The first case of X-linked Alpha-thalassemia/mental retardation (ATR-X) syndrome in Korea.

Abstract

Mutation of the ATRX gene leads to X-linked alpha-thalassemia/mental retardation (ATR-X) syndrome and several other X-linked mental retardation syndromes. We report the first case of ATR-X syndrome documented here in Korea. A 32-month-old boy came in with irritability and fever. He showed dysmorphic features, mental retardation and epilepsy, so ATR-X syndrome was considered. Hemoglobin H inclusions in red blood cells supported the diagnosis and genetic studies confirmed it. Mutation analysis for our patient showed a point mutation of thymine to cytosine on the 9th exon in the ATRX gene, indicating that Trp(C), the 220th amino acid, was replaced by Ser(R). Furthermore, we investigated the same mutation in family members, and his mother and two sisters were found to be carriers.

Full text

Page 1

© 2011 The Korean Academy of Medical Sciences.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0)
which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
pISSN 1011-8934
eISSN 1598-6357
The First Case of X-linked Alpha-thalassemia/Mental Retardation
(ATR-X) Syndrome in Korea
Mutation of the ATRX gene leads to X-linked alpha-thalassemia/mental retardation (ATR-X)
syndrome and several other X-linked mental retardation syndromes. We report the first
case of ATR-X syndrome documented here in Korea. A 32-month-old boy came in with
irritability and fever. He showed dysmorphic features, mental retardation and epilepsy, so
ATR-X syndrome was considered. Hemoglobin H inclusions in red blood cells supported the
diagnosis and genetic studies confirmed it. Mutation analysis for our patient showed a
point mutation of thymine to cytosine on the 9th exon in the ATRX gene, indicating that
Trp(C), the 220th amino acid, was replaced by Ser(R). Furthermore, we investigated the
same mutation in family members, and his mother and two sisters were found to be
carriers.
Key Words: Alpha-Thalassemia; Mental Retardation, X-Linked; ATRX; Hemoglobin H
Ki Wook Yun1, Soo Ahn Chae1,
Jung Ju Lee1, Sin Weon Yun1,
Byoung Hoon Yoo1, In Seok Lim1,
Eung Sang Choi1, and Mi-Kyung Lee2
Departments of 1Pediatrics, and 2Laboratory
Medicine, Chung-Ang University College of
Medicine, Seoul, Korea
Received: 9 January 2010
Accepted: 30 April 2010
Address for Correspondence:
Soo Ahn Chae, MD
Department of Pediatrics, Chung-Ang University Medical Center,
29 Heukseok-ro, Dongjak-gu, Seoul 156-070, Korea
Tel: +82.2-6299-1479, Fax: +82.2-814-4920
E-mail: kidbrain@korea.com
DOI: 10.3346/jkms.2011.26.1.146 • J Korean Med Sci 2011; 26: 146-149
CASE REPORT
Pediatrics
INTRODUCTION
The rare association between α-thalassemia and mental retar-
dation was first recognized in 1981 by Weatherall and colleagues
(1). Then, in 1995, in a case of α-thalassemia/mental retardation
(ATR-X) syndrome, mutations in the ATRX gene locus Xq13.3
were first reported (2). Since then, studies have identified 127
mutations in this gene in patients with ATR-X syndrome (3-7).
While the cellular function of ATRX has not yet been fully eluci-
dated, the characteristics of the syndrome suggest that ATRX
probably functions as part of a chromatin remodeling complex
to regulate the transcription of a discrete set of target genes, of
which α-globin genes involved in brain development are the
best characterized example (8-10).
Although there have been many studies and case reports of
this syndrome and the ATRX gene all over the world, no case
has been reported in Korea until now. We encountered the first
Korean case of ATR-X syndrome and reported it.
CASE DESCRIPTION
A 32-month-old boy was admitted to our hospital with two days
of irritability and fever. He was born with a birth weight of 2.9 kg
by normal spontaneous vaginal delivery at 40 weeks gestation
to a healthy 28-yr-old G3P2 mother. His delivery was non-event-
ful, but there was flexion deformity of both his middle fingers,
so he was transferred to our hospital and underwent many di-
agnostic tests and physical therapies in January, 2002. He showed
mild general hypotonia in that his cry was weak, and he sucked
poorly during early infancy. He had epileptic seizures 6 times
since the age of 15 months despite taking anti-epileptic medica-
tions. A diagnosis of mental retardation complicated by epilep-
sy was made, and his development was noted to be markedly
delayed. He raised his head at age 7 months, sat up at 26 months,
and had not yet acquired the ability to stand. He had a flat and
mid-hypoplastic face with prognathism, narrow and upward
slanting palpebral fissures with hypertelorism, low-set ears, a
small crashed nose, widely spaced incisors, carp-like mouth,
and round back (Fig. 1). He demonstrated repeated stereotyped
behavior like hitting his chin with his palm; this behavior was
often associated with emotional outbursts.
Soon after admission, a generalized tonic-clonic type seizure
was started and lasted approximately one hour; at that time his
vital signs were as follows: blood pressure 100/60 mmHg, pulse
rate 138 bpm, respiration rate 32 bpm, and body temperature
38.5°C. Mild throat injection was seen, but other systemic exam-
inations were normal. On neurologic exam, mental status was
alert, all cranial nerve exams were normal, and muscle tone in
both extremities were decreased to grade IV/IV bilaterally but
all deep tendon reflexes were physiologic. There was no spas-
ticity or pathologic reflex. Sensory functions were normal and
meningeal irritation signs were absent.
Initial laboratory investigations revealed: hemoglobin 12.7 g/
dL, platelet count 374,000/µL and white blood cell count 11,780/

