The clock gene Period3 in the nocturnal flatfish Solea senegalensis: Molecular cloning, tissue expression and daily rhythms in central areas.

Abstract

Clock genes are responsible for generating and sustaining most rhythmic daily functions in vertebrates. Their expression is endogenously driven, although they are entrained by external cues such as light, temperature and nutrient availability. In the present study, a full-length coding region of Solea senegalensis clock gene Period3 (Per3) has been isolated from sole brain as a first step in understanding the molecular basis underlying circadian rhythms in this nocturnal species. The complete cDNA is 4141 base pairs (bp) in length, including an ORF of 3804bp, a 5'UTR of 247bp and a 3'UTR of 90bp. It encodes a putative PERIOD3 protein (PER3) of 1267 amino acids which shares the main functional domains conserved between transcription factors regulating the circadian clock pathway. Sole PER3 displays high identity with PER3 proteins from teleost species (61-77%) and lower identity (39-46%) with other vertebrate PER3 sequences. This gene is expressed in all examined tissues, being mRNA expression particularly evident in retina, cerebellum, diencephalon, optic tectum, liver and ovary. Per3 exhibits a significant daily oscillation in retina and optic tectum but not in diencephalon and cerebellum. Our results suggest an important role of Per3 in the circadian clockwork machinery of visually-related areas of sole.

Full text

Page 1

The clock gene Period3 in the nocturnal flatfish Solea senegalensis: Molecular cloning,
tissue expression and daily rhythms in central areas
Águeda J. Martín-Roblesa,b,e, Esther Isornaa,c, David Whitmored,
José A. Muñoz-Cuetoa,e,⁎, Carlos Pendónb,⁎⁎
aDepartamento de Biología, Facultad de Ciencias del Mar y Ambientales, Universidad de Cádiz, E-11510, Puerto Real, Spain
bDepartamento de Biomedicina, Biotecnología y Salud Pública, Facultad de Ciencias, Universidad de Cádiz, E-11510, Puerto Real, Spain
cDepartamento de Fisiología (Fisiología Animal II), Facultad de Biología, Universidad Complutense de Madrid, E-28040, Madrid, Spain
dDepartment of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, London WC1E 6DE, United Kingdom
eCACYTMAR, Institutos de Investigación, Campus Universitario de Puerto Real, E-11510, Puerto Real, Spain
a b s t r a c ta r t i c l e i n f o
Article history:
Received 28 September 2010
Received in revised form 13 January 2011
Accepted 13 January 2011
Available online 31 January 2011
Keywords:
Circadian rhythms
Clock genes
Daily expression
Flatfish
Light
Period3
Clock genes are responsible for generating and sustaining most rhythmic daily functions in vertebrates. Their
expression is endogenously driven, although they are entrained by external cues such as light, temperature
and nutrient availability. In the present study, a full-length coding region of Solea senegalensis clock gene
Period3 (Per3) has been isolated from sole brain as a firststep in understanding the molecular basis underlying
circadian rhythms in this nocturnal species. The complete cDNA is 4141 base pairs (bp) in length, including an
ORF of 3804 bp, a 5′UTR of 247 bp and a 3′UTR of 90 bp. It encodes a putative PERIOD3 protein (PER3) of 1267
amino acids which shares the main functional domains conserved between transcription factors regulating
the circadian clock pathway. Sole PER3 displays high identity with PER3 proteins from teleost species (61–
77%) and lower identity (39–46%) with other vertebrate PER3 sequences. This gene is expressed in all
examined tissues, being mRNA expression particularly evident in retina, cerebellum, diencephalon, optic
tectum, liver and ovary. Per3 exhibits a significant daily oscillation in retina and optic tectum but not in
diencephalon and cerebellum. Our results suggest an important role of Per3 in the circadian clockwork
machinery of visually-related areas of sole.
© 2011 Elsevier Inc. All rights reserved.
1. Introduction
Theexistenceofcircadianrhythmsinbiochemical,physiologicaland
behavioral processes is a shared characteristic of all living organisms
from prokaryotes to humans. The genetic and molecular bases of these
rhythmsareknowntobehighlyconservedalongthephylogeneticscale
and are sustained by autoregulatory transcriptional–translational
mechanisms that involve a set of so-called clock genes (Bell-Pedersen
et al., 2005). In the last few years, many clock genes (as for example
Clock, Per1, Per2, Per3, Bmal1, Cryptochrome1, Cryptochrome2, casein
kinase 1epsilon and 1delta) have been cloned and characterized in
mammals (Reppert and Weaver, 2001, Okamura, 2004), revealing the
existence of two interlocked positive (represented by CLOCK and
BMAL1) and negative (represented by PERIOD and CRYPTOCHROME)
feedbackloops(Hastings,2000;Shearmanetal.,2000).Thesegenes are
expressed in a circadian manner, not only in the classical pacemaker
structures(thehypothalamicsuprachiasmaticnucleusofmammalsand
theretinaandpinealglandofnon-mammalianvertebrates)butalsoina
variety of peripheral tissues and cell types (Balsalobre, 2002; Okamura,
2004; Green and Besharse, 2004). Altogether, this evidence suggests
that the vertebrate circadian system may be highly distributed instead
of being restricted to “master” clocks, and this fact is especially true in
teleosts, where peripheral tissues appear to be also directly light
responsive (Whitmore et al., 2000a).
Teleost clock genes have received relatively little attention, with the
exception of detailed studies performed in the zebrafish, Danio rerio
(Whitmore et al., 1998a, 2000b; Tamai et al., 2005). Nevertheless, there
is a growing interest for the study of teleost circadian systems and their
molecularcontrol,sincezebrafishcannotreallyrepresentallofthislarge
and diverse class of vertebrates (Cahill,2002).Thus,recentstudieshave
been carried out in other diurnal species such as the rainbow trout
Oncorhynchus mykiss (Mazurais et al., 2000), the reef fish Siganus
guttatus (Park et al. 2007; Sugama et al., 2008; Takemura et al., 2010),
and the goldfishCarassius auratus (Velardeet al.,2009), and on diurnal/
nocturnal switching species such as the Atlantic salmon Salmo salar
(Davie et al., 2009) and the European sea bass Dicentrarchus labrax
Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15
⁎ Corresponding author. Tel.: +34 956016023; fax: +34 956016019.
⁎⁎ Corresponding author. Tel.: +34 956016391; fax +34 956016119.
E-mail addresses: munoz.cueto@uca.es (J.A. Muñoz-Cueto), carlos.pendon@uca.es
(C. Pendón).
1095-6433/$ – see front matter © 2011 Elsevier Inc. All rights reserved.
doi:10.1016/j.cbpa.2011.01.015
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part A
journal homepage: www.elsevier.com/locate/cbpa

