pharmacy and Pharmaceutical
Sciences, 3126 Dentistry/Pharmacy Centre, University of Alberta,
Edmonton, AB, Canada T6G 2N8 (e-mail: aelkadi@pharmacy.ualberta.ca).
Copyright ? 2011 by Lippincott Williams & Wilkins
J Cardiovasc Pharmacol??Volume 57, Number 3, March 2011www.jcvp.org|273

Page 2

cardiac hypertrophy such as, 3-MC–induced and BaP-induced
cardiac hypertrophy,7isoproterenol-induced cardiac hypertro-
phy, spontaneously hypertensive rats with heart failure,11and
angiotensin II–induced hypertrophy.12The coincident upre-
gulation of EPHX2 together with the development of cardiac
hypertrophy in different animal models suggested its involve-
ment in the development of cardiac hypertrophy. Therefore,
sEH inhibition is considered a new potential therapeutic target
in the treatment of different cardiovascular diseases. The
cardioprotective mechanism of sEH inhibitors involves
inhibiting the degradation of EETs and hence blocking of
nuclear factor kappa B (NF-kB) activation.13,14. Xu et al13
demonstrated that sEH inhibitors prevented and reversed
cardiac hypertrophy in murine model of chronic pressure
overload–induced cardiac hypertrophy. In addition, treatment
with an sEH inhibitor, 1-(1-methanesulfonyl-piperidin-4-yl)-
3-(4-trifluoromethoxy-phenyl)-urea (TUPS), decreased the left
ventricular hypertrophy and prevented angiotensin II–induced
cardiac hypertrophy in rats.12
Recently, we have demonstrated that BaP induces cardiac
hypertrophy through the induction of CYP v-hydroxylases,
enzymes responsible for the formation of 20-HETE, such as
CYP1A1, CYP1B1, CYP2E1, CYP4F4 and CYP4F5 and sEH
enzyme in the hearts of male Sprague-Dawley rats.7This
resulted in alteration in the arachidonic acid metabolism and
significant increase in the 20-HETE to total EETs ratio.7Several
studies demonstrated the association and the potential contri-
bution of higher levels of the cardiotoxic metabolite 20-HETE
and lower levels of the cardioprotective EETs in the
development of cardiac hypertrophy.7,15,16Interestingly, we
found that treatment with the CYP v-hydroxylase inhibitor N-
hydroxy-N#-(4-butyl-2-methylphenyl) formamidine(HET0016)
partially reversed the BaP-induced cardiac hypertrophy through
inhibition of 20-HETE formation.7Therefore, it is important to
examine whether the inhibition of sEH confers cardioprotection
against BaP-induced cardiac hypertrophy.
MATERIALS AND METHODS
Animals
The investigation follows the Guidefor theCare and Use
of Laboratory Animals published by the U.S. National
Institutes of Health (Publication No. 85-23, revised 1996).
All experimental animal procedures were approved by the
University of Alberta Health Sciences Animal Policy and
Welfare Committee. Male Sprague-Dawley rats weighing
300–350 g were obtained from Charles River Canada
(St. Constant, QC, Canada). All animals were allowed free
access to food and water all over the treatment period.
Chemicals and Reagents
BaP, 4-hydroxybenzophenone, and anti-goat IgG with
horseradish peroxidase secondary antibody were purchased
from Sigma-Aldrich Chemical Co (St Louis, MO). TRIzol
reagent was purchased from Invitrogen (Carlsbad, CA). High-
capacity complementary DNA (cDNA) Reverse Transcription
Kit along with SYBR Green SuperMix were purchased from
Applied Biosystems (Foster City, CA). Real-time polymerase
chain reaction (PCR) primers were synthesized by Integrated
DNA Technologies Incorporation (San Diego, CA) according
to previously published sequences. 14,15-EET and 14,15-
DHET were obtained from Cayman Chemical (Ann Arbor,
MI). TUPS was synthesized by Paul Jones (University of
California, Davis) as described in Tsai et al.17Acrylamide,
N#N#-bis-methylene-acrylamide, b-mercaptoethanol, ammo-
nium persulfate, glycine, pure nitrocellulose membrane (0.45
mm), and N,N,N#,N#-Tetramethylethylenediamine (TEMED)
were purchased from Bio-Rad Laboratories (Hercules, CA).
