WRKY22 transcription factor mediates dark-induced leaf senescence in Arabidopsis.

Abstract

Arabidopsis WRKY proteins are plant-specific transcription factors, encoded by a large gene family, which contain the highly conserved amino acid sequence WRKYGQK and the zinc-finger-like motifs, Cys(2)His(2) or Cys(2)HisCys. They can recognize and bind the TTGAC(C/T) W-box ciselements found in the promoters of target genes, and are involved in the regulation of gene expression during pathogen defense, wounding, trichome development, and senescence. Here we investigated the physiological function of the Arabidopsis WRKY22 transcription factor during dark-induced senescence. WRKY22 transcription was suppressed by light and promoted by darkness. In addition, AtWRKY22 expression was markedly induced by H(2)O(2). These results indicated that AtWRKY22 was involved in signal pathways in response to abiotic stress. Dark-treated AtWRKY22 over-expression and knockout lines showed accelerated and delayed senescence phenotypes, respectively, and senescence-associated genes exhibited increased and decreased expression levels. Mutual regulation existed between AtWRKY22 and AtWRKY6, AtWRKY53, and AtWRKY70, respectively. Moreover, AtWRKY22 could influence their relative expression levels by feedback regulation or by other, as yet unknown mechanisms in response to dark. These results prove that AtWRKY22 participates in the dark-induced senescence signal transduction pathway.

Full text

Page 1

Mol. Cells 31, 303-313, April 30, 2011
DOI/10.1007/s10059-011-0047-1











WRKY22 Transcription Factor Mediates Dark-Induced
Leaf Senescence in Arabidopsis

Xiang Zhou, Yanjuan Jiang1,2, and Diqiu Yu*


Arabidopsis WRKY proteins are plant-specific transcrip-
tion factors, encoded by a large gene family, which contain
the highly conserved amino acid sequence WRKYGQK
and the zinc-finger-like motifs, Cys2His2 or Cys2HisCys.
They can recognize and bind the TTGAC(C/T) W-box cis-
elements found in the promoters of target genes, and are
involved in the regulation of gene expression during
pathogen defense, wounding, trichome development, and
senescence. Here we investigated the physiological func-
tion of the Arabidopsis WRKY22 transcription factor dur-
ing dark-induced senescence. WRKY22 transcription was
suppressed by light and promoted by darkness. In addi-
tion, AtWRKY22 expression was markedly induced by
H2O2. These results indicated that AtWRKY22 was involved
in signal pathways in response to abiotic stress. Dark-
treated AtWRKY22 over-expression and knockout lines
showed accelerated and delayed senescence phenotypes,
respectively, and senescence-associated genes exhibited
increased and decreased expression levels. Mutual regula-
tion existed between AtWRKY22 and AtWRKY6, AtWR-
KY53, and AtWRKY70, respectively. Moreover, AtWRKY22
could influence their relative expression levels by feed-
back regulation or by other, as yet unknown mechanisms
in response to dark. These results prove that AtWRKY22
participates in the dark-induced senescence signal trans-
duction pathway.