Page 2

(Sánchez et al., 2010). However, to the best of our knowledge, there are
no studies of clock genes in nocturnal fish species as the sole.
The Senegalese sole, Solea senegalensis, is a flatfish species with a
great commercial interest in Southern Europe for marine aquaculture
(Dinis et al., 1999). This metamorphic species is also acquiring an
important relevance in chronobiological studies as the number of
published works focused on the sole circadian system has increased in
the last few years. Recent studies have shown that adult sole displays
nocturnal locomotor activity and feeding habits (Bayarri et al., 2004;
Boluda-Navarro et al., 2009). The sole also exhibits daily (nocturnal),
lunar and annual reproductive rhythms (Anguis and Cañavate, 2005;
García-Lópezetal.,2007;Guzmánetal.,2008;Oliveiraetal.,2009).Daily
rhythms inplasma melatonin(Bayarri etal.,2004; Vera etal.,2007) and
melatonin receptors (Oliveira et al., 2008; Confente et al., 2010) have
also been reported in sole, with lower levels during the day and higher
levels during the night. These rhythms are established at early
developmental stages as revealed by the existence of daily variations
on the expression of the melatonin biosynthesis enzyme AANAT2 from
2 days post-fertilization (Isorna et al., 2009). However, molecular
mechanisms underlying sole circadian rhythms remain unexplored.
Consequently, we have focused our efforts in characterizing the
molecular clockwork machinery sustaining circadian rhythms in this
nocturnalflatfish.Inafirststep,theclockgenePer3waschosenbecauseis
the only Period gene that shows mRNA rhythms in constant conditions
and has been proposed as the most important gene for the control of
activityrhythmsinfish(Pandoetal.,2001;Kanekoetal.,2006).Moreover,
Per3 mRNA has been shown to oscillate rhythmically in embryos, its
transcript cycles starting on day 1 post-fertilization with or without any
entraining signals (Delaunay et al., 2000). In addition, ambient temper-
ature also affected the developmental profile, the levels and cycling
amplitudesofPer3mRNAinzebrafishembryos(KanekoandCahill,2005).
The present work conducted in sole was aimed at obtaining molecular
tools to analyze the tissue distribution and daily expression pattern of
Per3,oneofthemaincomponentsoftheendogenousclockinvertebrates.
2. Material and methods
2.1. Animals and sampling
Adult vitellogenic female sole specimens (S. senegalensis) from 200 to
300 ginbodymasswerehousedinthe “LaboratoriodeCultivosMarinos”
(University of Cadiz, Puerto Real, Spain). Animals were kept in running
seawater at a constant temperature and salinity of 19±1 °C and 39 ppt,
respectively,inindoorfacilitiesreceivingnaturalenvironmentallight.Fish
were fed by automatic feeders with commercial 2 mm dry pellets
(SkrettingEspañaS.A,Burgos,Spain)toapparentsatiety.Thisresultedina
daily ration of about 1% body weight. Fish were fasted for 24 h before
sampling.TheywereanaesthetizedinMS-222(Sigma,StLouis,MO;100–
200 mg/L of water) before sacrifice. Experimental animals were treated
according to the European Union Directive (EEC, 1986) for the protection
of animals used for experimental and other scientific purposes.
Forcloningexperiments,Northernblotandtissuedistributionstudies,
sole specimens were sacrificed in March during daytime between
ZeitgeberTime(ZT)3andZT5,andneural(olfactorybulbs,telencephalon,
optic tectum-tegmentum, diencephalon, cerebellum-vestibulolateral
lobe, medulla, and retina, see Fig. 1 and Rodríguez-Gómez et al., 2000)
and peripheral tissues (pituitary, gills, heart, liver, kidney, intestine and
ovary) were collected.
To determine daily variations in Per3 mRNA expression, a total of 36
animals from the same broodstock were anaesthetized, killed by
decapitation in March, and the brain was immediately removed at six
different ZT points (n=6 at each point) during a 24 h cycle: ZT0, ZT4,
ZT8, ZT12, ZT16 and ZT20 (sunrise 07:28; sunset, 19:20). Retina, optic
tectum, diencephalon and cerebellum were dissected as previously
reported (Fig. 1). At night, sampling was performed under a dim red
light. All samples were frozen immediately inliquid nitrogen andstored
at −80 °C until used.
2.2. Molecular cloning
Gene walkingbasedstrategy and5′–3′ rapid amplification of cDNA
ends (RACE) were used to obtain the full-length coding region of sole
Per3 cDNA (Fig. 2). Total RNA was extracted from adult frozen brain
using TRIsure Reagent® (Bioline, London, UK) according to the
manufacturer's instructions. RNA was digested with DNase I (USB,
Cerdanyola, Spain) to remove genomic DNA and it was reverse
transcribed using SMARTTMRACE cDNA kit (BD Bioscience, Clontech,
Palo Alto, CA, USA). This cDNA was used as a template in polymerase
chain reactions (PCR) with the Advantage II polymerase PCR kit (BD
Bioscience), which permitted us to obtain five overlapping sole Per3
Fig. 1. Schematic representation of the sole brain (sagittal view) that depicts dissections
used in the present study to carry out the Per3 expression studies in the sole brain.
1: Olfactory bulbs; 2: Telencephalon; 3: Optic tectum-tegmentum; 4: Diencephalon;
5: Pituitary; 6: Cerebellum-vestibulolateral lobe; and 7: Medulla oblongata-spinal cord.
Bar scale: 1 mm.
Fig. 2. Schematic diagram of the sole Per3 cDNA. Cloning strategy including primer pair locations for PCR and product sizes is shown. The five Per3 overlapping fragments (black
rectangles) are numbered as I, II, III, IV and V, following the sequential order of cloning. Primers are represented by arrowheads (see Table 1, for details). Bold numbers indicate the
primers used for the cloning of long overlapping fragments and italic numbers indicate the primers used for nested and seminested PCR reactions. 5′ and 3′ RACE primers are
included in the BD SMART™ RACE cDNA amplification kit.
8
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 3