Page 2

Yun KW, et al. • ATR-X Syndrome in Korea
http://jkms.org 147
DOI: 10.3346/jkms.2011.26.1.146
µL. The C-reactive protein was slightly elevated at 19.0 mg/dL
on the day of admission and returned to normal 3 days later.
Urinalysis was normal. All microbiologic studies were negative.
A sleep electroencephalogram revealed intermittent high-am-
plitude slow wave discharges from the temporo-occipital area,
representing mild cerebral dysfunction. On radiologic evalua-
tion, spine radiography revealed mild scoliosis. An echocardio-
gram was normal.
The characteristic facial features and mental retardation of
the patient led us to consider ATR-X syndrome; thus, peripheral
RBCs were screened for hemoglobin H (HbH) inclusion bodies.
HbH inclusions were detected under the microscope in 1.1% of
brilliant cresyl blue stained RBCs, consistent with the diagnosis
of ATR-X syndrome (Fig. 2). The patient’s father, mother and two
sisters were all given the same test; only his mother and eldest
sister had the same findings. We performed gene analysis to con-
firm the diagnosis of ATR-X syndrome. Genomic DNA from the
peripheral blood of our patient and his 4 family members was
extracted with the Wizard® Genomic DNA Purification Kit (Pro-
mega, Madison, WI, USA) and used as a template for amplifica-
tion of the ATRX gene. Polymerase chain reaction (PCR) was
separated into three parts and carried out with sequence-spe-
cific oligonucleotide primers containing 20 known major muta-
tion sites (Table 1, Figs. 3, 4). PCR amplification using each prim-
er was conducted with premixture kit (PreMixTM-Top, Bioneer
Inc., Seoul, Korea). Cycling conditions were one cycle at 95°C
for 5 min, followed by 35 cycles of 95°C for 30 sec, at an anneal-
ing temperature adjusted to each primer’s (Tm) for 30 sec, 72°C
for 30 sec, followed by one cycle at 72°C for 7 min. For direct se-
quencing, the PCR products were purified using a PCR clean-
up system offered by Promega. DNA sequencing was performed
using the purified PCR products as template, the same primers
A
B
C
Fig. 3. Sequences of ATRX gene amplified by primer pair for mutation analysis. Under­
lined sequences in each box present exon regions of ATRX gene. Blue, pink and yellow
color boxes present sequences of primer pairs. Putative mutation site is indicated as
red boxes. (A) amplified sequences by ATRX A primer pairs, (B) amplified sequences
by ATRX B primer pairs, (C) amplified sequences by ATRX C.
AB
Fig. 1. Facials features of the patient. Our patient expressed the typical facial pheno­
type comprising epicanthus, midface hypoplasia, flat nasal bridge, small triangular
nose with anteverted nostrils, carp­shaped mouth with full lips, and dental diastema
at age 6 months (A) and 3 yr (B).
B
CA
Fig. 2. Photomicrograph of the peripheral blood of our case with ATR­X syndrome. It
shows cells containing HbH inclusions in our patient (A), and also his mother (B) and
eldest sister (C).
Table 1. Characterization and PCR conditions of primers for mutation analysis of ATRX gene
Primers Location*Sequences Size (bp)PCR conditions Tm
Number of
cycles
35 ATRX A108112/108221 5´ AATAATAGCCACTCCTTTCTCC 3´
5´ TTTGTACGTCTATTTTCCCCACTA 3´
5´ ATTAAATTTCCCCTTCCTCTT 3´
5´ AAAGATTATTCCCAACAAAACTC 3´
5´ TCAGGTGGTGTGCGGAAGGT 3´
5´ CAACAAAGGCTCTGGGTGACA 3´
283bioneer premix. 49
ATRX B 112384/112606 372bioneer premix.48 35
ATRX C112034/112101 164bioneer premix.5835
*Accession no. Z84487.

