The influence of bisphosphonates on human osteoblast migration and integrin aVb3/tenascin C gene expression in vitro.

Felix P Koch, Annette Wunsch, Christina Merkel, Thomas Ziebart, Andreas Pabst, Sareh Said Yekta, Marco Blessmann, Ralf Smeets

Department of Oral and Maxillofacial Surgery, University medical centre of Johannes Gutenberg University Mainz, Augustusplatz 2, 55131 Mainz, Germany.

Journal Article: Head & Face Medicine 02/2011; 7(1):4. DOI: 10.1186/1746-160X-7-4

Abstract

Bisphosphonates are therapeutics of bone diseases, such as Paget's disease, multiple myeloma or osteoclastic metastases. As a severe side effect the bisphosphonate induced osteonecrosis of the jaw (BONJ) often requires surgical treatment and is accompanied with a disturbed wound healing.Therefore, the influence on adhesion and migration of human osteoblasts (hOB) after bisphosphonate therapy has been investigated by morphologic as well as gene expression methods.
By a scratch wound experiment, which measures the reduction of defined cell layer gap, the morphology and migration ability of hOB was evaluated. A test group of hOB, which was stimulated by zoledronate 5 × 10(-5)M, and a control group of unstimulated hOB were applied. Furthermore the gene expression of integrin aVb3 and tenascin C was quantified by Real-Time rtPCR at 5 data points over an experimental period of 14 days. The bisphosphonates zoledronate, ibandronate and clodronate have been compared with an unstimulated hOB control.
After initially identical migration and adhesion characteristics, zoledronate inhibited hOB migration after 50 h of stimulation. The integrinavb3 and tenascin C gene expression was effected by bisphosphonates in a cell line dependent manner with decreased, respectively inconsistent gene expression levels over time. The non-nitrogen containing bisphosphonates clodronate led to decreased gene expression levels.
Bisphosphonates seem to inhibit hOB adhesion and migration. The integrin aVb3 and tenascin C gene expression seem to be dependent on the cell line. BONJ could be enhanced by an inhibition of osteoblast adhesion and migration. The gene expression results, however, suggest a cell line dependent effect of bisphosphonates, which could explain the interindividual differences of BONJ incidences.

Source: PubMed

Comments on this publication

ResearchGate members can add comments. Sign up now and post your comment!