fragments (Fig. 2). Degenerated forward primers were designed from
Per3 sequences available in the public databases and specific reverse
primers were designed from the partial sequences obtained (Table 1)
using the Oligo Explorer v 1.2 software.
The cDNA fragments I, II and III were amplified from the 3′-RACE-
Ready cDNA and cDNA fragments IV and V were obtained using the 5′-
RACE-ReadycDNAlibrary(Fig.2).First(I)andsecond(II)fragmentswere
amplified under the following PCR conditions: 94 °C for 2 min and 35
cyclesof94 °Cfor30 s,60 °C for30 sand 72 °C for90 s.ThePCR toobtain
the next fragment (III) was carried out as follows: 94 °C for 2 min and 30
cycles of 94 °C for 30 s, 68 °C for 30 s and 72 °C for 1 min. The fourth
fragment(IV)wasachievedbyusingthefollowingPCRprotocol:94 °Cfor
2 min and 35 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 2 min.
Finally,thelastfragment(V)includingthe5′UTRwasobtainedby5′RACE
PCR as follows: 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 68 °C for 30 s
and 72 °C for 3 min. In addition, nested or seminested reactions were
performedduringthecloningasindicatedinFig.2,toconfirmtheidentity
of sole Per3 sequence.
All amplified products were purified with GeneClean® Turbo Kit
(Qbiogene, Pacisa-Giralt, Alcobendas, Spain), subcloned into TOPO-TA
cloning vector (Invitrogen, Barcelona, Spain) and at least five clones
per fragment were sequenced by using the BigDye® Terminator v3.0
Ready Reaction Cycle Sequencing Kit in the ABI PRISM 3100 Genetic
Analyzer (Applied Biosystems, Carlsbad, CA, USA). Different frag-
ments obtained were overlapped to firmly determine the consensus
nucleotide sequence of the sole Per3 cDNA obtained.
2.3. Sequence analysis
The nucleotide and deduced amino acid sequences were analyzed
with the BLAST software. Multiple alignments for primer design and
phylogenetic analysis were carried out using the ClustalW algorithm.
Conserved domains and motifs were identified by the NCBI Conserved
Domain Database and several tools of the ExPASy Proteomics Server.
The phylogenetic tree was constructed using the neighbour-joining
method with the Phylo_win 2.0 software (Galtier et al., 1996) and
bootstrapanalysis with1000 replicationswas used totestthestrictness
of the tree (Felsenstein, 1985).
2.4. Northern blot
Northern blot analysis was carried out as is described previously by
González-Rovira et al. (2009). Briefly, total RNA was extracted from the
retina,brainandovaryofanimalssacrificedduringdaytimeusingTRIsure
reagent (Bioline). Thirty micrograms of RNA was separated on a 1%
formaldehyde-agarose gel and transferred to a positively charged nylon
membrane (Pall Corporation, FL, USA) using 10x SSC (Sodium Chloride
3 M,tri-Sodium citratedehydrate300 mM,pH7.0).RNAwasfixedtothe
membranebyUV-crosslinking(120 mJ)andblockedfor2–3 hat57 °Cin
Church mix containing sodium phosphate buffer 0.25 M, pH 7.2, EDTA
1.0 mM, 1% BSA and 7% SDS. Sole Per3 and β-actin (Genbank accession
numberDQ485686)fragmentsof1199 bpand515 bp,respectively,were
used as probes in two different membranes. They were amplified by PCR
using primers P3Z1900F and SSPER3R1 for sole Per3 and SSACTINF and
SSACTINR for sole β-actin (Table 1) and purified with GeneClean® Turbo
Kit (Qbiogene). Radioactive labelling was performed by using the Ready-
To-Go DNA Labelling Beads (Amersham, Biosciences, Uppsala, Sweden)
and [α-32P]-dCTP (Hartmann Analytic, Grupo Taper, Madrid, Spain). The
membranes were hybridizedinChurchmix for 14 hat57 °C andwashed
at the same temperature two times in 5x SSC-0.1% SDS for 20 min, two
times in 2x SSC-0.1% SDS for 20 min and once with 1x SSC-0.1% SDS for
15 min.BlotsweredetectedbyexposingthemembranestoCurixRP2film
(Agfa, Barcelona, Spain) at −80 °C for 3 days (Per3 probe) or overnight
(β-actin probe), using an intensifying screen (Amersham).
2.5. Tissue expression analysis by Reverse Transcription (RT)-PCR
Total RNA was extracted from sole neural and peripheral tissues as
described above and 100 ng of DNase I-treated RNA was retro-
transcribed using the iScript cDNA synthesis kit (Bio-Rad, Alcobendas,
Spain). PCR reactions were carried out using a set of specific forward
and reverse primers designed from the cloned Per3 sequence
(Table 1), and the following conditions: 94 °C for 5 min and 30 cycles
of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min. Sole β-actin was
used as internal control gene. Amplified products were resolved in 1%
agarose gel ethidium bromide stained, purified and sequenced to
verify that they corresponded to sole Per3 sequence.
2.6. Real time quantitative PCR expression analysis
Total RNA was extracted from retina, optic tectum, diencephalon
and cerebellum, and retro-transcribed using the Quantitec® Reverse
Transcription Kit (Qiagen, Hilden, Germany), which includes a
previous DNase treatment to remove genomic DNA. Real time gene
expressionanalysis of Per3 was performed in a Chromo4™ Four-Color
Real-Time System (Bio-Rad) using sole β-actin and rps4 (Genbank
accession number AB291557) for normalization. PCR reactions were
developed in a 20 μL volume containing cDNA, iTaqTMSYBR® Green
Supermix with ROX (Bio-Rad) and specific primers (Table 1). PCR
conditions for sole Per3 were: initial denaturation 2 min at 95 °C and
40 cycles of 10 s at 95 °C and 35 s at 57.7 °C. PCR conditions for
reference genes were almost similar but the annealing–extensionstep
was 30 s at 66 °C (β-actin) or 64.2 °C (rps4). Duplicates of each sample
Table 1
Sequences of primers used. Primers starting with P3 are degenerated and primers
starting with SS are specific of Solea senegalensis Per3 sequence.
Primer nameSequence (5′–3′)
Sole Per3 cloning
1 (P3Z900F)
2 (P3Z900F2)
3 (P3Z7F)
4 (P3Z5F)
5 (P3Z5R)
6 (P3Z800R)
7 (P3Z1900F)
8 (SSPER3R1)
9 (P3Z2000F)
10 (SSPER3R2)
11 (P3Z1000F)
12 (SSPER3R3)
13 (SSPER3R4)
14 (SSPER3R5)
15 (SSPER3R6)
16 (SSPER3R7)
17 (SSPER3R8)
18 (SSPER3R9)
19 (SSPER3R10)
20 (SSPER3R13)
21 (SSPER3R11)
22 (SSPER3R12)
AAYCTGCTGCAGGARGAGCTG
TCCAGCTCTCGCTCMAGTTC
CAGCCCMTSCAGCCYTGGTTC
GTSATGWTGAVTACCAGAT
ATCTGGTABGTCAWCATSAC
TGAGGRAGGTAKCCKAGCAA
TACAGCAGCACCATYGTCCA
AGCTCACTTGATGTAGATTGGG
CACACWCAGAAGGAGGAGCA
GAGGTTGTGCCAGTGTTGC
CCAGCTGGTCCAGCTTYRTCAAC
CAGAGACGGGAGCAGCATCAGCC
GACTCAGGTTGCGGCACGTGGAC
CATTGTTGTGAACCGGCT
ACTCGTCCTGACTTTGTGCC
CGACGCTGATGTAATGCTCG
CTCGTCCTGACTTTGTGCCGTCC
TGTGCCGTCCAATGATGAAGG
CGGAGAGACGCCACTGTTTGTT
GGCTTCCATCGGACAAACGCAGC
GCCTTACACTACGCACTCAA
ACAGAGGGCGACAGAAGACAGAA
Northern blot and tissue distribution
P3Z900F
SSPER3R1
SSPER3pcrF2
SSPER3pcrR2
SSACTINF
SSACTINR
AAYCTGCTGCAGGARGAGCTG
AGCTCACTTGATGTAGATTGGG
TGCCCAATCTACATCAAGTG
CTGCTCCTGACTGAACCAAG
GACATGGAGAAGATCTGGCATCA
GGCAGCTCATAGCTCTTCTCC
Real time quantitative PCR
SSPER3qpcrF3
SSPER3qpcrR3
SSACTB2F
SSACTB2R
SSRPS4F
SSRPS4R
GCTCAGGGGCAAGAGTTTC
GTTCATTGGGAGGTGGTTTC
AATCGTGACCTCTGCTTCCCCCTGT
TCTGGCACCCCATGTTACCCCATC
GTGAAGAAGCTCCTTGTCGGCACCA
AGGGGGTCGGGGTAGCGGATG
9
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 4