Page 3

Yun KW, et al. • ATR-X Syndrome in Korea
148 http://jkms.org
DOI: 10.3346/jkms.2011.26.1.146
as those used for template generation, the BigDye terminator
cycle sequencing ready reaction kit (Applied Biosystems, Foster
City, CA, USA), and automatic sequencer ABI Prism 3730 XL
DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Se-
quence data were assembled and compared to that of a previ-
ously reported ATRX sequence from accession number Z84487
using the DNAstar software (DNASTAR Inc., Madison, WI, USA).
Mutation analysis for our patient showed a point mutation
on the 9th exon in the ATRX gene of thymine to cytosine so that
Trp(C), the 220th amino acid, was replaced by Ser(R) (Fig. 5).
This missense mutation was reported by Gibbons in 1997 (8).
We investigated the same mutation in his 4 family members,
ATRX A
ATRX B
ATRX C
Fig. 4. PCR amplification by ATRX primers. M, size marker; 1, patients’s father; 2,
patients’s mother; 3, ATRX patient, 4, patients’s sister 1; 5, patients’s sister 2.
ACB
E
Fig. 5. Sequence of mutation region detected by ATRX B reverse primer. Sequencing conducted under BigDyeTM terminator cycling conditions. The reacted products purified
using ethanol precipitation and run using Automatic sequencer 3730xl. (A) ATRX patient’s father, (B) ATRX patient’s mother, (C) ATRX patient, (D) ATRX patient’s sister 1, (E)
ATRX patient’s sister 2.
and his mother and two sisters were found to be carriers.
DISCUSSION
The X-Linked α-thalassemia mental retardation syndrome is a
serious recessive disorder resulting from mutations in the ATRX
gene, mapping in Xq13.3 and coding for a protein containing
the signature motif of the SNF2 family of ATPases. Members of
this protein family are thought to act generally as part of large
multi-protein complexes and impart on those complexes the
ability to utilize the energy of ATP hydrolysis to remodel the
structure of chromatin and thereby regulate protein/DNA in-
teractions (11).
This disease is very rare, probably with an incidence of less
than 1/100,000 live-born males (11). So far, 173 patients have
been reported. Affected males present with severe mental retar-
dation, a typical facial appearance, microcephaly, urogenital
anomalies, and an atypical form of α-thalassemia. Pregnancy is
usually uneventful, proceeds to term, and, in 90% of cases, birth
weight is normal. Affected neonates usually have marked hypo-
tonia and associated feeding difficulties. In early childhood, all
milestones are delayed. As the affected individuals grow older,
there is often a tendency toward spasticity. Seizures occur in
approximately one third of cases. A number of patients have re-
portedly had jerking movements that are not associated with
epileptiform activity on EEG. Brain imaging studies frequently
show no abnormality, although mild cerebral atrophy or agen-
esis of the corpus callosum may be seen. The distinctive facial
traits are most readily recognized in early childhood: the frontal
hair is often upswept; there is telecanthus, epicanthic folds, mid-
face hypoplasia, and a small, triangular, upturned nose. The up-
per lip is tented and the lower lip is full and everted, giving the
mouth a “carp-like” appearance. The frontal incisors are fre-
quently widely spaced, and the tongue protrudes. Genital ab-
D