INTRODUCTION

Leaf senescence is a developmentally programmed degenera-
tion process that constitutes the final step of leaf development.
Senescence is controlled by multiple developmental and envi-
ronmental signals (Lim et al., 2003). It often occurs in an age-
dependent manner and is affected by complex interaction be-
tween developmental age and factors such as shading, ex-
treme temperature, drought, and exposure to nutrient defi-
ciency (Woo et al., 2004). Although leaf senescence is a suc-
cession of physiological and molecular events, the process can
be split into initiation, degeneration, and terminal phases ac-
cording to the three-stage theory (Yoshida, 2003). In Arabidop-
sis the initiation of natural senescence is associated with the
developmental aging process, and senescence occurs just
after a particular developmental time point (Buchanan-Wollas-
ton, 1997). At the time of initiation of leaf senescence, photo-
synthesis activity begins to decrease and the function of leaves
transforms from sink to source (Yoshida, 2003). The degenera-
tion processes are characterized by the degradation of macro-
molecules and the disassembly of cellular components, which
are accompanied by the mobilization and translocation of valu-
able resources from the leaves to growing organs or reserve
organs (Buchanan-Wollaston, 1997). The terminal phase re-
sults in the death or abscission of the whole leaf and the symp-
toms of leaf senescence become visible completely.
To understand the molecular mechanisms of foliar senes-
cence, many genes expressed during senescence have been
identified from a variety of plant species, including Arabidopsis,
tomato, maize, and rice (Buchanan-Wollaston, 1997; He and
Gan, 2002; Hinderhofer and Zentgraf, 2001; Oh et al., 1996;
Park et al., 1998; Quirino et al., 2000). For example, specific
sets of genes, designated senescence-associated genes (SAGs),
are up-regulated during foliar senescence, including proteases,
nucleases, lipid-, carbohydrate- and nitrogen-metabolizing en-
zymes, stress-responsive proteins, and transcriptional regula-
tors, which are involved in the breakdown of cellular compo-
nents (Buchanan-Wollaston et al., 2003). Different sets of genes,
designated senescence-down-regulated genes, are down-
regulated during foliar senescence, including the genes related
to photosynthesis (Gan et al., 1997). Other gene products are
associated with mobilization of nutrients and minerals from
senescing tissue to developing parts of plants (Buchanan-
Wollaston, 1997). Current molecular studies on leaf senes-
cence are mainly focused on genes up-regulated during senes-
cence. On the basis of the functions of their protein products,
genes related to senescence have been classified into six con-
ceptual categories (Lim et al., 2003). Class I genes control the
developmental aging process by affecting metabolic rate of cell.
For example, mutation of ORE4 leads to retardation of age-
dependent senescence, but dark- and phytohormone-induced
leaf senescence remains largely unaffected (Woo et al., 2002).
Class II consists of genes related to synthesis and response of
phytohormones (Grbic et al., 1995; Lanahan et al., 1994; Oh et
Molecules
and
Cells
©2011 KSMCB

Key Laboratory of Tropical Forest Ecology, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Kunming, Yunnan 650223,
China, 1Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Kunming, Yunnan 650223, China, 2Graduate University of Chinese
Academy of Sciences, Beijing 100039, China
*Correspondence: ydq@xtbg.ac.cn

Received June 23, 2010; revised January 19, 2011; accepted January 21, 2011; published online February 23, 2011