Similar publications

Page 1
 
Page 2
 
Page 3
 
Page 4
 
Page 5
 
End of preview.
Page 1
RESEARCH Open Access
The influence of bisphosphonates on human
osteoblast migration and integrin aVb3/tenascin C
gene expression in vitro
Felix P Koch1, Annette Wunsch1, Christina Merkel1, Thomas Ziebart1, Andreas Pabst1, Sareh Said Yekta2*,
Marco Blessmann3, Ralf Smeets3*
Abstract
Background: Bisphosphonates are therapeutics of bone diseases, such as Paget’s disease, multiple myeloma or
osteoclastic metastases. As a severe side effect the bisphosphonate induced osteonecrosis of the jaw (BONJ) often
requires surgical treatment and is accompanied with a disturbed wound healing.
Therefore, the influence on adhesion and migration of human osteoblasts (hOB) after bisphosphonate therapy has
been investigated by morphologic as well as gene expression methods.
Methods: By a scratch wound experiment, which measures the reduction of defined cell layer gap, the
morphology and migration ability of hOB was evaluated. A test group of hOB, which was stimulated by
zoledronate 5 × 10-5M, and a control group of unstimulated hOB were applied. Furthermore the gene expression
of integrin aVb3 and tenascin C was quantified by Real-Time rtPCR at 5data points over an experimental period of
14 days. The bisphosphonates zoledronate, ibandronate and clodronate have been compared with an unstimulated
hOB control.
Results: After initially identical migration and adhesion characteristics, zoledronate inhibited hOB migration after
50 h of stimulation. The integrinavb3 and tenascin C gene expression was effected by bisphosphonates in a cell
line dependent manner with decreased, respectively inconsistent gene expression levels over time. The non-
nitrogen containing bisphosphonates clodronate led to decreased gene expression levels.
Conclusion: Bisphosphonates seem to inhibit hOB adhesion and migration. The integrin aVb3 and tenascin C gene
expression seem to be dependent on the cell line. BONJ could be enhanced by an inhibition of osteoblast
adhesion and migration. The gene expression results, however, suggest a cell line dependent effect of
bisphosphonates, which could explain the interindividual differences of BONJ incidences.
Background
Bisphosphonates are proven to be effective in the treat-
ment of benign or malignant skeletal diseases character-
ized by enhanced bone resorption. They are comprised
of two phosphate groups, which are capable of binding
divalent ions, such as Mg2+ and Ca2+. This activity is
the basis of bone targeting of these therapeutics. These
effects, however, also seem to be dependent on the PH
value [1]. Bisphosphonates not only inhibit proliferation
and induce apoptosis in cultured cancer cells, but addi-
tionally interfere with adhesion of cancer cells and
osteoblasts to the bone matrix and inhibit cell migration
and invasion [2,3]. The influence on cell migration and
adhesion could also affect the wound healing potency of
osteoprogenitor cells after dentoalveolar surgery and
promote the side effect of BONJ.
Osteoblast migration is regulated by several surface
proteins, such as integrins. These are responsible for cell
adhesion as well as cell signaling [4,5]. Another recently
discussed substrate is tenascin C, which seems to influ-
ence the function of other adhesion proteins such as
* Correspondence: ssaidyekta@izkf.rwth-aachen.de; rasmeets@ukaachen.de
2Department of Oral and Maxillofacial Surgery, University Hospital Aachen,
Pauwelsstraße 30, 52074 Aachen, Germany
3Department of Oral and Maxillofacial Surgery, University Medical Center
Hamburg-Eppendorf, Martinistraße 52, 20246 Hamburg, Germany
Full list of author information is available at the end of the article
Koch et al. Head & Face Medicine 2011, 7:4
http://www.head-face-med.com/content/7/1/4
HEAD & FACE MEDICINE
© 2011 Koch et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in
any medium, provided the original work is properly cited.
Page 2
adhesins and syndecans [6]. Tenascin as well influences
cell shape and inhibits the activity of the focal adhesion
kinase, an intracellular protein binding the integrins and
accumulating vinculin, talin and a-actinin in the focal
adhesion site [6-8]. The function of tenascin C for cell
adhesion, however, is controversially discussed. There
are reports of a stimulation as well as inhibition effect
on cell adhesion and migration [9-11]. Tenascin C
knockout mice showing an altered fracture healing, it
seems to be an important regulator of osteoblast migra-
tion during wound healing [12].
Since adhesion and migration are important factors of
wound healing, this study aimed to investigate the influ-
ence of zoledronate on osteoblast by morphologic cell
culture experiments as well as integrin aVb3 and tenas-
cin C gene expression.
Materials and methods
Cell migration tests
- Scratch Wound
Human osteoblasts (HOB-c, Promo Cell, Heidelberg,
Germany) between passages 5-7 were cultured on 6-well