were analyzed in the same assay. Standard curves were generated for
each gene with 10-fold serial dilutions of cDNA and all calibration
curves exhibited slopes close to −3.32 and efficiencies around 100%.
Melting curves were performed for each sample in order to confirm
that a single product was amplified. Non template control and non
retro-transcribed total RNA sample were used as negative controls.
The ΔΔCt method (Livak and Schmittgen, 2001) was used to
determine the relative mRNA expression.
2.7. Data analysis
Daily statistical differences among groups were determined using a
one way ANOVA followed by a multiple contrast of range test (LSD). If
necessary, values were transformed (logarithmic or square root
transformations) to get normal distribution and homogeneity of
variances. In all cases, statistical significance was accepted at pb0.05.
All statistical tests were made using Statgraphics Plus 5.1 software.
Rhythm analyses were performed by the cosinor method (Nelson et al.,
1979),usingthesoftwaredevelopedbyProf.A.DíezNoguera(University
of Barcelona) and they were considered significant when pb0.05.
3. Results
3.1. Cloning of sole Per3 cDNA
The cloning strategy described above has allowed us to obtain a
4141 bp cDNA sequence (SsPer3, GenBank accession number
FM177703). This sequence consists of a full-length 3804 bp open
reading frame (ORF), flanked by a 247 bp 5′untranslated region (5′
UTR) and a short 90 bp 3′untranslated region (3′UTR). The poly-
adenylation signal (AATGAA) was located 30 nucleotides upstream of
the poly A tail. The putative sole PER3 protein has 1267 amino acids
and an estimated molecular mass of 137.9 kDa. Predicted protein
analysis revealed the existence of highly conserved PER-ARNT-SIM
(PAS) binding domains PAS A (residues 174 to 240) and PAS B
(residues 314 to 380) and a cytoplasmic localization domain (CLD,
residues 389 to 432). In addition, one putative nuclear localization
Fig. 3. Deduced amino acid sequence (1267 aa) and conserved regions of Senegalese sole Per3. Numbers on the left indicate the amino acid positions. The PAS A, PAS B and CLD
domains are shaded and sequence motifs Nuclear Export Signal (NES), Nuclear Localization Signal (NLS) and CKIɛ phosphorylation sites (CKIɛ site) are underlined. Serine/threonine–
glycine repeat region (SG) is boxed.
10
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 5

signal (NLS), one putative nuclear export signal (NES), two putative
casein kinase 1epsilon (CKIɛ) phosphorylation sites and one terminal
serine/threonine–glycine (SG) repeat were also identified (Fig. 3).
Sole PER3 shares 61–77 % identity with PER3 proteins from other
teleost fish and 39–46 % with other PER3 vertebrate sequences. This
result was consistent with the phylogenetic tree that clearly
positioned sole PER3 within the corresponding fish PER3 branch,
showing more divergence with PER3 proteins from other vertebrate
species. Moreover, higher divergence was found with regard to PER1
and PER2 branches (Fig. 4).
3.2. Northern blot analysis
To identify the size of sole Per3 gene transcript, Northern blot
analysis was performed using total RNA from sole retina, brain and
ovary and specific probes. Under high stringency conditions, an
intense signal with an estimated size of 6.4 kb was detected in all
assayed tissues, particularly in retina. A less prominent labelling was
detected in retina and ovary with an estimated size of 3.9 kb (Fig. 5).
Regarding sole β-actin, a single band was also revealed with an
approximated size of 2.6 kb.
3.3. Tissue expression pattern of sole Per3
Per3 expression was detected by RT-PCR in all neural and peripheral
tissues tested in the present study (Fig. 6). In neural tissues, the
expression was remarkable in retina, cerebellum, diencephalon and
optic tectum, and less apparent in telencephalon, olfactory bulbs and
medulla. The pituitary also exhibited a perceptible band. In some
peripheral tissues, Per3 expression was more evident than in neural
tissues. A prominent expression was observed in liver and ovary,
followed by gills, heart, intestine and kidney (Fig. 6).
3.4. Daily variations of Per3 mRNA in central tissues
Real time quantitative PCR was carried out in the retina, optic
tectum, diencephalon and cerebellum during a 24 h light–dark cycle.
These tissues were selected because they exhibited the highest Per3
expression in RT-PCR analysis, they have been implicated in the
Fig. 4. Phylogenetic tree showing the relationship of sole PER3 with other vertebrate
PER proteins. A consensus tree to corresponding 1000 bootstrap replications was
obtained by the neighbour-joining method. The length of the branches is proportional
to the phylogenetic distance. Solea senegalensis PER3 position is shaded in the
corresponding PER3 branch. Cf, Canis familiaris; Cj, Coturnix japonica; Cp, Cynops
pyrrhogaster; Dr, Danio rerio; Ga, Gasterosteus aculeatus; Gg, Gallus gallus; Hs, Homo
sapiens; Mm, Mus musculus; Ol, Oryzias latipes; Ps, Podarcis sicula; Sg, Siganus guttatus;
Ss, Solea senegalensis; Tn, Tetraodon nigroviridis; Tr, Takifugu rubripes; Xl, Xenopus laevis;
and Xt, Xenopus tropicalis. Protein accession numbers and Ensembl protein IDs used for
phylogenetic analysis were: ENSCAFP00000025009, ENSCAFP00000018297,
XP_850317 (Canis familiaris PER1, PER2, PER3); BAB03455, BAB03456 (Coturnix
japonica PER2, PER3); BAC98490 (Cynops pyrrhogaster PER1); NP_001025354,
NP_997604, NP_878277, NP_571659 (Danio rerio PER1a, PER1b, PER2, PER3);
ENSGACP00000025523, ENSGACP00000017830, ENSGACP00000007489 (Gasterosteus
aculeatus PER1b, PER2a, PER2b); NP_989593, XP_417528 (Gallus gallus PER2, PER3);
NP_002607, NP_073728, NP_058515 (Homo sapiens PER1, PER2, PER3); NP_001152839,
NP_035196, NP_035197 (Mus musculus PER1, PER2, PER3); NP_001129992,
ENSORLP00000020793, ENSORLP00000019352, ENSORLP00000019968 (Oryzias latipes
PER1b, PER2a, PER2b, PER3); CAI43981 (Podarcis sicula PER2); ABM97610 (Siganus
guttatus PER2); FM177703 (Solea senegalensis PER3); GSTENP00013830001,
GSTENP00028368001, GSTENP00026769001, GSTENP00013979001 (Tetraodon nigro-
viridis PER1, PER2a, PER2b, PER3); SINFRUP00000170087, SINFRUP00000147284,
SINFRUP00000174412, SINFRUP00000175673 (Takifugu rubripes PER1b, PER2a,
PER2b, PER3); NP_001079172, NP_001081098, (Xenopus laevis PER1, PER2); and
NP_001072696 (Xenopus tropicalis PER3).
Fig. 5. Northern blot analysis of Senegalese sole Per3. Thirty micrograms of total RNA
from adult retina (A), brain (B) and ovary (C) was analyzed using radioactive-labelled
Per3 and β-actin probes. Transcript sizes estimated were 6.4 kb and 3.9 kb for Per3 and
2.6 kb for β-actin. Sole Per3 transcripts are indicated by black arrowheads. RiboLadder
Long RNA molecular weight marker sizes are represented on the right.
11
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 6