Chemiluminescent Western blotting detection reagents were
purchased from GE Healthcare Life Sciences (Piscataway, NJ).
Goat anti-rat CYP1A1, rabbit anti-rat CYP1B1, and rabbit
anti-rat CYP2E1 polyclonal primary antibodies were pur-
chased from Oxford Biomedical Research (Oxford, MI), BD
Gentest (Woburn, MA), and Abcam (Cambridge, UK),
respectively. Goat anti-rabbit IgG with horseradish peroxidase
secondary antibody and actin goat polyclonal primary
antibody were purchased from Santa Cruz Biotechnology,
Inc (Santa Cruz, CA). All other chemicals were purchased
from Fisher Scientific Co (Toronto, ON, Canada).
Experimental Design
Animals were injected intraperitoneally with 0.65 mg/kg
of sEH inhibitor, TUPS, 20 mg/kg of BaP, or 20 mg/kg of BaP
with 0.65 mg/kg of TUPS daily for 7 days (n = 4). Weight-
matched controls received the same volume of corn oil and
saline daily for 7 days (n = 4). BaP was dissolved in corn oil,
whereas TUPS stock solution was dissolved in dimethyl
sulfoxide, and then further diluted in saline to reach the desired
concentration. Animals were euthanized under isoflurane
anesthesia, 24 hours after the last injection. Heart, kidneys,
and liver were excised, immediately frozen in liquid nitrogen,
and stored at 280?C until analysis.
RNA Extraction and cDNA Synthesis
Total RNA from the frozen heart, kidney, and liver
tissues was isolated using TRIzol reagent (Invitrogen)
according to the manufacturer’s protocol and quantified by
measuring the absorbance at 260 nm. The quality of the
isolated RNAwas determined by measuring the 260:280 ratio.
Thereafter, first-strand cDNA was synthesized by using the
High-capacity cDNA reverse transcription kit (Applied
Biosystems) according to the manufacturer’s protocol.
Relative Gene Expression Analysis by
Real-time PCR
The relative gene expression was determined by real-time
PCR using the ABI Prism 7500 System (Applied Biosystems)
according to the manufacturer’s protocol. The primers used in
the currentstudywerepreviouslypublished18–23andare listedin
Table 1. A melting curve was determined at the end of each
cycle to confirm the specificity of the primers and the purity of
the PCR product. Thereafter, real-time PCR data were analyzed
using the relative gene expression method as described
previously.24
Glyceraldehyde-3-phosphate
(GAPDH) was used as the endogenous control and the
untreated control was used as the calibrator when the
change of gene expression by TUPS, BaP, and BaP + TUPS
is being studied.
dehydrogenase
274|www.jcvp.orgq 2011 Lippincott Williams & Wilkins
Aboutabl et al
J Cardiovasc Pharmacol??Volume 57, Number 3, March 2011

Page 3

Microsomal Preparation and Western
Blot Analysis
Preparation of heart microsomal protein was performed
as described previously.25Lowry method was used for
measuring heart microsomal protein concentration using
bovine serum albumin as a standard.26Western blot analysis
was carried out using a previously described method.27In
brief, heart microsomal protein (20 mg) from each treatment
group was separated by 10% sodium dodecyl sulfate–
polyacrylamide gel electrophoresis. The gels were electro-
phoretically transferred to pure nitrocellulose membrane.
A blocking solution containing 0.15 M sodium chloride, 3
mM potassium chloride, 25 mM Tris-base (Tris-buffered
saline), 5% skim milk, 2% bovine serum albumin, and 0.5%
Tween-20 was added to the protein blots for overnight
blocking at 4?C. Thereafter, the blots were incubated with
a primary polyclonal goat anti-rat CYP1A1 antibody, rabbit
anti-rat CYP1B1, or rabbit anti-rat CYP2E1 for 4 hours at
4?C. Incubation with a peroxidase-conjugated rabbit anti-goat
IgG secondary antibody for CYP1A1 or goat anti-rabbit
IgG secondary antibody for CYP1B1 and CYP2E1 was
carried out for 2 hours at room temperature. The bands were
visualized using the enhanced chemiluminescence method
according to the manufacturer’s instructions (GE Healthcare
Life Sciences). The intensity of the protein bands was
measured relative to the signals obtained for actin using
ImageJ software (National Institutes of Health, Bethesda, MD,
http://rsb.info.nih.gov/ij).