plates, covering the whole bottom of the well after five
days of cultivation. A defined scratch was applied on the
well bottom, which detached cells within a definite cor-
ridor. Over a time period of five days the percental reco-
vering of the scratch wound was monitored.
Gene expression analysis
- Cell culture
Human osteoblasts (HOB-c, Promo Cell, Heidelberg,
Germany) between passages 5-7 were cultured at a den-
sity of 200 000 cells per well using 6-well plates. They
were allowed to attach for two days using an osteoblast
specific medium (10% FCS/DMEM Dulbecco modified
medium (Invitrogen, Carlsbad, Ca/US) containing 1% L-
glutamin, 1% penicillin/streptomycin/neomycin, 1%
ascorbic acid, and 20 μg/ml dexamethasone. After the
attachment phase, the cells were stimulated by osteo-
blast specific medium containing zoledronate, ibandro-
nate or clodronate at a concentration of 5 × 10-5M. The
osteoblast specific cell culture medium without bispho-
sphonate supplement was used for control. The media
and bisphosphonates were renewed every 4 days for a
period of 14 days to guarantee a constant stimulation
und nutrition supply over the experimental period.
- mRNA extraction and reverse transcriptase polymerase
chain reaction (RT-PCR)
On day 1, 2, 5, 10, and 14 of cultivation, the osteoblasts
were detached with 0.05% trypsin-EDTA solution (Invitro-
gen, Carlsbad, Ca, US) and individually harvested. mRNA
was extracted using a silicate gel technique that was
provided by the Qiagen RNeasy extraction kit (Qiagen,
Hilden, Germany). This included a DNAse digestion step.
The amount of extracted mRNA was measured by extinc-
tion at 260 nm; the contamination with proteins was deter-
minated with the 260/280 ratio.
To detect the mRNA of integrin aVb3 and tenascin C
in osteoblasts, primers were designed using NCBI-
nucleotide library and Primer3-design (Table 1). All pri-
mers had been matched to the mRNA sequences of the
target genes (NCBI Blast software).
As housekeeping genes, human ribosomal protein
(HuPO), actin, glyceraldehyde-3-phosphate dehydrogen-
ase (GAPDH) and ribosomal protein S18 (RPS18) were
evaluated. We were able to show the most stable expres-
sion for the actin, GAPDH and RPS18 genes by compar-
ing the bisphosphonate stimulated versus a non
stimulated cell-culture using a specialized freeware,
called GeNorm.
As a quantitative RT-PCR we used the SYBR Green
Real Time PCR (oneStep RT-PCR, Bio-Rad, Hercules,
CA/USA). This method enables reverse transcription
using the individual primers immediately before PCR
amplification and SYBR Green fluorescence measure-
ment for quantification of gene expression. Samples
were amplified in 96-well microplates in an IQ5-Cycler
(Bio-Rad, Hercules, CA/USA) with an annealing tem-
perature of 56°C and an elongation temperature of 71°C
over 40 cycles. Background was to determine over 3-10
cycles and the threshold were set above this fluores-
cence, crossing the SYBR green fluorescence curve at
the exponential part. This method was applied to calcu-
late the cycle number and CT-value for quantitation.
Furthermore, the CT-values of actin, GAPDH and
RPS18 housekeeping genes and the individual primer
efficacy were considered. Single product formation was
confirmed by melting point analysis. For negative con-
trol, water instead of mRNA-samples was used.
CDNA from individual cell experiments was analyzed
in triplicate PCR. The ΔΔCT method was applied
[13,14] for a statistical analysis of the CT-values. For
each specific primer and Real-Time PCR, the efficiency
was calculated on the basis of the SYBR Green fluores-
cence curves and the standard dilution series. The rela-
tive gene expression levels were standardized with those
measured in the unstimulated control, which was set to
Table 1 Oligonucleotide primer sequences used for Real
Time PCR
Sense Antisense
Integrin
aVb3
TTGTTTCAGGAGTTCCAAGA TGAAGAGAGGTGCTCCAATA
Tenascin C GAGACATCTGTGGAAGTGGA CGTACTCAGTGTCAGGCTTC
GAPDH AAAAACCTGCCAAATATGAT CAGTGAGGGTCTCTCTCTTC
RPS 18 TCGGAACTGAGGCCATGA GAACCTCCGACTTTCGTTC
Actin GGAGCAATGATCTTGATCTT CCTTCCTGGGCATGGAGTCCT
Koch et al. Head & Face Medicine 2011, 7:4
http://www.head-face-med.com/content/7/1/4
Page 2 of 7
Page 3
100%. Each point in time for relative mRNA is the mean
+/- standard deviation.
- Statistical analysis
The mean values and standard deviations were calcu-
lated by the IQ5-software (BioRad, Hercules, CA/USA)
to provide a descriptive data analysis.
Results
Scratch wound
Figure 1 shows microscopic pictures of the experiments
12, 36, 50 and 78 hours after the scratch wound setting.
The morphologic changes of the attached cells as well as
the differing width of the scratch wounds are presented.
Compared to the unstimulated control, zoledronate
changed the typical dendritic osteoblast morphology to
spherical appearance. The cellular gap was opened after
an intermediate closure after 50 h again (Figure 1).
The gap of the scratch wound compared to the width