Keywords: abiotic stress, AtWRKY22, dark, senescence

Page 2

304 WRKY22 Mediates Dark-Induced Leaf Senescence in Arabidopsis




al., 1997). These genes can regulate other endogenous bio-
logical processes in addition to leaf senescence. Class III
genes can alter senescence in response to environmental fac-
tors. Class V genes are involved in the degradation process of
senescence regulatory factors. For example, ORE9 encodes
an F-box protein that is a component of the ubiquitin E3 ligase
complex (Woo et al., 2001), and has a role in the degradation
of proteins that negatively regulate leaf senescence. Class VI
genes operate downstream of the senescence signal transduc-
tion pathway that is involved in executing the senescence proc-
ess. The genes in class I-V are primarily involved in the initia-
tion and/or progression of senescence, and the genes in class
VI are largely involved in the progression of senescence (Lim et
al., 2003).
Regulatory genes that are classified into class IV have an
important role in recognizing and transducing the age or stress
information into senescence-related physiology or the regula-
tion of senescence-associated genes (SAGs). Limited numbers
of regulating factors involved in leaf senescence have been
identified up to now. It is necessary to identify possible candi-
dates for regulatory genes to delineate the molecular mecha-
nism underlying leaf senescence. WRKY proteins are a super-
family of transcription factors with potential regulatory roles
related to various biotic and abiotic stress responses. Arabi-
dopsis WRKY proteins participate in regulation of plant devel-
opment (Johnson et al., 2002), material metabolism (Devaiah et
al., 2007), abiotic stress (Li et al., 2009; 2010; Qiu et al., 2009),
seed dormancy and germination (Jiang et al., 2009). They also
regulate plant responses to disease resistance and establish
the corresponding pathway of signal transduction (Chen et al.,
2002; Journot-Catalino et al., 2006; Yu et al., 2001). Expression
profiling in Arabidopsis reveals that WRKY transcription factors
are the second largest family of transcription factors in the se-
nescence transcriptome (Guo et al., 2004). In addition, 36% of
Arabidopsis WRKY genes show at least twofold changes in
transcription levels after 1- or 5-day dark treatment (Lin, 2004).
These results indicate that some WRKY proteins play an impor-
tant role in the process of dark-induced leaf senescence.
WRKY6 and WRKY53 in Arabidopsis appear to be involved in
the regulation of senescence. AtWRKY6 controls plant senes-
cence and pathogen defense by specifically binding to the W-
box in the promoter of the senescence-induced receptor-like
kinase (SIRK) gene in Arabidopsis (Robatzek and Somssich,
2002). The expression of AtWRKY53 increases at the early
stages but decreases at the later stages of leaf senescence,
suggesting that AtWRKY53 has a regulatory role in the early
stages of leaf senescence (Hinderhofer et al., 2001). Although
the functions of some Arabidopsis WRKY genes in senescence
have come to light, the functions of other leaf senescence-
associated Arabidopsis WRKY transcription factors remain to
be elucidated in detail.
AtWRKY22 is one target gene of AtWRKY53 (Miao et al.,
2004), at the same time we have found that the expression of
AtWRKY22 is induced by darkness, indicating that AtWRKY22
has an important role during dark-induced senescence. Thus, it
is necessary to elucidate the function of AtWRKY22 during
dark-induced senescence to understand the molecular mecha-
nism of senescence. In this study, we use AtWRKY22 over-
expression lines and T-DNA insertion mutants to investigate the
role of AtWRKY22 during dark-induced senescence. Our re-
sults show that in the AtWRKY22 T-DNA insertion mutants,
senescence is delayed, whereas in the AtWRKY22 over-
expression lines senescence is accelerated, compared with
control lines.

MATERIALS AND METHODS

Plant materials and growth conditions
Arabidopsis thaliana ecotype Columbia (Col-0) was used as the
wild-type strain. The WRKY22 mutant lines (W22m-1, salk_
094892; W22m-2, salk_056943) and 35S:W22 plants were
obtained using the background of A. thaliana ecotype Columbia
(Col-0). Seeds were surface sterilized, sown on Murashige and
Skoog medium containing 1% sucrose and cold-treated for
three days at 4°C. The plates were illuminated with white fluo-
rescent light in a growth chamber at 22°C under long-day (16 h
light/8 h dark) conditions. After seven days seedlings were trans-
ferred to soil, and were grown in an environmentally controlled
growth room at 22°C with a 16 h light/8 h dark photoperiod with
moderate light intensity (150 μM m-2 s-1).

Induction treatment
For H2O2 treatment, 3%H2O2 (gram/100 ml) was sprayed onto
the rosette leaves of four-week-old wild-type plants and leaf
samples were harvested at one hour interval for RNA extraction.
For dark treatment, fully developed leaves detached from four-
week-old plants were placed on 9-mm-diameter Petri dishes
with double-layer Whatman filter papers in the base and con-
taining 15 ml distilled water. The Petri dishes were placed in the
dark room at 22°C (Guo and Crawford, 2005). Detached leaves
were harvested every one and half days or three days for RNA
extraction. The leaves were sampled after four-day dark treat-
ment for determination of chlorophyll content, staining of dead
cells with Evans Blue, and determination of cell death rate.

Over-expression lines and identification of Arabidopsis
WRKY22 insertion mutants
To generate the 35S:W22 construct, the AtWRKY22 cDNA was
cloned into the transformation vector pOCA30, which contains
the modified cauliflower mosaic virus (CaMV) 35S promoter
(35S:W22). The resulting plasmid was transformed into Agro-
bacterium tumefaciens strain LBA4404 and introduced into
plants by the floral-dip method (Clough and Bent, 1998). Trans-
genic seedlings were selected on kanamycin medium (50
μg.ml-1) to identify T1 transgenic plants. The two WRKY22 T-
DNA insertion lines were obtained from the Arabidopsis Bio-
logical Resource Center (USA). The two WRKY22 mutants
were tracked by genomic polymerase chain reaction (PCR)
using the gene-specific primers wrky22m-A (5′-CGAGTTAAA-
CAAGATGTATCGAGCT-3′) and wrky22m-B (5′-AACCCATC-
AAAGGTTCACCATA-3′) and the T-DNA-specific right-border
primer KO-1 (5′-AAACGTCCGCAATGTGTTAT-3′).