processing of visual/light information and they contain melatonin
binding sites and express melatonin receptors in sole (Oliveira et al.,
2008; Confente et al., 2010). Statistical analysis including cosinor and
ANOVA revealed significant daily variations of Per3 in retina and optic
tectum (Table 2, Fig. 7A and B). In contrast, Per3 expression in
diencephalon and cerebellum did not exhibit significant daily rhythm
by cosinor analysis (Table 2) or differences by one-way ANOVA
(Fig. 7C and D). In retina and optic tectum, Per3 expression peaked at
the dark-to-light transition, showing their acrophases at night (ZT
21.1 and 23.2, respectively) and the minimum expression around
sunset (Table 2, Fig. 7A and B).
4. Discussion
In this work, we have reported the cloning of a Per3 cDNA in a
nocturnal flatfish species, the Senegalese sole, which is expressed in
central and peripheral tissues and displays significant daily oscillations
in retina and optic tectum, but not in diencephalon and cerebellum.
PredictedsolePERproteinobtainedhas1267aminoacids.Sequence
identity, structural and phylogenetic analyses confirmed that the PER
protein identified is closely related to PER3 vertebrate proteins, in
particular, to Takifugu rubripes and Tetraodon nigroviridis PER3.
Evolution of clock genes reflects the existence of several gene
Fig. 6. RT-PCR expression of Per3 in neural and peripheral tissues of sole. The RT-PCR conditions were as described in Materials and methods. A 430 bp specific Per3 product was
detected in all tissues tested (upper panel). β-actin expression was used for normalization and products obtained in the assayed tissues (515 bp in size) are shown below.
Abbreviations: MW, molecular weight marker (100-bp Dominion, Córdoba, Spain); OB, olfactory bulbs; TEL, telencephalon; OT, optic tectum; DIE, diencephalon; PIT, pituitary; CE,
cerebellum; ME, medulla; RET, retina; GI, gills; HE, heart; LI, liver; KI, kidney; INT, intestine; and OV, ovary.
Table 2
Cosinor analysis of Per3 gene expression rhythms in central tissues of sole.
Retina Optic tectumDiencephalonCerebellum
Mesor (relative expression)
Amplitude (relative expression)
Acrophase (ZT hours)
p-value
3.28 (Lim 2.62–3.96)
3.30 (Lim 2.33–4.26)
21.10 (Lim 19.5–22.2)
*
0.70 (Lim 0.54–0.86)
0.44 (Lim 0.22–0.66)
23.20 (Lim 20.5–1.5)
*
0.83 (Lim 0.68–0.98)
0.19 (Lim −0.02–0.40)
2.00 (Lim 20.27–7.33)
N.S.
1.30 (Lim 1.16–1.45)
0.20 Lim (0.00–0.41)
12.35 Lim (6.40–18.31)
N.S
Numeric values of mesor, amplitude and acrophase, as well as the significance of the rhythm (p-value) are presented. The fiducial limits of these parameters are also indicated.
*pb0.00001; N.S. Non significant rhythm.
A
C
B
D
Fig. 7. Daily expression of sole Per3 in central tissues: (A) Retina, (B) Optic tectum, (C) Diencephalon, and (D) Cerebellum. Per3 mRNA was measured by real time quantitative PCR.
Each value represents the mean±SEM of six different specimens (n=6). Samples were taken every 4 h and relative expression was normalized using β-actin and rps4 genes. White
bars indicate day-time sampling points (ZT0, ZT4, and ZT8) and black bars represent night-time sampling points (ZT12, ZT16, and ZT20). Different letters indicate statistically
significant differences between mean values (pb0.05).
12
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 7