Microsomal Incubation and Measurement of
sEH Activity
Heart microsomes (0.5 mg protein/mL) of control or
animals treated with BaP for 7 days were incubated in the
incubation buffer (5 mM magnesium chloride hexahydrate
dissolved in 0.5 M potassium phosphate buffer pH 7.4) at 37?C
in a shaking water bath (50 revolutions per minute). Heart
microsomeswerepre-equilibratedfor5minutes.Thereafter,heart
microsomes from both groups were incubated with 1 mM TUPS
for 5 minutes followed by incubation with 10 mM 14,15-EET for
30 minutes. The reaction was stopped by the addition of 600 mL
of ice-cold acetonitrile followed by the internal standard,
4-hydroxybenzophenone. 14,15-EET and its diol metabolite,
14,15-DHET, were extracted twice by 1 mL of ethyl acetate
and dried using speed vacuum (Savant, Farmingdale, NY).
Extracted 14,15-EET and 14,15-DHET were analyzed using
the liquid chromatography-electrospray ionization-mass spec-
trometry (LC-ESI-MS) (Waters Micromass ZQ 4000 spectrom-
eter) method as described previously.28The mass spectrometer
runs in negative ionization mode with single-ion recorder
acquisition. The nebulizer gas was acquired from an in-house
high-purity nitrogen source. The temperature of the source was
set at 150?C, and the voltages of the capillary and the cone were
3.51 kV and 25 V , respectively. The samples (10 mL) were
separated on reverse-phase C18 column (Kromasil, 250 3 3.2
mm) using linear gradient mobile phase system water/acetonitrile
with 0.005% acetic acid as mobile phase at flow rate of 0.2
mL/min. The mobile phase system started at 60% acetonitrile,
linearly increased to 80% acetonitrile in 30 minutes, increased
to 100% acetonitrile in 5 minutes, and held for 5 minutes.
sEH activity was determined by the 14,15-DHET:14,15-EET
ratio.
Statistical Analysis
Data are presented as mean 6 standard error of the
mean. Comparative gene and protein expression and metab-
olite formation across groups were analyzed using a 1-way
analysis of variance followed by a Student–Newman–Keuls
post hoc comparison. A result was considered statistically
significant when P , 0.05.
RESULTS
Effect of the sEH Inhibitor, TUPS, Treatment on
the Hypertrophic Markers and the Increase in
Heart to Body Weight Ratio Induced by BaP
To investigate whether the inhibition of sEH confers
cardioprotection in BaP-treated rats, we measured the cardiac
gene expression of the hypertrophic markers, ANP and BNP
relative to BaP-treated rats. BaP treatment caused a significant
induction of both hypertrophic markers ANP and BNP by 2.3-
and 2.5-fold, respectively (Fig. 1A). On the other hand, TUPS
treatment significantly decreased the BaP-mediated induction
of ANP and BNP by 4- and 1.4-fold, respectively (Fig. 1A).