RNA blotting analysis
Total RNA was isolated from detached leaves, as described by
Lagrimini et al. (1987). Twenty micrograms of cellular RNA was
size-fractionated by electrophoresis through a 1.2% formalde-
hyde-agarose gel and then capillary-blotted onto Hybond-N+
nylon membranes. Subsequently, the membranes were hybrid-
ized to 32P-dATP-labeled probes at 68°C according to standard
procedures (Sambrook et al., 1989). After hybridization, the
membranes were washed with 2× SSC and 0.5% SDS at 68°C
for 10 min, and twice with 0.5× SSC and 0.1% SDS at 68°C for
20 min every time. Finally, the membranes were washed with
0.1× SSC and 0.1% SDS at 68°C for 20 min and then exposed
to x-ray film.

Quantitative real-time PCR analysis
After the leaves were dark-treated with dark for 36 h or 72 h,
samples were frozen immediately in liquid nitrogen, and stored

Page 3

Xiang Zhou et al. 305




Table 1. List of quantitative RT-PCR primer sequences
Quantitative RT-PCR primers
Primer sequences (5′ → 3′)
Gene
Primer forward Primer reverse
AtWRKY22 (AT4G01250) CGACAAAGTAATGCCGTCTCC CGTTTCTGGTTCTGTGGCTTT
AtWRKY6 (AT1G62300) AGGAAGAACAAGATGATCGAACGGACG TCACCAACTCATTTTTCGCACGCT
AtWRKY53 (AT4G23810) GACGGGGATGCTACGGTTT TTTTGGGTAATGGCTGGTTTG
AtWRKY70 (AT3G56400) ACTTGAGGACGCATTTTCTTGGAGG TGCTTTGTTGCCTTGCACCCTT
SAG12 (AT5G45890) TCCAATTCTATTCGTCTGGTGTGT CCACTTTCTCCCCATTTTGTTC
SAG18 (AT1G71190) GTTTGCGAGGTGAGAAAATAGGA AGAGTAGCATCGTTTGGGTGAAG
SAG20 (AT3G10985) TCGGTAACGTTGTTGCTGGA ACCAAACTCTTTCAAATCGCCA
SIRK (AF486619) AGCAGCTCAATTAAGTAAATGGCG CCCGCAATCTATACTTATGAAACCA
ACT2 AT3G18780 TGTGCCAATCTACGAGGGTTT TTTCCCGCTCTGCTGTTGT
Quantitative RT-PCR primer sequences of AtWRKY22, AtWRKY6, AtWRKY53, AtWRKY70, SAG12, SAG18, SAG20, ACT2 and SIRK.


at -80°C. RNA was extracted from these samples using an
RNeasy Plant Mini kit (Qiagen, USA). One microgram of DNase-
treated total RNA was used as a template for first-strand cDNA
synthesis. Reverse transcription was performed with M-MLV
Reverse Transcriptase (Sigma-Aldrich) and oligo (dT) primers
in a 20 µl reaction volume. One microliter of reverse transcrip-
tion product was used as template for qPCR. Reactions (20 µl
each) were performed using the Lightcycler FastStart DNA
Master SYBR Green I kit (Roche, Germany) on a Roche Light-
Cycler 480 real-time PCR machine, according to the manufac-
turer’s instructions. ACT2 (AT3G18780) was used as a control
in qPCR. Gene-specific primers for detecting transcripts of
ACT2, WRKY22, WRKY6, WRKY53, WRKY70, SAG12, SAG18,
SAG20 and SIRK are listed in Table 1. The qPCR reactions (20
µl each) for these genes contained the following: 10 µl 2×
TransStart Green SuperMix, 0.5 µM forward and reverse prim-
ers, and 1 µl cDNA. The annealing temperature was 60°C in all
cases. A no-template control was routinely included to confirm
the absence of DNA or RNA contamination. The mean value of
four replicates was normalized using the ACT2 gene as the
control. Standard curves were generated using linearized
plasmid DNA for each gene of interest. A second set of experi-
ments was conducted on an independent set of tissue as a
control.