duplication events since they are present in a single copy in insects and
additional copies are present in vertebrates (Tauber et al., 2004).
Northern blot analysis performed in retina, brain and ovary suggests
that a main Per3 transcript of 6.4 kb exists in sole, as occurred in
zebrafish, fugu, tetraodon and medaka, which is orthologous to
mammalianPer3(Wang, 2008).However, thepresence of anadditional
band of 3.9 kb in retina and ovary could reflect that more than one Per3
transcript is present in this species, at least in some tissues.
Structural analysis showed that sole PER3 contains the main
functional regions shared between transcription factors regulating the
circadian clock. These include two tandemly organized PAS domains
(PASA–PASB)intheN-terminalpartoftheproteinandaCLDdomainC-
terminal to the PAS domains. In the biological timing context, PAS
domains function as dimerization domains required for PER–PER
associations to control their post-translational regulation and subcellu-
lar distribution (Ponting and Aravind 1997; Whitmore et al., 1998a, b).
The cytoplasmic localizationdomain confers cytoplasmic localization to
themonomericformsofPERanditisfunctionalinmammalianPER3but
not in PER1 and PER2 (Yagita et al., 2000, 2002; Vielhaber et al., 2001).
CLD domains also seem to contribute to the proper structure of the PAS
domain and protein folding (Ponting and Aravind, 1997).
Similar to other vertebrate PER proteins, sole PER3 exhibits a
putative nuclear localization signal (NLS), a putative nuclear export
signal (NES), two putative CKIɛ phosphorylation sites and a terminal
serine/threonine–glycine repeat region. A NLS is a short basic amino
acid sequence which is required for the translocation of PER3
heterodimers from the cytoplasm to the nucleus (Kaffman and O'Shea
1999; Yagita et al., 2000, 2002). CKI epsilon/delta phosphorylation
sites are serine/threonine enriched clusters that serve as key
regulators of PER activity and contribute to establish and maintain
circadian rhythms (Lee et al., 2004). Cellular trafficking of clock
proteins is also determined by sequence motifs that allow active
transportof theproteinbackto thecytoplasmastheNES signal,which
is rich in large hydrophobic amino acids, particularly leucine or
isoleucine (Gerace, 1995). The presence of NLS, CKIɛ phosphorylation
sites and NES in sole PER3 suggests that this protein could be shuttling
continuously between the cytoplasm and the nucleus, as has been
proposed for mammalian PER1 and PER2 (Vielhaber et al., 2001;
Yagita et al., 2002).
Clock gene expression is not restricted to central pacemaker
structures and exhibits a wide tissue distribution in all species studied
from insects to mammals, suggesting a high distribution of circadian
oscillators throughout the animal body (Plautz et al., 1997; Yamazaki
et al., 2000; Yoshimura et al., 2000; Kaneko et al., 2006; Vallone et al.,
2007; Velarde et al., 2009). Our tissue expression results determined
by RT-PCR agree with these findings since we have detected Per3
expression in all neural and peripheral tissues examined in sole,
demonstratingthatalsointhisspecies,clockgenesarewidelyexpressed
outside the brain.
Expression analysis during a 24 h period showed that Per3 exhibits
a significant daily oscillation in visually-related neural tissues as the
retina and optic tectum of sole. Per3 is able to anticipate dawn because
the expression of this gene is up-regulated before sunrise, showing its
acrophase at the end of the night (3 h and 1 h before dawn for retina
and optic tectum, respectively). This expression is significantly
decreased to basal levels by the end of the light phase or early
night, with minimum values at ZT8 for the retina and ZT12 for the
optic tectum. These results are consistent to those found in zebrafish,
goldfish or Japanese quail (Delaunay et al., 2000; Pando et al., 2001;
Velarde et al., 2009; Yoshimura et al., 2000) but differ to that reported
in mammals (Zylka et al., 1998; Kamphuis et al., 2005; Peirson et al.,
2006). Although these rhythms are quite similar in timing in both
tissues, there is a significant difference in their amplitudes, being
considerably higher in the photoreceptive retina in relation to the
optic tectum. These differences may be caused by the endogenous
properties of their oscillators, differences in photosensitivity and/or
phototransduction, in the coupling among cells or the presence of
cells with variable periods, phases and amplitudes.
The absence of a significant Per3 rhythmic expression in the
diencephalon of sole is interesting since this area includes the retino-
recipient suprachiasmatic nucleus (SCN) of fish (Springer and
Mednick, 1984; Yáñez et al., 2009). This nucleus represents the
“master” pacemaker in mammals and exhibits high amplitude
rhythms of clock gene expression (Klein et al., 1991). In addition, all
brain regions examined to date in zebrafish have been shown to be
rhythmic (Whitmore et al 1998b). It should be noted that a brain area
with similar pacemaker properties as mammalian SCN has not been
yet found in fish brain and, in fact, it is not clear if the retino-recipient
SCN reported in fish represents the real homologue of mammalian
SCN. In mammals, different SCN regions appear functionally distinct
with only some regions exhibiting rhythmic clock gene expression
(Hamada et al., 2001; Silver and Schwartz, 2005). Therefore, it is also
possible that a pacemaker structure exists in the sole hypothalamus,
but it remains masked when this region is processed as a whole.
Moreover, the absence of rhythmic Per3 expression in the dienceph-
alon of sole does not mean that this area lacks pacemaker activity
because other Period and/or clock genes exhibiting daily differences in
their transcript levels could sustain its rhythmicity.
In our RT-PCR study, we have detected a high Per3 expression in
the cerebellum of sole but this brain area lacks a significant daily
rhythm in Per3 mRNA levels. It has been considered that the
teleostean cerebellum serves visual, motor learning and coordination
functions (Finger, 1983; Wullimann, 1998). Moreover, the cerebellum
expresses melatonin receptors in sole (Confente et al., 2010) and
exhibits significant day/night differences in the density of melatonin
binding sites (Oliveira et al., 2008). Nevertheless, the possible role of
the cerebellum in the circadian organization has been poorly studied,
and although the hindbrain appears to be rhythmic in zebrafish
(Whitmore et al., 1998b), there are no more available data in fish to
compare our results. It is interesting to note that Per1 and Per2
rhythmic daily expression has been detected in the cerebellum of
mammals (Sun et al., 1997; Akiyama et al., 1999; Farnell et al., 2008;
Mendoza et al., 2010). Therefore, we cannot rule out the existence of
daily rhythms in the expression of other genes from the Period family
in this central area.
In fish, circadian clock gene expression has been analyzed only in
diurnal (Whitmore et al., 1998a, 2000b; Mazurais et al., 2000; Tamai
et al., 2005; Park et al. 2007; Sugama et al., 2008; Velarde et al., 2009;
Takemura et al., 2010) and diurnal/nocturnal switching (Davie et al.,
2009; Sánchez et al., 2010) species. In this way, our study in sole
represents the first approach to analyze the clockwork machinery in a
nocturnal fish. The molecular timing of Per3 from sole looks
remarkably similar to those from zebrafish (Delaunay et al. 2000)
and goldfish (Velarde et al., 2009), two diurnal species. Hence, the
expression pattern for at least one core clock component does not
appear to be altered in diurnal versus nocturnal fish species. This
situation resembles what happens in mammals, where the temporal
profile of clock gene expression in both chronotypes is similar
(Challet, 2007). Taken together, these data reinforce that the most
basic difference between diurnal and nocturnal animals arises from
mechanisms operating downstream of neural oscillators.
In conclusion, we have cloned a full-length coding region of sole
Per3 and demonstrated that Per3 mRNA exhibits a wide distribution in
central and peripheral tissues, as well as significant daily variations in
visually-related structures as the retina and the optic tectum. In
addition, the absence of a significant Per3 rhythmic expression in the
diencephalon and the cerebellum of sole could reflect that other brain
structures and/or clock genes might sustain the circadian machinery
in this species. Our results are also consistent with the conservation of
transcriptional mechanisms in the circadian clock of diurnal and
nocturnal fish species, at least for Per3. Ongoing studies are focused on
the isolation of other core clock components and the analysis of their
13
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 8