In addition, TUPS treatment alone did not alter the gene
expression of ANP or BNP. Moreover, BaP significantly
increased the heart weight to body weight ratio by 8.1%,
TABLE 1. Primer Sequences Used for Real-time PCRs
Gene Forward PrimerReverse Primer
CYP1A1
CYP1B1
CYP2E1
CYP4F4
CYP4F5
EPHX2
ANP
BNP
HO-1
GAPDH
CCAAACGAGTTCCGGCCT
GCTTTACTGTGCAAGGGAGACA
AAAGCGTGTGTGTGTTGGAGAA
CAGGTCTGAAGCAGGTAACTAAGC
AGGATGCCGTGGCTAACTG
CACATCCAAGCCACCAAGCC
GGAGCCTGCGAAGGTCAA
CAGAAGCTGCTGGAGCTGATAAG
AGAGTTTCCGCCTCCAACCA
CAAGGTCATCCATGACAACTTTG
TGCCCAAACCAAAGAGAATGA
GGAAGGAGGATTCAAGTCAGGA
AGAGACTTCAGGTTAAAATGCTGCA
CCGTCAGGGTGGCACAGAGT
GGCTCCAAGCAGCAGAAGA
CAGGCCTCCATCCTCCAG
TATCTTCGGTACCGGAAGCTGT
TGTAGGGCCTTGGTCCTTTG
CGGGACTGGGCTAGTTCAGG
GGGCCATCCACAGTCTTCTG
q 2011 Lippincott Williams & Wilkins
www.jcvp.org|275
J Cardiovasc Pharmacol??Volume 57, Number 3, March 2011 TUPS and Alteration of Cardiac CYP450 by BaP

Page 4

whereas treatment with TUPS completely prevented the BaP-
mediated increase in the heart weight to body weight ratio.
Furthermore, no significant difference was observed between
the control and the TUPS treatment alone (Fig. 1B).
Effect of TUPS Treatment on the Changes in
the CYP450 Gene Expression Induced by BaP
To examine the effect of TUPS on BaP-mediated
induction of CYP450 genes, total RNAwas extracted from the
heart, kidney, and liver of control, TUPS-treated, BaP-treated,
and BaP + TUPS–treated rats. Thereafter, the expression of
different CYP450 genes was measured using reverse tran-
scription followed by real-time PCR.
Figure 2A shows the effect of treatment with TUPS on
BaP-induced CYP1A1 gene expression. Our results demonstrate
that BaP treatment caused a significant increase in CYP1A1 gene
expression in heart, kidney, and liver by about 400-, 440-, and
2240-fold respectively (Fig. 2A). On the other hand, TUPS
treatment caused significant inhibition of BaP-induced CYP1A1
gene by 27.8% in the heart compared with the BaP treatment. In
the kidney and liver, CYP1A1 messenger RNA (mRNA) levels
FIGURE 1. Effect of TUPS treatment on the hypertrophic markers
induced by BaP. Sprague-Dawley rats received daily injections of
TUPS(0.65mg/kg),BaP(20mg/kg),orBaP(20mg/kg)plusTUPS
(0.65 mg/kg) for 7 days while weight-matched controls received
the same volume of corn oil and saline. A, Gene expression of the
hypertrophic genes, ANP and BNP was determined in the heart.
B, Heart to body weight ratio (in milligrams per gram) was
determined for each animal after 7 daily IP injections of TUPS, BaP,
BaP + TUPS, or corn oil. Results are presented as mean 6 standard
error of the mean (n = 4). #P , 0.05 compared with control. *P ,
0.05 compared with BaP-treated rats.
FIGURE 2. Effect of TUPS treatment on gene expression of the
CYP1 family induced by BaP. Sprague-Dawley rats received
daily injections of TUPS (0.65 mg/kg), BaP (20 mg/kg), or BaP
(20 mg/kg) plus TUPS (0.65 mg/kg) for 7 days while weight-
matched controls received the same volume of corn oil and
saline. Total RNA was isolated from the heart, kidney, and liver
of control, TUPS-treated, BaP-treated, and BaP + TUPS–treated
rats, and the relative gene expression of (A) CYP1A1 and (B)
CYP1B1 was determined by real-time PCR. Results are
presented as mean 6 standard error of the mean (n = 4).
#P , 0.05 compared with control. *P , 0.05 compared with
BaP-treated rats.
276|www.jcvp.orgq 2011 Lippincott Williams & Wilkins
Aboutabl et al
J Cardiovasc Pharmacol??Volume 57, Number 3, March 2011

Page 5

were not altered in response to TUPS treatment when compared
with the BaP treatment (Fig. 2A).
Figure 2B shows that BaP treatment significantly induced
CYP1B1 gene expression in heart, kidney, and liver by 153-, 16-,
and 2000-fold, respectively. Interestingly, CYP1B1 mRNA level
was significantly decreased in both the heart and liver after
treatment with TUPS by 82% and 54.2%, respectively, compared
with the BaP treatment. With respect to the kidney, CYP1B1
mRNA levels were not significantly altered compared with the
BaP-treated rats (Fig. 2B).