of the gap at the beginning of the experiment is demon-
strated by Figure 2. Both, the hOBs of the control as
well as the zoledronate group, tended to close the
scratch wound gap during the first 36 h. After 50 h,
however, the gap was not further reduced in the
zoledronate group, while the scratch wound gap has
been completely recovered after 78 h in the control
group (Figure 2a &2b).
Integrin aVb3 gene expression
With respect to the different hOB cell lines, integrin aVb3
was expressed at different levels. Furthermore, the integrin
aVb3 gene expression was influenced in a time dependent
manner. Figure 3a shows an enhanced gene expression at
day 2, 6 and 14 with a maximum of 500% after stimulation
by zoledronate and ibandronate, whereas at day 1 and 10
the gene expression was decreased compared to the unsti-
mulated control. The integrin gene expression of another
cell line is presented in Figure 3b. At all data points the
gene expression was lower compared to control after sti-
mulation with zoledronate.
The non-nitrogen containing clodronate was
expressed at lower levels during the first 10 days and
caused as well a higher gene expression at day 14 com-
pared to control (Figure 2a; Table 2a).
Tenascin C gene expression
Except for the first day with zoledronate stimulation and
day 14, tenascin C was expressed at lower levels after
Figure 1 Synopsis of scratch wound microscopic images during the first 78 h: (a) control, (b) stimulation by zoledronate 5 × 10-5M.
(Magnification 10×).
Koch et al. Head & Face Medicine 2011, 7:4
http://www.head-face-med.com/content/7/1/4
Page 3 of 7
Page 4
zoledronate and ibandronate stimulation. Both cell lines
were affected by bisphosphonates in the same way
(Figure 4a, Figure 4b). At day 14, tenascin C gene
expression was evidently enhanced.
The non-nitrogen containing bisphosphonate clodro-
nate caused as well a decreased gene expression during
the first 10 experimental days. Tenascin C, however,
was not significantly enhanced at day 14 compared to
the unstimulated control (Figure 4a; Table 2b).
Discussion
The migration of osteogenic cells is a crucial step during
physiological wound healing. This regulation seems to
be disturbed after application of bisphosphonates, as
most BONJ occur after surgery of the oral cavity.
The data of our study suggest an inhibition of hOB
migration and disturbance of cell morphology by
bisphosphonates.
With respect to other studies, this is in agreement
with the inhibition of metastases ingrowths and tumor
cell migration. Additionally to published studies on hOB
migration, which could as well show the inhibition of
migration, by morphologic methods, this work gives
insight in the cellular mechanisms responsible for adhe-
sion and migration. For the first time the effect of
bisphosphonates on integrin aVb3 and tenascin C gene
expression has been quantified in hOBs.
Integrin aVb3 plays an important role in focal adhe-
sion, intercellular communication and differentiation.
Overall, it regulates cell migration and adhesion, stimu-
lated by extracellular ligands as laminin, fibronectin and
tenascin.
Tenascin C regulates OB focal adhesion by interacting
with extracellular proteins and cellular receptors as integ-
rins [15-17]. It is elevated during wound healing and
tumor invasion [18]. As differential local detachment and
Figure 2 Box plot graph of the scratch wound gap over the experimental period of 130 h. (relative scratch wound gap compared to the
initial gap).
Koch et al. Head & Face Medicine 2011, 7:4
http://www.head-face-med.com/content/7/1/4
Page 4 of 7
Page 5
reattachment of cells to the extracellular matrix is
required during cell growth and wound healing, tenascin
C seems to have adhesive and antiadhesive functions
[19,20], possibly depending on isoforms produced by
alternative splicing [21].
Corresponding to literature and our morphologic find-
ings, the downregulation of the adhesive genes integrin
aVb3 and tenascin C, which possibly even enhanced the
antiadhesive effect by autocrine secretion, could be one
of the molecular, intracellular reasons for the BONJ.
Figure 3 Quantitative RT-PCR-results of integrin aVb3 gene expression as fold of unstimulated control gene expression (means +/-
SD), that was set at 1 (100%). (a & b are due to different hOB cell lines).
Koch et al. Head & Face Medicine 2011, 7:4
http://www.head-face-med.com/content/7/1/4
Page 5 of 7
End of preview.
Preview full-text

Science & Research Jobs

Keywords

5 data points
 
bisphosphonate induced osteonecrosis
 
bisphosphonate therapy
 
Bisphosphonates
 
bisphosphonates clodronate
 
bisphosphonates zoledronate
 
bone diseases
 
BONJ incidences
 
cell layer gap
 
cell line
 
cell line dependent effect
 
experimental period
 
gene expression levels
 
gene expression results
 
inconsistent gene expression levels
 
scratch wound experiment
 
severe side effect
 
tenascin C gene expression
 
unstimulated hOB control
 
zoledronate inhibited hOB migration