spatiotemporal expression patterns. This information, together with
behavioral studies could contribute to a better understanding of the
molecular clockwork machinery sustaining circadian rhythms in this
nocturnal species and might provide useful information of practical
interest for sole aquaculture.
Acknowledgments
This work was supported by grants from the Spanish MICINN
(AGL2007-66507-C02-01) and Junta de Andalucía (P06-AGR-01939) to
José A. Muñoz-Cueto, and a predoctoral fellow of the Spanish MICINN
(BES-2005-8629) to Águeda J. Martín-Robles. We thank Francesca
Confente for her help in sampling. We also thank all staff from the
“PlantadeCultivosMarinos”(UniversityofCádiz)forthemaintainingof
animals used in these studies. Sequencing analyses were performed in
Servicio Central de Ciencia y Tecnología (University of Cádiz).
References
Akiyama, M., Kirihara, T., Takahashi, S., Minami, Y., Yoshinobu, Y., Moriya, T., Shibata, S.,
1999. Modulation of mPer1 gene expression by anxiolytic drugs in mouse
cerebellum. Br. J. Pharmacol. 128, 1616–1622.
Anguis, V., Cañavate, J.P., 2005. Spawning of captive Senegal sole (Solea senegalensis)
under a naturally fluctuating temperature regime. Aquaculture 243, 133–145.
Balsalobre, A., 2002. Clock genes in mammalian peripheral tissues. Cell Tissue Res. 309,
193–199.
Bayarri, M.J., Muñoz-Cueto, J.A., López-Olmeda, J.F., Vera, L.M., Rol de Lama, M.A.,
Madrid, J.A., Sánchez-Vázquez, F.J., 2004. Daily locomotor activity and melatonin
rhythms in Senegal sole (Solea senegalensis). Physiol. Behav. 81, 577–583.
Bell-Pedersen, D., Cassone, V.M., Earnest, D.J., Golden, S.S., Hardin, P.E., Thomas, T.L.,
Zoran, M.J., 2005. Circadian rhythms from multiple oscillators: lessons from diverse
organisms. Nat. Rev. Genet. 6, 544–556.
Boluda-Navarro, D., Rubio, V.C., Luz, R.K., Madrid, J.A., Sánchez-Vázquez, F.J., 2009. Daily
feeding rhythms of Senegalese sole under laboratory and farming conditions using
self-feeding systems. Aquaculture 291, 130–135.
Cahill, G.M., 2002. Clock mechanisms in zebrafish. Cell Tissue Res. 309, 27–34.
Challet, E., 2007. Entrainment of the suprachiasmatic clockwork in diurnal and
nocturnal mammals. Endocrinology 148, 5648–5655.
Confente, F., Rendón, M.C., Besseau, L., Falcón, J., Muñoz-Cueto, J.A., 2010. Melatonin
receptors in a pleuronectiform species, Solea senegalensis: cloning, tissue
expression, day-night and seasonal variations. Gen. Comp. Endocrinol. 167,
202–214.
Davie, D., Minghetti, M., Migaud, H., 2009. Seasonal variations in clock-gene expression
in Atlantic salmon (Salmo salar). Chronobiol. Int. 26, 379–395.
Delaunay, F.,Thisse, C., Marchand,O., Laudet, V., Thisse, B.,2000. Aninherited functional
circadian clock in zebrafish embryos. Science 289, 297–300.
Dinis, M.T., Ribeiro, L., Soares, F., Sarasquete, C., 1999. A review on the cultivation
potential of Solea senegalensis in Spain and in Portugal. Aquaculture 176, 27–38.
EEC, 1986. Council Directive 86/609 EEC for the protection of animals used for
experimental and other scientific purposes. Off. J. L358, 1–28 18/12/1986.
Farnell, Y.Z., Allen, G.C., Nahm, S.S., Neuendorff, N., West, J.R., Chen, W.J., Earnest, D.J.,
2008. Neonatal alcohol exposure differentially alters clock gene oscillations within
the suprachiasmatic nucleus, cerebellum, and liver of adult rats. Alcohol. Clin. Exp.
Res. 32, 544–552.
Felsenstein, J., 1985. Confidence limits on phylogenensis: an approach suing the
bootstrap. Evolution 39, 783–791.
Finger, T.E., 1983. Organization of the teleost cerebellum. In: Davis, R.E., Northcutt, R.G.
(Eds.), Fish neurobiology. : Higher Brain Areas and Functions, 2. University of
Michigan Press, Ann Arbor, pp. 261–284.
Galtier, N., Gouy, M., Gautier, C., 1996. SEAVIEW and PHYLO_WIN: two graphic tools for
sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12, 543–548.
García-López, A., Couto, E., Canario, A.V., Sarasquete, C., Martínez-Rodríguez, G., 2007.
Ovarian development and plasma sex steroid levels in cultured female Senegalese
sole Solea senegalensis. Comp. Biochem. Physiol. A 146, 342–354.
Gerace, L., 1995. Nuclear export signals and the fast track to the cytoplasm. Cell 82,
341–344.
González-Rovira, A., Mourente, G., Zheng, X., Tocher, D.R., Pendón, C., 2009. Molecular
and functional characterization and expression analysis of a Δ6 fatty acyl
desaturase cDNA of European Sea Bass (Dicentrarchus labrax). Aquaculture 298,
90–100.
Green, C.B., Besharse, J.C., 2004. Retinal circadian clocks and control of retinal
physiology. J. Biol. Rhythms 19, 91–102.
Guzmán, J.M., Norberg, B., Ramos, J., Mylonas, C.C., Mañanós, E.L., 2008. Vitellogenin,
steroid plasma levels and spawning performance of cultured female Senegalese
sole (Solea senegalensis). Gen. Comp. Endocrinol. 156, 285–297.
Hamada, T., LeSauter, J., Venuti, J.M., Silver, R., 2001. Expression of Period Genes:
rhythmic and nonrhythmic compartments of the suprachiasmatic nucleus
pacemaker. J. Neurosci. 21, 7742–7750.
Hastings, M.H., 2000. Circadian clockwork: two loops are better than one. Nat. Rev.
Neurosci. 1, 143–146.
Isorna, E., El M'Rabet, A., Confente, F., Falcón, J., Muñoz-Cueto, J.A., 2009. Cloning and
expression of arylalkylamine N-acetyltranferase-2 during early development and
metamorphosis in the sole Solea Senegalensis. Gen. Comp. Endocrinol. 161, 97–102.
Kaffman, A., O'Shea, E.K., 1999. Regulation of nuclear localization: a key to a door. Annu.
Rev. Cell Dev. Biol. 15, 291–339.
Kamphuis, W., Cailotto, C., Dijk, F., Bergen, A., Buijs, R.M., 2005. Circadian expression of
clock genes and clock controlled genes in the rat retina. Biochem. Biophys. Res.
Commun. 330, 18–26.
Kaneko, M., Cahill, G.M., 2005. Light-dependent development of circadian gene
expression in transgenic zebrafish. PLoS Biol. 3, e34.
Kaneko, M., Hernandez-Borsetti, N., Cahill, G.M., 2006. Diversity of zebrafish
peripheral oscillators revealed by luciferase reporting. Proc. Natl Acad. Sci. USA
103, 14614–14619.
Klein, D.C., Moore, R.Y., Reppert, S.M., 1991. Suprachiasmatic Nucleus: The Mind's Clock.
Oxford University Press, New York.
Lee, C., Weaver, D.R., Reppert, S.M., 2004. Direct association between mouse
PERIOD and CKIε is critical for a functioning circadian clock. Mol. Cell. Biol. 24,
584–594.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(−DDC(T)) Method. Methods 25, 402–408.
Mazurais, D., Le Dréan, G., Brierley, I., Anglade, I., Bromage, N., Williams, L.M., Kah, O.,
2000. Expression of clock gene in the brain of rainbow trout: comparison with the
distribution of melatonin receptors. J. Comp. Neurol. 422, 612–620.
Mendoza, J., Pévet, P., Felder-Schmittbuhl, M.P., Bailly, Y., Challet, E., 2010. The
cerebellum harbors a circadian oscillator involved in food anticipation. J. Neurosci.
30, 1894–1904.
Nelson, W., Tong, Y.L., Lee, J.K., Halberg, F., 1979. Methods for cosinor-rhythmometry.
Chronobiologia 6, 305–323.
Okamura, H., 2004. Clock genes in cell clocks: roles, actions, and mysteries. J. Biol.
Rhythms 19, 388–399.
Oliveira, C., López-Olmeda, J.F., Delgado, M.J., Alonso-Gómez, A.L., Sánchez-Vázquez, F.J.,
2008. Melatonin binding sites in Senegal sole: day/night changes in density and
location in different regions of the brain. Chronobiol. Int. 25, 645–652.
Oliveira, C., Dinis, M.T., Soares, F., Cabrita, E., Pousao-Ferreira, P., Sánchez-Vázquez, F.J.,
2009. Lunar and daily spawning rhythms of Senegal sole Solea senegalensis. J. Fish
Biol. 75, 61–74.
Pando, M.P., Pinchak, A.B., Cermakian, N., Sassone-Corsi, P., 2001. A cell-based system
that recapitulates the dynamic light-dependent regulation of the vertebrate clock.
Proc. Natl Acad. Sci. USA 98, 10178–10183.
Park, J.G., Park, Y.J., Sugama, N., Kim, S.J., Takemura, A., 2007. Molecular cloning and
daily variations of the Period gene in a reef fish Siganus guttatus. J. Comp. Physiol. A
193, 403–411.
Peirson, S.N., Butler, J.N., Duffield, G.E., Takher, S., Sharma, P., Foster, R.G., 2006.
Comparison of clock gene expression in SCN, retina, heart, and liver of mice.
Biochem. Biophys. Res. Commun. 351, 800–807.
Plautz, J.D., Kaneko, M., Hall, J.C., Kay, S.A., 1997. Independent photoreceptive circadian
clocks throughout Drosophila. Science 278, 1632–1635.
Ponting, C.P., Aravind, L., 1997. PAS: a multifunctional domain family comes to light.
Curr. Biol. 7, 674–677.
Reppert, S.M., Weaver, D.R., 2001. Molecular analysis of mammalian circadian rhythms.
Annu. Rev. Physiol. 63, 647–676.
Rodríguez-Gómez, F.J., Sarasquete, M.C., Muñoz-Cueto, J.A., 2000. A morphological
study of the brain of Solea senegalensis. I. The telencephalon. Histol. Histopathol. 15,
355–364.
Sánchez, J.A., Madrid, J.M., Sánchez-Vázquez, F.J., 2010. Molecular cloning, tissue
distribution and daily rhythms of expression of per1 gene in European sea bass
(Dicentrarchus labrax). Chronobiol. Int. 27, 19–33.
Shearman, L.P., Sriram, S., Weaver, D.R., Maywood, E.S., Chaves, I., Zheng, B., Kume, K.,
Lee, C.C., van der Horst, G.T., Hastings, M.H., Reppert, S.M., 2000. Interacting
molecular loops in the mammalian circadian clock. Science 288, 1013–1019.
Silver, R., Schwartz, W.J., 2005. The suprachiasmatic nucleus is a functionally
heterogeneous timekeeping organ. Methods Enzymol. 393, 451–465.
Springer, A.D., Mednick, A.S., 1984. Selective innervation of the goldfish suprachiasmatic
nucleus by ventral retinal ganglion cell axons. Brain Res. 323, 293–296.
Sugama, N., Park, J.G., Park, Y.J., Takeuchi, Y., Kim, S.J., Takemura, A., 2008. Moonlight
affects nocturnal Period2 transcript levels in the pineal gland of the reef fish Siganus
guttatus. J. Pineal Res. 45, 133–141.
Sun, S., Alsbrecht, U., Zhuchenko, O., Bailey, J., Eichele, G., Lee, C., 1997. RIGUI, a putative
mammalian ortholog of the Drosophila period gene. Cell 90, 1003–1011.
Takemura, A., Rahman, M.S., Park, Y.J., 2010. External and internal controls of lunar-
related reproductive rhythms in fishes. J. Fish Biol. 76, 7–26.
Tamai, T.K., Carr, A.J., Whitmore, D., 2005. Zebrafish circadian clocks: cells that see the
light. Biochem. Soc. Trans. 33, 962–966.
Tauber, E., Last, K.S., Olive, P.J., Kyriacou, C.P., 2004. Clock gene evolution and functional
divergence. J. Biol. Rhythms 19, 445–458.
Vallone, D., Frigato, E., Vernesi, C., Foa, A., Foulkes, N.S., Bertolucci, C., 2007.
Hypothermia modulates circadian clock gene expression in lizard peripheral
tissues. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R160–R166.
Velarde, E., Haque, R., Iuvone, P.M.,Azpeleta, C., Alonso-Gómez, A.L., Delgado, M.J., 2009.
Circadian clock genes of goldfish, Carassius auratus: cDNA cloning and rhythmic
expression of Period and Cryptochrome transcripts in retina, liver, and gut. J. Biol.
Rhythms 24, 104–113.
Vera, L.M., De Oliveira, C., López-Olmeda, J.F., Ramos, J., Mañanós, E., Madrid, J.A.,
Sánchez-Vázquez, F.J., 2007. Seasonal and daily plasma melatonin rhythms and
reproduction in Senegal sole kept under natural photoperiod and natural or
controlled water temperature. J. Pineal Res. 43, 50–55.
14
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15