CYP2E1 mRNA levels were significantly increased in
heart, kidney, and liver of rats treated with BaP by 5-, 9-, 3.4-
fold, respectively. In the heart, treatment with TUPS alone
resulted in a significant increase in CYP2E1 gene expression
by 4.4-fold. However, TUPS treatment did not significantly
alter the gene expression of CYP2E1 induced by BaP in all the
tissues tested (Fig. 3).
WithregardtoCYP4family,CYP4F4geneexpressionwas
significantly increased by 1.7-, 7.5-, and 23.8- fold in the heart,
kidney, and liver of BaP-treated rats. Interestingly, the gene
expression of CYP4F4 was significantly reduced by 63% in
the heart, but not the kidney or liver of rats treated with TUPS
(Fig. 4A). Similar to CYP4F4, CYP4F5 gene expression was
induced in the heart, kidney, and liver of BaP-treated rats by 2.3-,
3.4, and 1.9-fold, respectively. However, TUPS treatment
significantly reduced the BaP-mediated induction of CYP4F5
mRNA by 54% in the heart and 51% in the kidney but not the
liver (Fig. 4B).
Effect of TUPS Treatment on BaP-induced
EPHX2 Gene Expression
The enzyme sEH is a major determinant of EET level;
therefore, we determined the effect of TUPS treatment on the
expression of EPHX2 gene. Total RNAwas extracted from the
heart, kidney, and liver of control, BaP-treated, and BaP +
TUPS–treated rats. Thereafter, the expression of EPHX2 gene
was measured using reverse transcription followed by real-
time PCR. Our results show that BaP treatments caused
a significant induction of EPHX2 gene expression in the heart,
kidney, and liver by 3.9-, 3.1-, 2.9-fold, respectively (Fig. 5).
On the other hand, treatment with TUPS did not alter the BaP-
induced EPHX2 gene expression in all tissues tested.
Effect of TUPS Treatment on BaP-induced
Heme Oxygenase-1 Gene Expression
The gene expression of heme oxygenase-1 (HO-1) was
significantly induced by 2.4-, 2.2-, and 2.3-fold in the heart,
kidney, and liver of BaP-treated rats. Interestingly, treatment
FIGURE 3. Effect of TUPS treatment on gene expression of the
CYP2E1 induced by BaP. Sprague-Dawley rats received daily
injections of TUPS (0.65 mg/kg), BaP (20 mg/kg), or BaP (20
mg/kg) plus TUPS (0.65 mg/kg) for 7 days while weight-
matched controls received the same volume of corn oil and
saline. Total RNA was isolated from the heart, kidney, and liver
of control, TUPS-treated, BaP-treated, and BaP+TUPS–treated
rats, and the relative gene expression of CYP2E1 was de-
termined by real-time PCR. Results are presented as mean 6
standard error of the mean (n = 4). #P , 0.05 compared with
control. *P , 0.05 compared with BaP-treated rats.
FIGURE 4. Effect of TUPS treatment on gene expression of the
CYP4 family induced by BaP. Sprague-Dawley rats received
daily injections of TUPS (0.65 mg/kg), BaP (20 mg/kg), or BaP
(20 mg/kg) plus TUPS (0.65 mg/kg) for 7 days while weight-
matched controls received the same volume of corn oil and
saline. Total RNA was isolated from the heart, kidney, and liver
of control, TUPS-treated, BaP-treated, and BaP+TUPS–treated
rats, and the relative gene expression of (A) CYP4F4 and (B)
CYP4F5 was determined by real-time PCR. Results are
presented as mean 6 standard error of the mean (n = 4).
#P , 0.05 compared with control. *P , 0.05 compared with
BaP-treated rats.
q 2011 Lippincott Williams & Wilkins
www.jcvp.org|277
J Cardiovasc Pharmacol??Volume 57, Number 3, March 2011 TUPS and Alteration of Cardiac CYP450 by BaP