Page 4

Yun KW, et al. • ATR-X Syndrome in Korea
http://jkms.org 149
DOI: 10.3346/jkms.2011.26.1.146
normalities are seen in 80% of these children. A wide range of
relatively mild skeletal abnormalities have been noted. Recur-
rent vomiting or regurgitation, sometimes treated by fundopli-
cation, is a common finding. The tendency to aspiration is com-
monly implicated as a cause of death in early childhood. Con-
stipation is common and in some individuals is a major prob-
lem to manage. A wide range of cardiac and renal abnormali-
ties also has been noted. There is considerable variation in the
hematologic manifestations associated with ATRX mutations
(11). A number of families have been identified in which some
or all of the affected members have no signs of α-thalassemia;
despite lack of these signs, however, diagnosis of α-thalassemia
requires only a simple investigation.
Female carriers of ATRX mutations do not have a distinctive
phenotype. They are intellectually normal and have no consis-
tent physical manifestations, because they show preferential
inactivation of the mutated X-chromosome. Rare cells with HbH
inclusions may be found in approximately one fourth of obli-
gate carriers (12). In our case, there were HbH inclusions in 2 of
3 carriers. But recently, there have been some cases of females
with ATRX mutations with phenotypical abnormalities. Wada
et al. (13) reported a carrier mother who showed non-skewed
X-inactivation with moderate mental retardation. Furthermore,
Badens et al. (14) described a 4-yr-old girl with typical features
of ATR-X syndrome, carrying the recurrent R246C mutation of
ATRX. They showed that her pattern of X-inactivation was total-
ly skewed and that her active X chromosome, which harbors the
ATRX mutation, was maternally inherited. That was the first re-
port of ATR-X syndrome in a female patient. Fortunately, none
of our female carriers had phenotypical abnormalities.
We report the first Korean case of ATR-X syndrome in a 32-
month-old boy. Now, we can consider ATR-X syndrome in a
young male child with characteristic facial features and neuro-
logic abnormalities of unknown etiology, and get simple screen-
ing test for HbH inclusions so that adequate and early manage-
ment should be started.
REFERENCES
1. Weatherall DJ, Higgs DR, Bunch C, Old JM, Hunt DM, Pressley L, Clegg
JB, Bethlenfalvay NC, Sjolin S, Koler RD, Magenis E, Francis JL, Beb-
bington D. Hemoglobin H disease and mental retardation: a new syn-
drome or a remarkable coincidence? N Engl J Med 1981; 305: 607-12.
2. Gibbons RJ, Brueton L, Buckle VJ, Burn J, Clayton-Smith J, Davison BC,
Gardner RJ, Homfray T, Kearney L, Kingston HM. Clinical and hemato-
logical aspects of the X-linked alpha-thalassemia/mental retardation
syndrome (ATR-X). Am J Med Genet 1995; 55: 288-99.
3. Gibbons RJ, McDowell TL, Raman S, O’Rourke DM, Garrick D, Ayyub H,
Higgs DR. Mutations in ATRX, encoding a SWI/SNF-like protein, cause
diverse changes in the pattern of DNA methylation. Nat Genet 2000; 24:
368-71.
4. Badens C, Lacoste C, Philip N, Martini N, Courrier S, Giuliano F, Ver-
loes A, Munnich A, Leheup B, Burglen L, Odent S, Van Esch H, Levy N.
Mutations in PHD-like domain of the ATRX gene correlate with severe
psychomotor impairment and severe urogenital abnormalities in patients
with ATRX syndrome. Clin Genet 2006; 70: 57-62.
5. Wada T, Sakakibara M, Fukushima Y, Saitoh S. A novel splicing muta-
tion of the ATRX gene in ATR-X syndrome. Brain Dev 2006; 28: 322-5.
6. Thienpont B, de Ravel T, Van Esch H, Van Schoubroeck D, Moerman P,
Vermeesch JR, Fryns JP, Froyen G, Lacoste C, Badens C, Devriendt K.
Partial duplications of the ATRX gene cause the ATR-X syndrome. Eur J
Hum Genet 2007; 15: 1094-7.
7. Gibbons RJ, Wada T, Fisher CA, Malik N, Mitson MJ, Steensma DP, Fryer
A, Goudie DR, Krantz ID, Traeger-Synodinos J. Mutations in the chro-
matin-associated protein ATRX. Hum Mutat 2008; 29: 796-802.
8. Gibbons RJ, Bachoo S, Picketts DJ, Aftimos S, Asenbauer B, Bergoffen J,
Berry SA, Dahl N, Fryer A, Keppler K, Kurosawa K, Levin ML, Masuno
M, Neri G, Pierpont ME, Slaney SF, Higgs DR. Mutations in transcrip-
tional regulator ATRX establish the functional significance of a PHD-like
domain. Nat Genet 1997; 17: 146-8.
9. Park DJ, Pask AJ, Huynh K, Renfree MB, Harley VR, Graves JA. Compar-
ative analysis of ATRX, a chromatin remodeling protein. Gene 2004; 339:
39-48.
10. Tang P, Argentaro A, Pask AJ, O’Donnell L, Marshall-Graves J, Familari
M, Harley VR. Localisation of the Chromatin Remodelling Protein, ATRX
in the Adult Testis. J Reprod Dev 2009. doi:10.1262/jrd.20221.
11. Gibbons R. Alpha thalassaemia-mental retardation, X linked. Orphanet
J Rare Dis 2006; 1: 15.
12. Muers MR, Sharpe JA, Garrick D, Sloane-Stanley J, Nolan PM, Hacker T,
Wood WG, Higgs DR, Gibbons RJ. Defining the cause of skewed X-chro-
mosome inactivation in X-linked mental retardation by use of a mouse
model. Am J Hum Genet 2007; 80: 1138-49.
13. Wada T, Sugie H, Fukushima Y, Saitoh S. Non-skewed X-inactivation may
cause mental retardation in a female carrier of X-linked alpha-thalasse-
mia/mental retardation syndrome (ATR-X): X-inactivation study of nine
female carriers of ATR-X. Am J Med Genet A 2005; 138: 18-20.
14. Badens C, Martini N, Courrier S, DesPortes V, Touraine R, Levy N, Edery
P. ATRX syndrome in a girl with a heterozygous mutation in the ATRX Zn
finger domain and a totally skewed X-inactivation pattern. Am J Med
Genet A 2006; 140: 2212-5.