Measurement of chlorophyll content
Chlorophyll was extracted from the fourth fully-grown leaf with
80% (v/v) acetone. Total chlorophyll content was determined
spectrophotometrically at 652 nm following the method of
Lichtenthaler (1987).

Measurement of cell death
The fourth fully-grown leaves, which were dark-treated for four
days, were completely submerged in 0.1% (grams per one
hundred milliliters) aqueous Evans Blue dye (Sigma-Aldrich)
and subjected to two five-min periods of vacuum followed by 30
min under vacuum. The leaves were then washed three times
with distilled water (15 min each). Dye bound to dead cells was
solubilized in 50% (v/v) methanol and 1% (w/v) SDS at 60°C for
30 min and then quantified by absorbance at 600 nm. For
100% cell death, the detached leaves were heated at 100°C for
5 min before staining. Two-to-three leaves were pooled for
each sample (Koch and Slusarenko, 1990). Six samples were
analyzed for each data point. This experiment was repeated six
times with equivalent results.
RESULTS

cDNA cloning, sequence analysis, and constitutive
expression of AtWRKY22 in different Arabidopsis
tissues with different developmental ages
The expression of Arabidopsis WRKY22 was induced by
pathogen attack (Dong et al., 2003). Therefore, we inoculated
four-week-old Arabidopsis rosette leaves with a DC3000 aviru-
lent strain of P. syringae pv. Tomato, and harvested the inocu-
lated-leaves after four hours. Total RNA was extracted in
preparation for reverse transcription. A full length AtWRKY22
cDNA sequence was obtained by RT-PCR and comprised 897
bp encoding a predicted 298 amino acid protein. Sequence
analysis at the amino acid level showed that the full-length At-
WRKY22 protein contained a single WRKY domain (WRKY-
GQK) and a characteristic Cys2His2 zinc-finger-like at its C-
terminus. WRKY proteins are classified into three groups ac-
cording to their structures (Eulgem et al., 2000), and AtWR-
KY22 belongs to group II.
High sequence similarity and similar expression profiles
might indicate similar function; therefore, we aligned the amino
acid sequence of four proteins: AtWRKY6, AtWRKY22, Os-
WRKY23, and AtWRKY53. The first three belong to subgroup II
and contain a typical WRKY domain and the zinc-finger-like
motif Cys2-His2, while AtWRKY53 belongs to subgroup III and
contains a zinc-finger-like motif Cys2-His/Cys in addition to the
WRKY domain. BLAST searching with the sequence of At-
WRKY22 (At4g01250) as the query found 36%, 55%, and 43%
identity at the amino acid level with AtWRKY53 (At4g23810),
AtWRKY6 (At1g62300), and OsWRKY23 (Os01g53260), re-
spectively (data not shown).
Although the similarity between AtWRKY22 protein and At-
WRKY53, AtWRKY6, OsWRKY23 proteins is not high, the
relative high expression level of AtWRKY22 was found to be
the same as AtWRKY53 and OsWRKY23 under the condition
of dark-induced senescence (Jing et al., 2009; Miao et al.,
2004) (Figs. 2D and 7D). On the other hand, there was a basal
expression of AtWRKY22 in all organs examined under normal
conditions, including roots, cotyledons, rosette leaves, cauline
leaves, flowers, inflorescence stalks, and siliques. The roots
and siliques exhibited higher AtWRKY22 expression than the
other organs. Though as the age of the rosette leaves in-
creased, the expression of AtWRKY22 was very slightly en-
hanced (Fig. 1), statistical test showed that there was no any
difference among rosette leaves and roots with different devel-

Page 4

306 WRKY22 Mediates Dark-Induced Leaf Senescence in Arabidopsis






















Fig. 1. Relative RNA levels of Arabidopsis WRKY22 were analyzed
by real-time PCR using gene-specific primers (Table 1) in different
organs (rt, root; cn, cotyledon; rl, rosette leaf; s, inflorescence stalks;
cl, cauline leaf; f, flower; si, silique) with different ages (the number
after the letters represent development age, for example rt7 de-
notes roots of seven days developmental age). Histograms are the
average of triplicate assays and the bars indicate SD.


opmental age.