Page 9

Vielhaber, E.L., Duricka, D., Ullman, K.S., Virshup, D.M., 2001. Nuclear export of
mammalian PERIOD proteins. J. Biol. Chem. 276, 45921–45927.
Wang, H., 2008. Comparative analysis of Period genes in teleost fish genomes. J. Mol.
Evol. 67, 29–40.
Whitmore, D., Sassone-Corsi, P., Foulkes, N.S., 1998a. PASting together the mammalian
clock. Curr. Opin. Neurobiol. 8, 635–641.
Whitmore, D., Foulkes, N.S., Strahle, U., Sassone-Corsi, P., 1998b. Zebrafish clock
rhythmic expression reveals independent peripheral circadian oscillators. Nat.
Neurosci. 1, 701–707.
Whitmore, D., Foulkes, N.S., Sassone-Corsi, P., 2000a. Light acts directly on organs and
cells in culture to set the vertebrate circadian clock. Nature 404, 87–91.
Whitmore, D., Cermakian, N., Crosio, C., Foulkes, N.S., Pando, M.P., Travnickova, Z.,
Sassone-Corsi, P., 2000b. A clockwork organ. Biol. Chem. 381, 793–800.
Wullimann, M.F., 1998. The central nervous system. In: Evans, D.H. (Ed.), The
Physiology of Fishes. CRC Press, Boca Raton, pp. 245–282.
Yagita, K., Yamaguchi, S., Tamanini, F., van der Horst, G.T.J., Hoeijmakers, J.H.J., Yasui, A.,
Loros, J.J., Dunlap, J.C., Okamura, H., 2000. Dimerization and nuclear entry of mPER
proteins in mammalian cells. Genes Dev. 14, 1353–1363.
Yagita, K., Tamanini, F., Yasuda, M., Hoeijmakers, J.H.J., van der Horst, G.T.J., Okamura, H.,
2002. Nucleocytoplasmic shuttling and mCRY-dependent inhibition of ubiquitylation
of the mPER2 clock protein. EMBO J. 21, 1301–1314.
Yamazaki, S., Numano, R., Abe, M., Hida, A., Takahashi, R., Ueda, M., Block, G.D., Sakaki,
Y., Menaker, M., Tei, H., 2000. Resetting central and peripheral circadian oscillators
in transgenic rats. Science 288, 682–685.
Yáñez, J., Busch, J., Anadón, R., Meissl, H., 2009. Pineal projections in the zebrafish
(Danio rerio): overlap with retinal and cerebellar projections. Neuroscience 164,
1712–1720.
Yoshimura, T., Suzuki, Y., Makino, E., Suzuki, T., Kuroiwa, A., Matsuda, Y., Namikawa, T.,
Ebihara, S., 2000. Molecular analysis of avian circadian clock genes. Brain Res. Mol.
Brain Res. 78, 207–215.
Zylka, M.J., Shearman, L.P., Weaver, D.R., Reppert, S.M., 1998. Three period homologs in
mammals: differential light responses in the suprachiasmatic circadian clock and
oscillating transcripts outside of brain. Neuron 20, 1103–1110.
15
Á.J. Martín-Robles et al. / Comparative Biochemistry and Physiology, Part A 159 (2011) 7–15