Expression profiles of AtWRKY22 in response to light,
dark, and H2O2
To confirm whether AtWRKY22 transcription is induced by light
and dark signals, we performed Northern blot hybridization
using the full-length WRKY22 cDNA as a probe. Wild-type
plants were grown in a chamber under long-day (16 h light/8 h
dark) or short-day (8 h light/16 h dark) conditions and harvested
at three-hour intervals over two days. WRKY22 transcription
was suppressed by light but induced by dark treatment (Figs.
2A and 2B). The level of AtWRKY22 transcripts increased
gradually when plants were transferred from light to dark condi-
tions, reaching a peak when under continuous dark conditions
for two days. Thereafter, a high relative mRNA level of At-
WRKY22 was maintained (Fig. 2D). These results indicated
that AtWRY22 transcription is regulated by light and dark sig-
nals. In addition, AtWRKY22 transcription was maintained at a
high level after 3% H2O2 treatment for six hours (Fig. 2C). Both
of dark (Keench et al., 2007) and H2O2 (David, 1995) treatment
can induce plant senescence, thus AtWRKY22 might partici-
pate in senescence-induced signal transduction pathways.

Arabidopsis WRKY22 mutants result in a delayed-
senescence phenotype of detached leaves
To better understand the biological function of the AtWRKY22
gene in cell senescence, we first characterized WRKY22 T-
DNA insertion mutants (W22m-1, salk_094892; W22m-2, salk_
056943). The structure of the AtWRKY22 gene and position of
the T-DNA insertion in the AtWRKY22 mutants is illustrated in
Fig. 3A. The AtWRKY22 gene is located on the Arabidopsis
fourth chromosome and contains two introns and three extrons
(Fig. 3A). The expression of WRKY22 was clearly suppressed
in the W22m-1 mutant plants and decreased to a great extent
in the W22m-2 mutant plants (Fig. 3B). Although minor differ-
ences in physiological phenotypes existed between the two
AtWRKYY22 mutants under dark conditions, the physiological
change was roughly similar, indicating that the function of the
A






B







C D






Fig. 2. RNA blot analysis of the WRKY22 expression profiles in
Arabidopsis under alternate light-dark treatment, H2O2 application,
and continuous dark conditions. (A) The expression profile of Arabi-
dopsis WRKY22 over the two-day experimental period under long-
day (16 h light/8 h dark) conditions. Illumination was from 8:00 to
22:00. Sampling under dark conditions was undertaken at 24:00,
3:00, and 6:00. Sampling under light conditions was undertaken at
9:00, 12:00, 15:00, 18:00 and 21:00. (B) The expression profile of
Arabidopsis WRKY22 over the two-day experimental period under
short-day (8 h light/16 h dark) conditions. Illumination was from
10:00 to 18:00. Sampling under dark conditions was undertaken at
21:00, 24:00, 3:00, 6:00, and 9:00. Sampling under light conditions
was undertaken at 12:00, 15:00, and 18:00. (C) Arabidopsis WRKY22
expression profile after treatment with 3% (gram/100 ml) H2O2 for 1-
6 h. (D) Arabidopsis WRKY22 expression profile under continuous
dark conditions for up to eight days. Ck in Figs. (C and D) represent
AtWRKY22 expression levels under normal conditions. As a control
for equal loading, ethidium bromide staining of RNA is shown at the
bottom; each lane was loaded with 20 µg total RNA.


AtWRKY22 gene is lost completely in W22m-1 and almost
completely in W22m-2. The T-DNA sequence was inserted in
the 3′ terminal region of AtWRKY22 in the W22m-2 mutant,
leading to decreased AtWRKY22 transcription and reduced
translational efficiency. Besides the change of AtWRKY22 ex-
pression and translation, no other obvious differences in mor-
phology or growth were observed between the wild-type and
two mutant plants under normal growth conditions (data not
shown).
Earlier work demonstrated that both H2O2 (David, 1995) and
dark (Keench et al., 2007) could induce plant senescence. At-
WRKY22 transcription increased continuously with 3% H2O2
treatment (Fig. 2C) and with continuous dark treatment (Fig.
2D), indicating that AtWRKY22 might have a physiological role
in the senescence-related signal transduction pathways. There-
fore, we assessed the function of AtWRKY22 in vivo in dark-
induced leaf senescence. We first examined the responses to
dark of detached leaves of different ages from WRKY22-
mutants. The detached leaves from AtWRKY22-mutants showed
a moderate delayed-senescence phenotype compared with

Page 5

Xiang Zhou et al. 307


A B












C D














E F



















wild-type plants (Fig. 3C). To minimize any developmental ef-
fects, full-grown fourth euphylla (referring to the sixth leaf of
each plant from left to right in Fig. 3C) were used in the follow-
ing experiments. The fourth euphylla of WRKY22 mutants and
wild-type plants were detached and treated with continuous
dark for four days. The response of detached leaves to dark
treatment was monitored by measuring the chlorophyll content
and the cell death rate. Staining showed that a small quantity of
dead cells occurred at the edge or middle of the leaves from the
two mutants, while many dead cells were found in those of wild-
type plants (Fig. 3D). Significantly lower levels of cell death
were observed in the mutant leaves compared to the wild-type
when cell death was measured spectrophotometrically (Fig. 3F).
The decrease in leaf chlorophyll content in the wild-type plants
(from 0.84 µg.g-1.FW-1 to 0.19 µg.g-1.FW-1) was larger than in
the two AtWRKY22 mutants (from 0.82 µg.g-1.FW-1 to 0.31 µg.
g-1.FW-1 for W22m-1; from 0.81 µg.g-1.FW-1 to 0.28 µg.g-1.FW-1
for W22m-2) (Fig. 3E). These results showed that mutation of
AtWRKY22 resulted in an altered response to dark-induced leaf
senescence.

Over-expression of Arabidopsis WRKY22 influences plant
morphogenesis
To characterize the physiological function of the AtWRKY22
gene in dark-induced senescence, we generated more than 25
independent transgenic Arabidopsis lines, each harboring the
AtWRKY22 cDNA under the control of the CaMV 35S promoter
(35S:W22). RNA blotting analysis showed that five transgenic
plants contained a high level of the AtWRKY22 transcript under
normal conditions (Fig. 4A). These transgenic 35S:W22 plants
exhibited serious morphological and developmental defects.
During the entire vegetative growth phases, 35S:W22 plants
showed stunted growth (Fig. 4C), a more compact growth form
(Fig. 4B), and narrower leaves (Figs. 4E and 4F). The most
striking phenotype was partial sterility. The young siliques of
WRKY22 over-expression transgenic plants were undeveloped
Fig. 3. Characteristic and delayed-sene-
scence phenotypes of the WRKY22 T-
DNA insertion mutant plants (W22m-1,
salk_094892; W22m-2, salk_056943). (A)
Characterization of the Arabidopsis WRKY22
gene and position of the T-DNA insertion
sites. (B) PCR screening and examining
by hybridization of the Arabidopsis WR-
KY22 mutant lines. (C) Senescence symp-
toms of detached leaves from the WR-
KY22 mutant and control plants of different
ages after dark treatment for four days. (D)
Staining of dead cells with Evans Blue in
detached full-grown fourth rosette leaves
of the control and WRKY22 mutants. (E)
Chlorophyll content in detached full-grown
fourth rosette leaves of control and WRK-
Y22 mutant plants measured spectropho-
tometrically. FW, fresh weight. (F) Cell
death measured spectrophotometrically
using Evans Blue staining of detached full-
grown fourth rosette leaves of control and
WRKY22 mutant plants after dark treat-
ment for four days. (E) and (F), Error bars
indicate SD (n = 6). Differences between
wild type (Wt) plants and mutant lines were
tested with one-way ANOVA followed by
LSD post hoc test. *Differences for AtWR-
KY22 mutants compared with wild-type
plants are significant (P < 0.05, n = 6).